Monodelphis_domestica Locus BAT1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica BAT1
Monodelphis_domestica
BAT1
2
SNORD83, SNORD83
2324..2399, 4377..4455
9601
AAGTATTTGTGGGGACCGTAGTGTAGGGAGAATGCAAATTACTGCCCAAAGCAAAACTA
ACTACGGTACCTTTACTCCAGGGTCCCCTTAAGGAGCAGTTGGGAGGGGCAGGTTTCTGG
GCCCATTCTCTGTATAAACTACCAACGGGTTCTCTTCCCCTCCCCCCCATTTGATTCCAT
CTAGTAAAAAAGGTAGTGGATAAGGCAATCTATTTCAAAGTTAGAGGGGAAACGTGATAC
TCTATTGATGAAGAAATCCTATCTTCCCTTGCCATTGACGGAGAACAATGTTTTGCTCCC
TTGATTTAGAAATTCTCCACCTTTGGTCGGTTTCTGACCAAGAGGGACTTGGACAGGCCG
GGGATTGAGTAACAGCCGGCAACGTGGTGTGCCCATTTTAAGACTAGAACTATCATTTCG
TGCTATGATCAAAATAATCTTATCACCTTTCACTGGTTGCTGCAGGTTTAGGGGTGGGAA
GAAGTTACTGGTTCAATAAGTTATTATATATTAATGTGTCTGTAGTTACTCCCTCTCTCC
TATCCCCCCATTTTAAAATTTTCCTTACTCTTATGCAGTTCTGAATTATCCACTCATCCT
TCATTCTGCAGTTCTCTCAGGCTTCTTGTCAGTGTGTCATCCGTACCGTTGGTTTACTCT
GGTTCCTAAATTGCTTATTTCAAACTTTGGTCTATAAACATTTGATCTGGAGGAGGATCA
ACCCACTTGTTCCTGCCCCCAAACTTCAGCTTTCTATTGTTTCTCAGCTTGTTTTTCCTC
TCTCCAGAAGAAATATTCCAAAATTTGTAGAAAGGGGAAAATATGGAGAAAACTTGAGTT
TGGTGGGAATATTTTTTTTAAGCCATCTTCTTTCTCCCATCCCTATTTCCCCCAGTTCTC
AACTCTGAAGCCAATTTCTTCATCTTCCCCTGCTGCTCCCTGAATCTCTACCACCCCAGC
TTCCCTGCACTGAAAAGAACCAATCTAGACATCCCCTTCCCCTGACCCAGCCATGGCAGA
GAATGATGTGGACAATGAACTCCTGGATTATGAAGATGATGAAGTGGAGACAGCAGCTGG
GGGTGATGGTGCTGAGGCCCCTGCAAAGAAAGATGTCAAAGGTTCCTATGTCTCCATCCA
CAGCTCTGGCTTCCGTGATTTTCTACTTAAGCCAGAGCTCCTCCGGGCCATTGTAGATTG
TGGCTTTGAGCATCCATCTGAAGGTAAGCATCTTTTCTCTTCTCCATAAGTCTAGGGACA
AAGAGAATCCAGGAACAAAATCTTTGAGGGAATAGGACATGGAGTTTTGAGGAGTGGGGG
CAGAGCTGGGAAATTGTTACGAGAATTAATGGAAACAGAAGTGTAAGGGTTTCTAAAGTG
AGATGGTAGGGAATTAGACTTGAGTATGGGGATAAAACAGTGTAGAAATGTCTGTTGAAC
TAGAATGATGGTAGATGCAGCAGGAGATAATTGGTGTAGTGAGAGATGAGGATGGGCAGG
TAGAAATGGGATGGGAGAGATTATGATTGAATTTGGTAGGATTTGTGAGAGATAGAGGTC
TATGGTAGAATAAAAAAATAGCAGAATAAGATAAAAAGATTCATTTCCTGAAGTCTGGCT
GAATTTCTAGCCTTGCCTAATGACTATGGTAATAATCCCATAATCCCATTCTTTAGGGAT
TAGTATTGCCTAATCATACCACTACTCTGTCTTTATTCAAAATCATTTCTTTCTGCCTTT
CTCTGATAAAGCATAGGAAATGTCTTATGGTCAGAGGACTGGAACAGAAACCACCCAGAA
ATGTAAAACAAAAGGGAAAGGGAATAGGCATTAAGTGCCAGGTACTATTAAACAATTTAG
TTATCTCTTCATGGTAATCTGGATTGTAGGTGCTACTGTTATCCCCATTGATGAAGAAAC
TGAGGCAGATAGGTTAAGTGATGTGCACAGGTTCGTTCAATAGTTAGTGTTTGAGGCTGG
ATTTGAACTTTGGATTTTTCACCACCTAGTTGCCTTCTAGCAAATATTGGAATTGGTTCC
TTGTTACAGACTTAAGAGATTTTAGGGGTTTGGGATGTGTGTCTGGGAGGGAGACCCACC
TCTAATCCATCATCTTCCCTCTTTTTTCCCCAGTCCAGCATGAGTGTATTCCTCAGGCCA
TCTTGGGAATGGATGTCTTGTGCCAGGCCAAGTCAGGCATGGGAAAGACAGCTGTGTTTG
TGCTGGCCACGCTGCAACAGCTGGAGCCAGTCACCGGTCAGGTATAAACTATGTGGGGAA
CAATAAGGAAGGAATATTGAAGGGAAAGACATATTCCTGTCTAAGCCACATGATGTATTT
TCAGAGACATGAGCACTCAGTGCTGAGATGACCTTTATCTATCACCCTTGACTGATGGCA
GATGGGATATTGGGGTGAGAGGTGGGGATTTTCTGACTTTAAATTGTAGAGACCTTTTAA
AGACCAAAGTAACTTAAGGTTTTTGGTTTAATTGAGATTTATTTTTTTTTAACTGTTTAT
TGAAATTCTACCTAGTGCTTAGAATTGTACGAGGCAACACTGGGGGAAAAAAAAATGAAA
AATGAAAGACAAGATTGATGTCCTCAAGGAGCTTGTGGTCTGGTTTGGAAGACCAAACAT
ACATTTGAAAATAGTTTAACAGATATGATTCTTGAAAGTTCATAAGGCACTTTTGCTTTC
GAGTGCATAAGAGGCACTTAAATTGTTAGGTCTCAGAAGTAGAATTGTTTAATATGCTTA
GTTATATTTTTCATTATGGTCTTCCTCTTCTTAAAAAAAGGGCAATTTACTAAACATTTA
TCTATTATCCCCTGTCTAAGGTTTCTGTGCTGGTAATGTGTCATACTCGGGAGTTGGCCT
TTCAAATCAGTAAGGAGTATGAGCGCTTCTCCAAATACATGCCTAATGTCAAGGTAATTG
ATGGGGAGGAGACTGGATTAAGGGGAAAAATTAAGGGTGGAGGAAAAGTAGTAATAAGAA
TCTGCCAGTTGTGTTGGGGAACATAATAGAAACCAAAATTGAACCAGAAGTCACTGAAGA
ATAGATACTATCTTTAGGTATGTGCTACATTATGTAGTAGACAGGTTCCTGAAAAGTTGG
ATGTAGGTGAGATTTTCATTAATTTGATTTTGTTTCCTTAATAGATTGCTTTTATAATGT
CCCCTAAAAATCTTTTTTATCTTCTTTACTGGGTGGATTTTTTTAGTGGCCAGGGGCTCT
TACTATGTTAACTTAGGTTAGTCCTCCCCCAGCCTCTTTGTTAAGCAATTTATGAGCTAG
GATATAGTTAACTCCATTATCCTGACTCTGCTTTTCTATTGCTCTTGTCTTTAAGTCACA
TTAATGCTCCTTGCACTTCATTATACTTAGGTCTTTTCCTTTCTTGTCCACCATTTGGGT
TGTTCTAGGAGGTGGTAGTATGGATGAAAGCTTAGGTTGTGTGGTGTGGGAAGGTTTTAA
GCTCTCTATCCCTAATGGCATATGTGGACTTGGAAGATACATGATGTCTTCATTCTTTAG
GATAGCAGAAAATTGAGTCCTGGCTATCTGGACCACTGGATGGATGGATGGCCTAAGAGG
TTCCCATTATATTTTCTCACTTAACTGTATTGGAATAGAAAGCATGCTTAGGTACAGATG
AGTTTGCTTGATTTTACTTCTTCCCAGTCAGAGCTGGGCTTGCTCAATTGGTTGGGGTAA
ATTAAGTCCATTAACTTGCAACAGATCAAAAGCTCTGCCTTTCAGTATTCTCTGCTCCCT
CTGTACATTCACTCTAACTTCAGAGGAAAATAGAACTTTTCAGAATTACAAGGAGAAGGG
TATGGAAAGAACACTAGATTAAAGGTCAGAAGATTTGAATTCTAGTTCAGATTCTTCCAC
TGGCTAACTGTACGAGTGAGCCAACCCTTCTGAGTTTAGGTTTCCTTATGTTCAAAATGA
GAGCATTAAGATAATTTCTAATGTTTTTACGTGGCAGTAAGAAAAGGTTTTAGCCAAATA
GGGAAGAAATCAAGACTGGGAAATGGCTGTTTAGGAAATGAGAAGATAATTACTCTATGG
TGACCTTCTCAATTCTGAATGGCAGGTGGCGGTATTTTTTGGTGGTCTTTCAATAAAGAA
GGATGAGGAGGTGCTGAAGAAGAACTGCCCACACATTGTCGTGGGGACTCCAGGCCGTAT
CCTGGCCCTGGCCCGAAATAAGAGCCTCAATCTCAAACACATTAAACATTTTATCTTGGA
TGAGTGTGACAAAATGCTCGAACAACTCGGTGAGTGGAAAACCTGAAGAATAGAGGGATC
ACAGAACTGGGTCTATACCTCATGGAAATTAAAGGTCAGGGTATTTGACCTTTTAGAGCC
ACATGATGTGTTCATATTAAGATGGAGCACCTTGGTGCCAGGACGACTTTTGATCTATCA
CCCATGACTGATGGCTCTGGGCTCCGGGAAGCTGGCATTCTTTGGATATCTGTGAATATT
TTCATTGGTTCTTGATAAAAGGGGATCTGGGGAGTCCAAGCAAATCAGCATGGTGCTTTG
GGATGCTTTAGTGATGGGGATAATAAAGAGAGAATGGTTCGGGCCTTTTCTTTCTATATG
TTAGAGAAGGGGGTACCTTCATCCCCTAGAGAGAACTTCCCTAATCTGATAACACTGTGT
ACTGATTATTTTGCCTTATGTTTGAAATGCTAGGATTAAAGGAAGTTGGCTTTTAGGATA
GGTAGGAAGAGAGCAGAATTCAGTCAATAATAACCAAACTTCTGGATAGACTTAAGTTTT
AGATATTGGGACCAGGAAGCATCCTTAAGTTGCCATCTGAATACCAAATTCAGATATTGA
GAACTTTCTGGGAGGGGAATTTTGAGCAAGATTTGTAAGGAGCAGTTGAAGATAATTTAA
TCGAATTAAGCTCATGTGTTGGAGTGAGATAGCCTGTTACAACCAAAAGTAGCATACTGG
ACAGGGAACCAGATAGTAGTCTCTTGCTTTCTTCATATTGGAAATTACCCTTTTCCTTGT
GATTCTATACTACCCCTTAAAAACTTTTTTCTCTCTCTTTTTTTTATTTTTATAGACATG
CGTCGGGATGTCCAGGAAATTTTCCGCATGACCCCCCATGAGAAGCAGGTCATGATGTTC
AGTGCCACCCTGAGCAAAGAGATCCGCCCTGTCTGCCGCAAGTTCATGCAAGACGTAAAT
ACCCTTCTACCTTCTCTCCCTCCATCCCCTGCCCGAAGCCTTCTCCTACTCCCTCTCCTC
GACCTTCTCCAGTCTACCCTCTTCCCTGTCCTCCCAGTGCTGAGATGGAGTCATGTGACC
CCCCAGGGCTGAGTCCTCCCTGGAAAGACAGAGATAGAGACAGCCAGTGATAAGGTCTGC
GCGGGTGCCAGGGAAACTCCGGAAGACTTGGTCGGGATAAACACGAGAGCGGGTAGAATT
CAAATAAACCCCCAACAAAATAAGAAAACCCAAACAACAGCAAAACTCTTTTTCCTTTTG
GCAGGGTGGGACACACTGTCCCACCCCACCACCCACTATTTCCCTTGTCCCCCACAAGCA
CACACCCTCAAGGTGGCATCGAGCACAACTGGGGCCTTTTGGTCCCCCTAAAAACTCAAA
TCTCCCCAAAACCCACATTTCCTGGTGACAGGAGAGCGAGAGAGGGACAGACAGACTTCA
GGGCATGGCCAACAGAAGAGCAAAAGTCAAAAATGAGTCTGCCCCCTCCCCACCTCCAGG
GGTGGGGGCCTTCGGCACCTCAACCCCCGACCCTTCTACTCCTTCCCCTCCCTTTCCTCC
TCCTCCCCCATCTGGACCCTCTGGAGATGTGAGCCAGCAGCAGAGACTCAGCGCGGCGGG
GGATTGCGGATGTCATCCAGCATCGGAAGGCGGCAGCGGAGGCCGCAGGAGAACCGTGTC
CAGGAAGCAGAGGACCAAACCAGCCTTTTTTTCCGTTCCCGGTTTTTTTTTCCTGAACCT
TACGCGTACCGCGCTCCCTTCGCGCCCATGCGAGTTGCGGGGGTGCTCCTGAGTGGGTGG
TGGATTTTTTTGGTTTTTTGTTTCCTTTTTTTTTCCGGGAGGGGGAAAGGGCAAGGTAAC
AAGTGAAGATCTTTACTTTGCTGAAACCAGGTGGGGATTGGGGGTTCTAAAACTGGAAAG
AGAGTAGTGGGGTAAGGCTTGGGGATGGGGATTTATTTATATTGCTCCCTTATGTGGGAT
GCCTCCCTTGTACTACTACCCTCTGTGGGTAATAGAGATGAATTTCAAGGAGGCTTCTAA
ACTGCTCCTAAGTGGGCTTGACCATCAATTCCCTGGCAGAATCTAGGGCTAGCTAGAGAG
GATGGAGAAGCAAATGGGGATTGAGGCTGAATCTATTATTACCTTGTAGAGATTTTGTCT
TCCCCTTCAAGGGGATATATAGTTCAAGAGCTTTAAAGGAGAATTCTTATATAATAATAG
GAGGTGCTACTCTTTGCCTGAACATCTTTATTGCTGGGGTTTATTTAATTTTAGCTTCTC
AAGGAAGCCAGTCCCTTAAAGGGGTCTTCCTTCTTAGGTGGTTCTGGCTAGAAAAAGTGA
TGCAATCTTTCACTTTAAGTTACCTCCATTTCCTTTAAACCAGCTCTTTAATGTAGCATC
CTAATCTTTAAGAGATTTGACCATCTCCCCCTAAGTCAACCTTCCATTTTTACTGTTTCA
GATTTATCTGATAGTATCATAACTCTCTTTAAGATTTCTCCCACTATTGCCCCCTTTTGG
CTGGCAAATTGAGGTGATGTTGTCTAAATCATCTGAATAGCCTCTTGCCATAGTCTCACC
AGAGGCCATTAGTTCTGTCCATTGTCCTTTTGCCTCGATAGTGCTTTCCATGGGTGTTTA
CAACATCCCAGGACAGCTTTTACTTAAAACCCTATTTTAGAGAGAAGAGACCATGTTTGG
GAGGCTGTGGGGTTGGAGTTGGGAAGGGAACTTGACATCTTAACTCTCTTCTCCCCATCC
CATTCATGGGGTGTATTGGGAGTCGCCTATCCCCACCCCCCCCACCCCCCTCAGGTTTAA
CACCCCCACTCTGCCCTCCCTCCTCCGTCCCCTCCCTTCCTCCCCCCCAGCCAATGGAGA
TCTTCGTGGATGATGAGACGAAGCTGACGCTGCATGGGCTGCAGCAGTACTACGTGAAGC
TGAAGGACAATGAGAAGAACCGAAAACTCTTCGACCTCCTGGATGTTTTGGAGTTCAACC
AGGTCAGCTAGGTGGGAGGAGAGAGGAACATGAGGGAGAAAAGTCTGAAGGATAATATAA
ATGCCAGGAATGCCCTTTAGGGGAGGCTAACCAGTTTTGATGCCAAGTGAATTCTCTTCT
GCTTGGTCTGGATCTTTTGTTATTTTATAAATATGAGGAGTATCTCATCTATCTTTGCCT
TTCCTGACAGCTATGACATCTTTTTTGTTCTCTGATGGCAACTTTCTACCACCCCATAAC
TTCCCTCTGGTTTTATCTTGTTTTCTTCTTTTTTTTCCTTTTTCTTTTTTTAAACCCTTA
CTTTCCATATTAGAATCAATACTAGGTATTGGTTCCAAGGCAGAAGAGTGGTTAGGGTTA
GGCAATGGGGGTTAAGTGACTTGCCTAGGGTCACACAGCTAGGGAGTGTCTGAGGCCAGA
TTTGAACCTAGGACTTCCCATCTCTGGGCCTGACTCAATCCACTGAGCCACCCAACTGCC
CCCTTATCTCGTTTTCAAGATGAATGATAGTTCTCTGAATCAAGTGAAGTAGATGGAGTG
AAAATAGACTGTTTTAAGACTGTCAGAATAGCAAGAGCATGTAGTTTGGTGGTTCAGGCA
AGAATTGGATCTGTTGAGGTAGGATGGTAGAAGCCTTGGCCCATTCCAGGAGTATAACTG
AATCCTTTTTCCTTATCTCACCACAAACAGGTGGTGATCTTCGTGAAATCTGTGCAACGC
TGCATTGCCCTGGCCCAGCTCTTAGTGGAACAGAACTTCCCAGCCATTGCCATCCATCGT
GGGATGCCCCAAGAGGAGAGGTGAGCAAGGTCTTCGAGGGATGGGGTGATGCAGGAGAAT
ACCAAGGGCAATTTTCATATCCTTCCCTGCACTCTATCCCCTGTCTCCACTATCAGGCTG
TCCCGGTATCAGCAGTTTAAGGATTTCCAGCGTCGTATCCTTGTGGCTACTAACCTTTTT
GGCCGGGGCATGGATATCGAACGAGTAAACATTGCTTTCAACTATGACATGCCAGAGGAC
TCAGATACCTACTTACATCGGGTAAGCCTCATAGTTGGGTGATACTTTTTAATCTCTTAC
CTTCTGGCTTTCTAGCCCCTTTCTCACCTTTCTTTGCCCCATATCCATCTTTTCTGTACT
GTCTCTTTCTCAGGATATTCCTTGACCTATATCACCTTTCTCGTCCCTAGGTGGCTAGGG
CAGGCCGGTTTGGTACAAAGGGTTTGGCTATCACATTCGTGTCAGATGAAAATGATGCCA
AAATCCTCAATGATGTCCAGGATCGCTTCGAGGTCAATATCAGTGAACTGCCTGATGAGA
TAGACATTTCTTCCTACAGTGAGTATTGGACTTTCCCTTTTGCTAATTAGCTTTTATCCT
ATGATCTCACTTCTCAGCCTTTTTTTTTTAAGTCTTAATGTGTGTCTTGTCTTTTTATTA
ATTCTCATCAGTTTCCCCTCCCCACCTTTCTTTGTATAATTCTTTCCCCCTATCATTTCC
CTTCCTATCACTACTCCCACCTCTAACCCTATCTTAATTTCTTTCTTTCTTTTTTTTCTT
TTTTTTTTTTTAAATTTTTCAGTCGAGCAGACTCGGTAGAGGCCTTGGCCGTCCCTGGAG
TATGATACCCTCTCCCTCCCCAGGAGCCGAACACCCGGGCGTGGGGGTGAAGGAGACACT
ACTGCCACCTACCCCCAGCCTCCCGCCCCAACGGCCCTGTTCACGTCATCCCCCAAAATC
CCTCATTGATTTGCCCTGTCGGATTTTTTTTTAACAAAAACTAAAAATGAAACAAAAAAG
TGTCTTGAGCATTTGTGAGGGTTTTGTTCCTTTATTTGAGGGGTGGCAATGGGTGGTGTC
TTTTTCTCTTCAACTTTGGGGGTGGAATGGAGGTCACAGGGGACTGGAAATAGGATTATT
GTGAAGGAATTCAGTTTACTAGAGACTAGCTTATCCTTAGTACCCCTTCCCATTCTTAGC
CCTCCTCAAGAGAGCATTCCTATTTCCCCTCATTGGGTGTTCTCTCTGCTCCAGGAAAGA
AGGGAACAGGATAGGACCCTGGAGGGGGCAAAGGGGTTCTTAGAAATGTTGACCTGGGTT
CAGCCATTGAAGGAAGGTAAGGGAAGGTTCCTTCAAGCATCACCTCCCAGGCTTTCTCGG
TGCCGCCTCATTTGCTCCTTGAGCTTCTGGATCTTGAGCACAAGGGCCTGAGCTTCCCAT
GCCCCTTCTTGCCCCTCCAGCAGGGCTTGGTACAGCTCTAACTGCTGCTCAAGCAGTTCT
TCTGCCTGGGCCAACTCCGCTCTTCTGTGGCCTGGACCCTGGGGGAGGATGCAGAGGGTT
CA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1222, 2133..2260, 2840..2932, 4105..4288, 5095..5213, 7130..7261, 7950..8059, 8156..8308, 8435..8601
1012..1222, 2133..2260, 2840..2932, 4105..4288, 5095..5213, 7130..7261, 7950..8059, 8156..8308, 8435..8579
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved