Monodelphis_domestica Locus BAT2
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica BAT2
Monodelphis_domestica
BAT2
2
SNORA38
1303..1437
15147
GGGAGGAATTAAGAGGGAAGGTCCTGGGGTTGTGAGAGCCAACACTGGCCCAAGATAGG
GGAATTTCCAAGTGGTCCATAATTGCTTTATTTCTTCACAATCTGGATTTGGGAAGATAA
AGTTGACTGGTGCCTTACCCCAGAATCTGGGTCTGCAGTATCCTGGACTCTTCAGGGCCT
TGGCTATAAATCAGGCAGTTAGTCGTCGTTCCGGTAGTTTGGGTGCTTCAGTCAGAGAGT
GTGGGTGAACACTGATTGTTCATTTGAGCATTTCTCAGACACCAACCCCCATTCTGGCTG
GGCAAGCTCATAAAATTCCCAAACTCCCAGCATCCCTCTTTCCTAACCCTCCCCAGATGG
GACAGAAGGCATGCTGGGAATAGAGCCTGGGGCTCTGAGCCCTGAGACAGAGCTAAGGAG
TTTCAAACTGAATGGAGGGTTCTGGTTTGAAAAGTGATGGGACTGAGATTTTTGGTTTTT
TGAGCTATTGATTATTTAGGATTTCTCTGAAATAAGGATTAATGTATCTACTTCCTTTGA
GGGAAAGAAATGTTCTTGTTGATGGAATACAGAACTAAGAGAGAAAGAAGAGACTTGATA
TTTTCCTTAGAACTCTAAGATGAAGTTAAGTTTCTAATATTCCTTTCCCACCACCTTTAA
TAATCTATGGCTTTTCCTTGTGGTGGCAGAGGATGAGAGTAGGAAGATCAATGTTGAAAG
GTAACAGGATTTGAAATTCATATCTCCCTGACTGAGTTTGGATGGTATGAGAAACTTATT
TCATTGTCTGAAGGTGATAAAAAAGCTAAAATTTTAAATAAAAGAATGAGCTAGGGGCCA
GGATATCTTTGATTCTGAAAGAAGTGAGAGTTGGGCATAGCCCTCCTCTTTGGTTCCTGA
AAGAACGGGGAATAAGGTGCCTGGAACCCCACCTGCAGGCTCCAGCACGTTTCGGGGGAG
GCGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCGATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACATACA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGCCCTTATGGGAATGTTGCTG
TGGAGGGTGAGGGGGAAGAAATGATGGGAGTGCTCACGGTCTTTTGGGAGAACCAGACAT
AGTGGAGATATGGGAGGCCAAAAGGACACAGAAGACTTAGCAGGTCCACTCTAGGGATAG
AGAAGGAGGGGATAGATACCTGATTCTGGATAGGAGTTATTTTACCTCCCACAAAGGCGT
GTCTGTGGCTTCCCATCCATAGATACGTAAGAACTGGAGGCAAAGAAATGAGGATTAGGA
AAAGTTCAAGACTGGCTTACTCAACCCTTGCTGGTCTAGGACTTCCTGTCCAACAATAAT
TCTGAGGAGGTTAGAGTCTCAGCCCTAAATCCCAGAGATGAGGGTATTAATAGGTTTTGT
GGTAAATTGGGCCCTTCATCAAAGAGAGGTATAAATTGTGAGTGTTTGGCATTGGAGTCT
CCTAAATCTGAGCCAGTTCTCTCATGGGCTAGGTTGAAGCACTCCTGACCCTTTTCTACC
TTTCCTCTAGTTGCTCCTCGACATGGCTTACAGAGTCTTGGGAAAGTTGCCATCGCCCGG
CGCATGCCACCCCCAGCCAATCTGCCGAGTCTGAAAGCCGAAAACAAAGGCAATGACCCC
AATGTCTCGCTAGTGCCGAAAGACGGGACAGGATGGGCAAGCAAACAGGAGCAGCCCGAC
CCCAAGAGGTGTGGGGAACAGAGAAGAGATATTCGGACTTCAGCTTTTCTCATAGGGGAT
TTGGTGTAATAGAATTGGGGTTTGAACTAATTCTTTATGAACAAATAGGAGAACCAGAAG
CAAGAACATGGGGACCTGAAGAGGGTTGGGCCTGAGTTTTTGTCACACATGGAGAGAAAA
ACAGATAAAGGAACATGTAGCTTTCTAATTTTGATTGTGAAACTGTCTTCTCTAAATGAA
TAGGAGAGATGGCCTAACCCTTCTGTCCTTCTATCTCCCTCCAGTTCCGATGCCTCAACT
GCTCAGCAGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCCAGCCAACCG
AAACGCCCCCCAGCAGCCCCCGAGGTATTATTGAGAGAGGTTCAACCATATTTGGGATAA
AGAAGAAAGGCATCTGAGACCAGCCATTAGCTCACTTTTCAATTTCCTTTCTTCCAACAG
AACGCCCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCACAAGCCAGTGTCACCCATGGA
GCGCACGGGGATGGTAAGTTGGGGACATTGGAGTACTCTTCTGAATGAAGAACAGATTGT
GTATGTTTCCTTTTCAATGGTCCTTAATTTCCTCCTCCTGTTTAGTAACCCTCTTTTTAA
GGCCTGGCTTCCATGATGGTGGCCATTCCCTCCTTAGAGGCTGTCAGAGATTTGGTTGGG
ATTTTTTTGGTCATTCCCTTATTATTTAATCCATGTTCATTTCCCAAATCTCTCGTGTTA
GGCTTTTAAGGAAAAAATAGAAGATTCCTTACCAGAGCTAGCTCTCCTTGGGTGAAGGAA
CCCACATATCCACTCTGAATTAGGGGCAGGGAGAGAGATTCTAGTCTAAAATCTGATAAT
TTAGTATTTAACAGATGTTTGATGTGTTTGATCATACTGAGGTCTTTCTGTCCTTCACTC
ATCTCTTACAGGTGGAAGGGCATCAAACCTACTGTCACGATTCTCTCGAGAGGAATTTCC
GACCCTGCAGGCGGCTGGCGACCAGGACAAGGCTGCCAAGGAAAGGGAGTCTGCCGAACA
GTCGTCTGGGCCCGGACCAAGCCTCCGCCCCCAAAGTGTGTCCCATTTTTTTTTTAAATT
GATTACTACTTTTTAAATGACTGTTTTCACTACCCATTGTCCCTTCCTCCCCCTTTGCAA
GGGGTGACTCAAAATTACTTCTTTGTTCTGTTATTCTTGACCTATATGGTGTTTCCCATG
CATCCTTTCCCCAAAGGCCATAGTTTCTCTTCCAGAACCAGAGGCTGATGTGATCAGCTT
TGTTCTTGCCTGTTCTTTTTATCCATGTTCACTTGCTCTTGGTAGTTATGTCTCTTTGTT
TTTCTTTTCCTTTCTTTCTGTCTCTAACCCTCAAACTTGTAACAGATTCCACAACTTGGA
GGGATGGAGGTGGGCGGGGCCCTGATGAGCTGGAGGGCCCGGACTCCAAACTCCATCATG
GTCACGACCCCCGGGGGGGGCTCCAGCCCTCCGGCCCTCCCCAGTTCCCTTCCTACCGCG
GGATGATGCCGCCCTTTGTGAGTTGTGGGTCTTGAGAGAAGGGGATCTTGGTGGACTAGT
AAATAAGGGGATAGCAAGAGGGTTGGAACAGGTTTTTGGAAAGGAAGGTTGGAGGGGAGG
GTTGGAACTTTTGGATTCCCTTCTAAGCACGAGTTTTGGGACCTCTTGCAGATGTACCCC
CCATATCTCCCGTTCCCTCCTTATGGACCACAGGGGCCTTACCGATACCCTACTCCTGAT
GGGCCCAGGTGAGAGAACTGGGCTTGGACCTGGGGTGGAAGGGTTGTGGGACTGAGGGTT
AAGATATGTAGAGTTTGGGAGACTGGACAGACTGGGACCTGAGGGAAGGAGATGCATGTC
CTAGGAAACAGAGCCCCATTTAGAGGTGTAATCCATTCACATACCCTTAATGCAGCCGAT
TCCCCCGGCTGGCTGGCCCCCGGGGCTCAGGTCCCCCCATGCGCCTGGCAGAGCCTGTGA
GCCGACCCTCCATCCTCAAGGAGGATAACCTCAAGGAATTTGACCAGCTGGATCAGGAGA
ATGATGACGGTTGGGCGGGTGAGTGGAGAATCCAAGGAGAACTGGACAAAGGGAATCTAT
GAAACAGGATCTGCTGGGAGAAAAAAGCTAGGCTCAATGAGGGCAAAGTTAAGCTCTTTC
AGGAGTTTGGGGGGGTGGAAGTACCAATGGTGAAGAGTTTGGGTAATGAGGGGTGGTAAT
GGAGGTACTTTGAGGGGTCAGTTGGAATGGGAGACGATGGGGAAAGAGAGACGAGATGAA
AGAGGGAAGAACATCAGTCTTTACAGAAATTGAAATAATGTAGTATATTCATCTCTACTA
CCCCTTTTCTCCAAGTCTTGGTCCCAACCTTAAGGGGAATCATAGGCAAATGTTTCAAGC
CAAAACTACCAAGGTCCCAGTGGAAGACTGTATTTACCATCTGTGCCCTCTCCCCTCAGG
GGCCCATGAGGAGGTAGACTACACAGAAAAGCTCAAGTTCAGCGATGAGGAGGATGGTCG
TGATTCTGATGAAGAGGGAGCAGAGGGCCAGTGAGTGGGTGTGGAGGGTGGGGGCATTCT
GATTCTCTGAACTCTGAGCATTTGTGGTTCTTGGAGTAAATCACTTTTGGTCATGGGGAC
ATTTCCCTTGTTCCTCTTCCCACAGCAAGGAGTCTCGTCCTTCCAGTGAGGATCGGCCCC
CTGACACAGAAAACAAAAAGGGCTGTTCCTCTGGCAGTGAGCCACCTCCTCCCAAGACAG
CCTGGACAGAGACCTCCCGGCCTCCTGAGGCAGAGCCTGGGCCTCCTGCCCCTAAACCTC
CCCCACCCCCACCTCACAGAGGCCCCACCGGGAATTGGGGACCCCCTGGAGACTATCCAG
TGAGTTTTGACAAGAAGCATTGTGGAAAAAAGAATGTCTTTTCACGTGAAGGGAAATAGC
TTGTACAAAGTGCAGCATAGGTGTATGAGAAAGCCAAGATTGTTTGAGGAGAGGGCAGAG
CACTGTGTAAAGGTCCTCTCTATGTAAATCCCTTGCTTAGAACTTCTCTAACTTTGGGCA
AGTTCCATTCCTTTGAGCTTCTGTTTTCTCCTCTCTAAAATAAGTGAGTCAAATCAGGAG
ATCTAAGGCCCTTTCTAACACATGGTAGCATTCTTCAAGAATGTTAAAGGAAGAAGTAGT
TGTGAAGTCAAGAGTAAAATAGTGAGGAATGGCTGAAGATGGATTAAGTCAGGAGGAGGG
AATGTTTAGGTGATATGGTAGAATGATGGAGCCAGAGAGCTAGAATATTGGTGAAAGAAG
GGTAAAGTTATGCAGAAGTGAGTATCTGATATTTGTCTTCATCCTTAGGATCGTGGGGGC
CCACCCTGTAAGCCACCAGCACCTGAAGATGAGGATGAAGCTTGGCGGCAGCGTCGAAAG
CAGTCATCATCAGAGATCTCTCTAGCAGTAGAGCGAGCACGAAGGCGACGAGAAGAGGAG
GAAAGGCGGATGCAGGAGGAGCGGCGGGCAGCCTGTGCAGAGAAGCTCAAGCGACTGGAT
GAGAAGTTTGGGGCACCTGACAAACGACTCAAGAAAGAGCCTTCTGCTCCCCCTGCTGCC
CCACCTACCCCAGCTCCACCCCCTGCCCCCTCCAAAGAACCCCCAGCACCTCCTGCACCA
CCTCCAGTGCTAGTTCCACCTGCTGAAAAGGAGCCTGAAGAGCCAGCTCTGGTCCCTGCC
CCTGTCCAGCCTGCCCCTGCCCTGTCTTGGCTCCAGTTCCCACCCTGGTGAGCGGGGGCT
GCAATAGCAGTACTAGCAGCAGCAGCTTTGATGCTAGCCCAGGTATGGGGTACATAACCA
GGTGAATATTCCTAATTTGTGGGGTTATTTTGACTGGTTTGGGGCCAGGGAACAGTGGTA
GGATGAAAAAAGAGCCTTCTCCCCTTGTGATTTAGGAAGGGACAATTTAATGAAGTAAAT
AATCTCTTGAGTGAGTCAACTTGGAAATTGGTTTGGCAAGGAAGGTAGTAAGGGCTTATA
GAGAAGATATTAACATTGTCTTGGTGAACACTAGCTGTAAAGGGAGGGTTTCCTGGTTCT
GACTATAAGAAAGCTCTTCTTTGTTTTGATGGGAGAAATATGGTAATTGTTCAGCATAGA
TAAGAATCTGTTTGCCTGAGCCACCTTGATTTTCCTCTGTTTTCAATTTAGTGGAGCCTC
CACAACCACCAAAGGAAGGCCCTGAGCCACCAGAAGAGGTCCCCCCACCTACCACACCCC
CAGCTCCCAAGGTGGAACCCAAAGTTGATGGAGCTGGGCCAACACGACAGCCCCCTAACC
AGGGACTAGGCTATCCCAAATACCAGAAGTCGCTGCCTCCCCGATTCCAGCGTCAGCAGC
AAGTGAGCTTGAGGCCTTTTCCCTTAGGGCTCCCCATCTCTCCAATTTCACCAATGTTTA
CAGTGATCATTGACCACTTTCTGATATTTGTCTCCAATTTTGTCTGTATCTTGTTTCATT
TTCATCTAATTTAGGCTTTTGTTCTCTCCCAGTTTCTTTGGCCACTTGATGTTTCCAAGC
CTCGATTTCCTTCTCTCATTCATTCCACTCTCCACCACCTATAGACTTATCCCTGTGCTC
CTTTCTACTAATGGAATCGTTTGGGTTTTTCCCTCCACTTTTTCTAGGAGCAGCTTTTGA
AGCAGCAACAGCAACAACAGTGGCAGCAACACCAACAGGGTCCCACCCCTCCTGCTCCAG
TGCCCCCATCACCTCCACAGCCTGTGGCCATGGGTGCTGTGCCACCCCCCCAGGCTCCAC
CCCCACCACCCAAGGCCCTATACCCTGGCTCACTGGGCCGGCCACCACCAATGCCCCCAA
TGAACTTTGACCCTCGTTGGATGATGATCCCACCCTACATGGATCCCAGACTGCTTCAGG
GGAGACCCCCCCTGGATTTGATGTTGCGTTTTAGCGATTAAGTGATCTTAGTGAATGACG
TTTTACTGCAGCTGATGACTGCAGCTTTTTTTGCCCGAAGTCTTTATTTTCCCACAAAGG
TCTTCCAGAGGGTGCAGCTGCGTCCCCCCACAGGAGAGACACGCGCTCGTTTTACAAAAA
AACCTCAGACACTTCCCAGCTGTGTGACCCTGGGCAAGTCACTTAACCCTGCCCTTGCCT
AGCCCTTACCACTCTTCTGCCTTGGAAACAATATACAGTGTTGATTCTAAGATGGAAGGT
ATGGGTTTAAAAAAAAAAGTTTTGCAGAGTTATAAATGGTTGTACCCATTATAATGAGAA
TGTTGGTGCCAAGGACCCATTCTTTTTCCTAACCACCATCCCTTACGTCAGGTCTAGTTC
CTCGGGAGCGCTCAGATAGTGGGGGCTCAGGTTCAGAGCCTTTTGATCGGCACGCACCTC
CCCTCCTAAGGGAACGTGGCACCCCACCGGTGGACCCAAAGCTAGCTTGGGCAGGAGATG
TCTTTGCCACTGCACCTGCTGACAACCGCCCACTCACCTCCCCACTTCGACAGGCCCCAG
AAGAGGATGATAAAGGCATACGGTGAGTTGAGATGGGGAAGAAAGCCCAAGTCCTTGTAG
AGTTCATAGACTCAGCAAATATAACTTAAAACCTTTTTTCTGAGTGGGAATAATTGGTTA
GCCTGTTGTATGCTCTTGGGGAGAAGGGAAGGTTCAAATTGCTGCAAATAGTATCACCAC
AATAAATCCTAACTCCGTTTTCATATCCCAATATGCTGATTCTATACCTTTTTTTTTCTA
CTTTCCAATGTCGTTTTATTTCCATACAGGAGTGAGACCCCTCCAGCCCCTCCGCCACCA
CCCTACCTAGCAACTTATCCAGGCTTTCCTGAGAATGGAGCCCCTGGTCCCCCACTTTCC
CGATTTCCTCTGGAGGAATCTGGCCCCCCAGGCCCTCGTCCGATCCCCTGGCCTACTGGT
AATGATGAATCAGCCAAACTATCGATCCCACCCAAGAAGGAACCCCCTAAAGAAGAATCC
CAACAACTAGGGGGACCAGAAACTGGGCGTAAACCCCCCCGGAGTGGTGGGGGTGGGGGC
CAAGGCCCACCACCACCACGTCGTGAGAGCCGAACAGAAACCAGATGGGGTCCCCGCCCA
GGTAGCAGCCGCCGTGGTGGACCACCTGAAGAACCAGGAGCACCCCCTCGACGTGCTGGG
CCTATCAAAAAACCCCCACCCCCTACAAAGGCAGAAGAACTGCCTCCCAAGCCTCTGGAG
CCAAGTGATGAAACCTCTAAGGTCTCAAAACCAGATGCTCTGAAGGTCTCCAAAGGGAAA
ACAGGAGGCCCCAAGGATACCCCTCCAGTTGGGACCCTGTCCCCTGCACCTCGACTTCGT
CGGGATTACTCCTACGAGCGTGTAGGGCCAACTTCCTGCCGAGGCAGGGGCCGTGGAGAG
TACTTTGCCCGGGGTAGGGGTTTCAGGGGGACCTATGGGGGAAGGGGCAGGGGTGCTCGA
AGCCGAGAGTTCCGTAGCTACCGGGAATTCCGAGGTGATGATGGGCGTAGCAGTGGAACT
GGAGGACCATCCCATCCCCCTCCTCCCCGAGGTCGAACAGCCAGTGAAACAAGGAGTGAA
GGTTCAGAGTACGAAGAGATCCCTAAGCGGCGCCGGCAGCGGGGTTCGGAGACAGGCAGT
GAGACACATGAGAGTGACTTAGCCCCCTCCGACAAGGAAGCCCCTCCAGCCAAGGAGGGG
GCACCACCTCAAGTACCTGTAGCTCCCCCACAACCAGGAGCTCCACCGTCACCAGCTCCA
GCCCGATTCCCTGCTACCCGGGGCGGTCGTGTTTTTACTCCTCGAGGTGTTCCATCACGA
AGGGGTCGAGGGGGTGGTCGACCTCCTCCCCCTGCTGGTCCAGGTTGGAGCCCTCCAGCC
AAGTCCCTGGCTCCCAAGAAACCCCCACCTGGCCCACTGCCACCAGGCAAGGAAGCCTCA
AAGGAGAAATTAGTTCCAGGGCCTCTGCCACCCCAGGCTCGAGGTGCTGGTGGTGGCATA
GAAGATGGGGAGCGTCCCCGGAGGAGGAGGCATGGACGGGCACAACAACAGGACAAGCCA
CCTCGATTTCGGAGACTCAAGCAAGAGAGGGAGAATGCAGCAAGGGGGGCTGAGGGAAAG
GCTCCACCTTTGCCCCTTACCACCACACCACCTGGCCCTGAGGAAGTACCAACAGCAGCA
GTGGTACCCCCACCTCCACGAAGAGCAGCTGCCAAATAACCAGACCTGTCAAACCAGAAC
TCAGACCAGGCCAAAAAGAGTGGGAGACAGCATCAGAGAGCAGGATTTGCCAGCGAACGT
CGGGGAGACAAAGAGGCACCCCCACCTACCCTACTAGCCCCCAAGGTGGTGGGAACCCCT
AGCAGTGGAGGTGGAGGGGTTGGGGCAAATCCTGGGGTCTCCTCCATGCCCCGAGGTGAG
CTGAGCCAGAGAGCCAAAGACCTGAGCAAGCGGAGTTTCTCCAGTCAGCGACCTGGCATG
GAACGACAGAACCGGCGCCCAGGACCAGGGGGAAAGACAGGTGGTGGCGGAGGCAGCGGG
GTCCCTGGGGGGAGGGCTGGCCCTGGGCGAGGGGACAAAAGGAGCTGGCCCTCACCCAAG
AACCGAAGGTGAGTAGAAACCAATACTCATGCCTAAGGGTTAGGGTGGACTTGGTGGTAA
AGGGGTTGGGAATGATTTGGGCCCCTGCAGGGATTCAAGAACGAGGTTGGTTTAAGGATT
CCTAAGTGGAAGGAATAAGCACTAGAGCAGGCCCAGGATAAAGGTTGTTTCCAAACAACT
GCTCCCCTAGTCCCAACACACAAGACTATTAGGGAAGGGAAGGGAGCATTTGAGGGAGAC
TATAGTACCTGGGCTTTAAGGCAACAGAATTTAAAGAGTAATTTAGATAGATAGCTGAAT
GCTTGGGAGAGGGCAGGGGCTTGGCCAGCACTAGGACTGATGCCATCCACCCCCTACCAT
ATCCCCAGCCGACCCCCAGAGGAGCGTCCCCCGGGACTTCCCTTGCCTCCCCCACCCCCC
AGCAGCTCTGCCGTCTTCCGCCTGGACAGAGTCATCCACAGCGACCCAGCTGGTATCCAG
CAGGCTTTGGCCCAACTCAGCAGCCGACAGGGGGGTGCAGCTGCCCCAGGGGGCCCCCCG
AGGCCCAAGCCAGGGGCCCCCCCAGCCCCTCAGGGCCCCTCTCCCCGGCCCCCAGCACGA
TTCGAGCCCCCAAGGGCCAGCAGCAACGGTGTAGGTGGCACCGGTGAGCTGGGAGAAATG
GATTGGAGGTGGGGTGGGATGGTCAATACCTTTGTCACCAGAGGGAAAAATCCAAGTGGG
AGGTGTATGTATATATTGAGGGCCCAAAGTGCTAGGATCTCCTTTCCCCTACTCCCTACC
CACCCTCCCACCCTCCCCCACCCCCACAAAGTAAAGGTTGGGATGGTAAAAAGACCCTAG
GACTCTGGATCCATATGCTACCAGGTTTTCCCCATTTTTCTCAGAGCCCCACTTTGCGGA
GCCAGGGCCATTGGTGAGGGGGGTGAGTGGGACCTCCCGGGACTCTACTGGGGTTAATCC
CTTCCCCCCCAAACGTCGTGATCGGCCTCCTCGAAAGCCGGAGCTGCTACAGGAGGTGAG
AGGGGGCTGGGTCTATATTCTATTTTCATTGTCCTAAAGGTTTCTGGGCCTGCCCGCATC
CTGAGCTTTTGGTATTGTCTCAGTCTTTCTTATTTTCTGTATACCATTTACCTCCATGTT
ATCCTACTGCTTCCTGTCTGTCCTATTTTTCATCCCATCTTTTCCCCTCCACCTTCATTA
TCTCCTTTTTTTTTATCTTTCTCCCTGTAGGAGTCTTTGCCTCCTCCTCATAGCCCTGGA
TTCCTAGGTCCCAAGCCAGAGGGACCCAATCCACGGGGAGAGCCCAGAGATGCAGGCACA
GAGGCCCTGGCTCCCCATATCTGGAATCGTCTGCATACTAGTGAGTGGGATTGTGGTGGG
AGATGAGATTTTGAAATGGCATAAAGCAGGCTCCAGGATTAATAACACCCCATCTAACTT
TTCCCTCCTGGCCTCTTTAGCCGCCAGCCGAAAGAGTTATCGACCTGGCTCAGTGGAGCC
CTGGATGGAGCCCCTCAGCCCTTTTGAAGATGTGGCTGGCACAGAGGTGAGCAAGATGGG
GGAATCTGGGCATCTAGAGTGGGGATATCCATAAAGGCTGACCACTCTACTGCCTCACAT
TCAATATGATGTCTGTACGTGTTCAGATCTCCTATGTGTTCATCCTTCATCTGTCTGTCC
TTCGTCTATGGGGTGACTTGGGAAGACTGTATTTCAGTTGGAGACTGATTACTTTCTTCT
CCCCCATCCCATGCCAGATGAGCCAGTCTGACAGTGGGGTGGATCTGAGTGGCGACTCTC
AGGTTTCATCAGGCCCCTGCAGCCAGCGAAGTTCCCCTGATGGGGGACTAAAGGGGACAG
GGGAGGGTGCACCCAAGCGGCCTGGAGGCCCCTCACCCCTGAGCACTGCCCCTGGTGAGG
GTCCACCTGGCTCTGAACCCTCCGATCCTCCAAGGAGACGTCCTCCTGCCTCCCGTGATG
GGGACAAGAAGGTAACAGGGATCAAGAAAAGAAGGGAGGTGCAACCTGTAATACAGTCCC
TCACTTCCACCTTTGCCCTGAAAGGCACTGAGCACCCCTGATTTTAGTCTTTTTTGTTAT
CTTGCCTACCCTAGGAGCCACCTCTGCCCCCTGGCCCCATAGGCACAGAACGATCCCAGC
GAGCAGATCGAGGACCGGAGCCTGGTCCCCTTCGGCCCTCTCACAGACCTGGTCCCCCTA
TCCAATTTGGAACCAGTGACAAGGTTTGTCTGGAGCTGGACATTGGGAGCTTTGGTTGAG
GGATAGAGGATGGGCTGGAGGGAAAAAGTTCAGGAAGTTGATGTCTTTCCAATATCCTCT
TCTACCCTTCTGTGGTCTCAGGACTCTGACCTCCGCCTGGTGGTGGGAGACAGCTTAAAG
CCAGAGAAGGAGTTGCCACAATCTGGGCCTGAGGTGGTAAGTAGGTGGTGGAAAGGCCAG
GTATTTGGGAGAAGAGAGGATAATGCCTGGCTTCCTCATATGACATGGTGGCCCTTTTCT
CAGCCTGCTCCAGTACCTCGAGACTGGGAATTGCTCCCCTCTGGTCCCACTTCAGCTGAG
CCAACATCCAAAAATCTGGGCCCCAGCCATTGTGGCCCAGATCCCAACCCCTCGGGTCCC
CGCCTATACCCTGAGGTCTTCTACAGCAGCCCAGGGCCTCCAGGCACCCAGGTATGTTCC
AACCCCACTCCATCCCCAAAACACAACAAAACACCTTTTGTAGCATTCCTTAGATATCTT
TATCAGAATTCTGACCACCAGTCTTCCCTAGCTATTCTTTTCACCTAATTTACTTTTTGT
GTCAGGTCACTTATTAACTTGAAGCAATGCAATGCTTAGCACATAGCAGATTCCCAGTAA
ACATTTTCTGAATGAACAGATACTGTACTTGCTTCTCACAGGCACATCCTCATCACTGGT
TGTGTGATATCTCATGTAGGGGCGTAAATGGCCCTGCCAAGAGCCTTCCCTGCTTCACTT
TTTTCCCTCAGGTCCCAGGGGGAACAGTGGACTCTCAGCTGCACCCCACCAATGGTGGAT
TCCGCCCAGGGACCCCTTCGCTGCACCCCTATAGGTAAAGAAAGACAAGGAACCTAGGTA
CCTCAAGAAGTCAAAGTAGGGATTTGTAACTGAACTTGACACTTTACACCCGTTCTCTTT
CCTCCTCAGGTCACAGCCCCTCTATTTACCCCCTGGCCCAGCCCCTGCTTCAGCACTGCT
TTCGGGAGTAGCCCTTAAAGGCCAGTTCCTGGATTTCTCAGCATTGCAGGCAGCAGAGCT
GGGGAAGCTGCCAGCTGGGGGTGTCCTTTATCCCCCACCTTCCTTCCTCTACCCACCGGC
CTTCTGCCCCAGTCCCCTGCCTGACCCCCCTTTACTGCAGGTAAGAAATAGAATGTTGGT
GTGGGGCATCATGGTTGGGGATTTGGGGACCCTGAGCTATGAAGCCCCTTCTTTCAGGTG
CGTCAGGACCTGCCATCCCCTTCAGATTTCTACTCTGCTCCTCTGCAGCCTGGTGGCCAA
AATGGCTTCCTGCCCCCGGCTGCCCCCACCCAGCAGGTAGCACCCCATGTCTCCCTCCGG
TTGTATTAGCTGTTTTCTTTTCAGCTTCCCTTACAAGTCTTTCCATAGAGCTGGTCTTAA
ATAGCCTGTCTTTTATTTTCCTGCTTCTAGACCTTGTAAACCCAAGAAAATCTCATTTCT
CTTTACCAGGGTTTAGAGTTTTTTTCAGAATTTTCCTTGGCCAGACTTACTCAATTTCTC
CTATAGATGCTGCTGCCAGTAGTGGAATCCCAGCTACCAGTGGTGAACTTCAGCTCCCTG
CCTCCAGCTCCACCTCCTGCCCCACCTCCACTTTCCCTGCTGCCTGTGGGCCCTGCCCTA
CAGCCCCCCAGTCTGGCTGTCCGGCCCCCACCTGCTCCGGCAGCCCGGGTGCTACCCTCA
CCCGCCCGGCCCTTCCCTCCCAGCTTGGGGAGAGCAGAGGTGAGAGGCTAGGAGTTTAAG
GGGGAAATGAAATTTTAAATTGTGGAGCCTGAAAGCAGGTCCTGAGGTTTTTTCTCTCTT
CACCTTTCCCCTGTAGCTGCACCCAATGGAACTAAAGCCGTTCCAGGATTATCGAAAACT
GAGCAACCTCGGGGGACCTGGGGCTCGAACCCCCCCAGCTGGAAGGTGAGAAGATGGGAG
ATTTTTAGCTTACCCCATGGAACTAGTCAACTCTAACAATCTGCCCCTGATGGTTCTTCT
TCATTCTACAGGCCCTTCTCTGGTCTCAGCTCCCGACTCAAGGCCCCACCTACTGGATAC
AGTGGTGTCGGTGTCTTCCGAACCCAGCGCTTCGACCTCTACCAGCAGGTGAGGAAGATG
AGACACCCCTTAGCCACTTGTCCTGACCTGTAAAATAAATACTACCCAAATCCTAACTCT
TGCCCACAGTTTGGAAACTGGCCTACCCTCAATGATCCCCAAGTCTGTTTCTCACTCTCC
CAGTTTGACTCCATGTGTACCTGCCCTCAGGCCTCCCCACCGGATGCCCTGCGCTGGATG
CCGAAGCCCTGGGAGCGGGCAGGGCCACCCTCTCGTGAGGGTCCACCCCGGCGGGCAGAG
GAGTCAGGGCCCCGTGGGGACAAGGATCCTGGGTTGCCCCCGCCCCGCTGAGGGAGCTGC
CCCCCCCTGGGGCCTGTACATAGATATAAATATATAAGGGGGAAGGGGGCGGGTGGGGAG
GGGTTGTGGGGCTGGGGCCTCCCTCCCCCTCCCCCCTCTTCCCCTGGGCCCCTATCCCTG
GGGCCGTTTGTTTAAAAAAGAATAAAAGGATTTAAAAAAAATGTCCAAGTTGTTTAGAGA
ATGAATGTGAGGACAGATATTCCTCCTGAATGGCCATCAGAAGGAAAACGACAGAATTCA
TCCTGCTTCAAGCTCTTATTCCCAACTCCCAACCCCCAAAATGAGTTGGGCCATTGGGGG
GGGGGGCGGGTGGACTGCAATCAGGTAAAATGAAGAAAAGTAATAGCAATGCAGTACCCA
GCTTATAGAAGTTTGGGGAGGTGTCGACTTTTGTAGGGATAAAAACAGCCAAAGCCAGGA
AAATCCGACTTTATTTCTTAAATACTGTGAATGGGGAGGGGAAGAGAGGTCCCTGGGAGA
AGATGGTATGGGATTGGCCATCAAGCAAGAACCTAAGGGTCATCAGCAAAGGCCCTGTGG
GTATTGGGGAAACGCTGGGGGCTGTAGTTGGGATCATCTTGAAGTCGTTTTTGGATGTCA
GAACGGAGCTAGGAAGAAAAGAGCAAATGGGTTAAAAGCAGGGTAAAGGGCCCTTAGCAT
ATGCCAACACTTCCTTCCCCCTTTAAACTTGTGTTCCACTAGGATAGCCATTCAGGAGAC
AAATCTTATCCATCTTCCCCATGCAGATTGTATATGGCAATATCGTTCACCAGAGGCATC
CAAAATAATGACGGTGATCCGGCCCATCCCAGCTTATTTCCCCCTTGCTGACCTGATCTA
ATGGTCTCCACTTTGAGCCCACCCTCTTTTCCAAATGAACCTCCTGCCCTAGACCATTCC
ATTTCAGTTCTAGAAAAGGGAAGGACTGTCCCTAATGAAACTTTGCGATAAAGAATTTGC
TATTCTGTTTTGAGAGGGTGCACCTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1630..1807, 2084..2183, 2280..2352, 2771..2914, 3225..3376, 3531..3607, 3775..3917, 4319..4409, 4525..4738, 5208..5576, 5579..5681, 6051..6241, 6527..6802, 7172..7401, 7649..9095, 9099..9487, 9848..10107, 10355..10494, 10710..10839, 10940..11025, 11237..11470, 11582..11590, 11594..11722, 11841..11915, 12006..12170, 12491..12573, 12669..12879, 12957..13055, 13266..13478, 13576..13664, 13751..13847, 14010..14147
1001..1112, 1630..1807, 2084..2183, 2280..2352, 2771..2914, 3225..3376, 3531..3607, 3775..3917, 4319..4409, 4525..4738, 5208..5576, 5579..5681, 6051..6241, 6527..6802, 7172..7401, 7649..9095, 9099..9487, 9848..10107, 10355..10494, 10710..10839, 10940..11025, 11237..11470, 11582..11590, 11594..11722, 11841..11915, 12006..12170, 12491..12573, 12669..12879, 12957..13055, 13266..13478, 13576..13664, 13751..13847, 14010..14147
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved