Monodelphis_domestica Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica GNB2L1
Monodelphis_domestica
GNB2L1
2
SNORD95, SNORD95
2579..2646, 7697..7764
9851
AATATATCATTCTGCTATAAAAATGACAAAGGATGAGTTCAAAGAAACTTGGAAAGAAT
GAATGGATGCAGTACTGTAAGCAGTCAAGAGAACAATTAAAAAGACAAAACATTGTCAAT
TTTTTTCTCTTCTATTTTTAATGGGTTTGGGGGGGAGGCAAGAAAAATGATGACGATGGT
GACCCCTCTCCCCCAAAAGGACGATTAAAACATTTTTAAAAGTATGCAGAGAGCGGAAAG
AAAAGAGCAGGGTAGTACTAAAAAGTGATTACTTTATTACATATTTTTTAAAAGGAAGCA
TTATGAAAAACTCAGCTTCGTGCATACTTTTTATTTATTCTATTTTGCATACAAATATGC
TCCTATTTTCGGGGCATTAAAACAGAGAAACAGCCAGCGCAGGAGGCAAGCTCCCAATCC
TCAAAGTGCCTTTTTCAGCTTCACTCTATCTTTAGTAACAATGTGGGCCCCAGTCTACAT
AGCGAAGTGGTGCAAAGACGCGGCCCCATGACCATTTGCCACACAATTTTCGCTTTTCTT
ATTATCAAGGTCCTTCCCTCCGCTCTCAGTACCTAACAAGGCTTTGATATTACCTCTTTG
TAGGCTTCTATTCTGATTCTGCTAATAAAGGCCCTAGTAAAACAACAAAGAAGTTAGAGG
GGCGTAAAAAGTAAAAACGCCAAGCACAAGGAAGCGGCCATGATGTTCCGCTGCGCCCGA
GGAAATACGTCATGACGCACGTTCGTTTTGCCGCCCCCGAGGCACCGACCCTCTTTCTCC
TATTGGCTGTTGGACAACACCGCCGCCATTTCGTACGGAAACGTGTTACGTACGTCGCCA
TTTTGAACAGGGTCCGGGAACTTAGGGTATATCCGATTCCGGCCGGAAGCTGCTCTCTCT
TTCCTTGCTGGGCGGCTGGCGTGAGGGAGACCTGGCTCACCTCTCTCCGTGCAATCTGGA
TCCATCCTTCCTCCTGGAGCGATCCACTGAGTTCTTGTCATCATGACTGAACAGATGACC
CTTCGGGGTACCCTTAAAGGCCACAATGGCTGGGTGACCCAGATCGCTACCACTCCTCAG
TTCCCAGACATGATCCTGTCCGCCTCCAGAGGTATCGCGCCCCGGATCATGCTTACCAGG
GGCTGGGGGAAGGTTAGGAGAGACCAGGGAAGATGAGGGAGGGGAGGGGTGGCGATGGTG
GTTTAGGTAATTGGGGATTGTGAGAGGAATGTCTGCTTTTGTTAAGGGAATTGAAAGCAG
GATTCCACGCTAAGGGAGGACGGGCCATGGAGTTCAGGCGGGGAGGGGAGGGGGAGAGCA
TTTGTGCAGGACAGTCACTCAGCCCAGGCTGACGCGCCCGAAGCTCCCGCGTTGAAGGAA
GGCGGGGGTGGGGAGGTACTTTGGGAAAAGTTGAGAAGAGCTCACTTTGTGGAGAGAGAC
GCGACCTAGATGAAACCACTCTCTTAAGGGAGATGGGGACCCAGAATTGTCCTTGAGTAT
CCCAGAAAAAGGTGGGGAGGATACACCTAATAGTGTACTCATTGCTTGGGGCCGGGGGTG
GATATCAATGGGTTGTGCTTGTTGAAATTTTCCTTTCGGGTTCAGGATAGGGTGGAAAGA
AGGCTCGTAGGGACCTCCCTTTTGAAAGTTGGTAACGTCCGTCCCATGGGCCTTGTCGAG
ACGAGGTGATTGTGGTAGGGGTATACTGAAATAAGGGAGGCAGGCTGTCACTCATTCAGT
CTAGTCCTAGCTCGGTTTCCTGCTCTGAAGACCTACTTTATCTTAACACCCTCTCCCACC
CTAGGCATACCTGAGGCTCAGGTTTACTTAGAATTGGCAGGAAGGAAGGAATTAAGCAAT
GTATCTCCTACCAAGTGCCAGTCATTGTGGTAAAGCTCATTTGATCCTCACTACAGCTGA
ATGCTTCATCCCCATTTTCCGGATAAGGAAAGAAAGTACCCAGGTCAAGTGAGCGAGACA
GGATTTGAATTCGGGTTTTCTTGACTCATACTGATCTCTGGTTCCTCAGGATTCTTTAGA
AAGGAGTATTTGCTTTGAATATAAGGACCTGGGTTCAAATCCTGACTGCTTCCTGTGTGA
CGTGTCCCGGGCATCTCTCCTGCCCTGTTTCTTTATATTGTAAATATGCAATTGGACTTG
ATGATCTCAAAGATTCCCCTCAACTTTTATCACTAGACTGTAGACTCTGAAAATTTAATT
TTCGGTCCTAGATGGAGTTGAGGCTCCACCATAAAGGACCCCCGGGAGGTTATCCTAAAT
TTCTAATGCTATTACCTGACTTTTGTTCTGTTCTCTATCTGTATGCCTGACTTTCATACT
ATAATTGAAAGATCACAAAGAATTGTTTTCAGACTCTGATATCCAGGTCCTTGAAAATAG
CGGGCACACTTGTTAAGTTTTTTTTGGAATTTTGCTAAGGGAGAGTTTTAAGATTTGCAG
AGGAAAAACAAAGTAATTTTAGGCATTAGGAAAATCTTGGGTTGGGGAAAGGAATGAGAA
AAGAGGGAAGTTGTGGGGGTTTTCTTCCACCTTAATGGAGGTTTTCTGGGACCAGAGGAG
AAGCAATGATGATTTTCTAACATGCCATCTGATGCCTATGCTGAATACAGAGGCTGTTTC
TGAGCTTCTGCCTTGTTCCTTGAGTCTTTTCCATAGTGGTTCAGTCGGCTAGCTTTCATT
AAGCATTTGTTATGTGCCAGGCACTTTGATCCTTTTAGGAATATAAGAAAGGCAGGAGAG
AAAAGCTTAAGTGGTTTTGCTGTTTATGTTGGCATTTATATAATGCATGATATGCTCTCA
CAACTAGGCATGTAAGAAATTTTGGTTGCAGAAGGGATTTCAAATACAAGTTTCTGACTT
GAGGTCCAGTGTGCTACACCATGACTTTTTATATCTCAACAGACAGTTCTCCTTTTGGTA
TACTGATAATATTGAAAGGAGTGCTGGGTTCCGAATCGGGAGACCTGACTTCTAGTTGTT
CTGTAACTTTGGTTAAATCACTTTAACCTCTTCAGGGTTAAAAATGAAGGAAAATCGGTT
TAACACAGCAATATTATTGAAAGTACATATGACTGAGACTAGGTTTTCCTAGTGTTCTCT
TCAAGTTTCCCTGATTTTTCTCCTAATTAATGAATATTTGTGAAGGTACTTTTGTATTCA
GAGTACTGCTAGGCCTTGGTTGATAGTCTTTGTGGAAGAGTTGGCATTTGAGTCAAGCTT
TTGTGGATGGATGAAAAATTGAGGTAAATATAGGAAAGAGACTTAGTCTTAGGAAGTGAA
AAAGTACAAGGAATGTTTGGGAAATAATGTAGTTCAGATTTCTGGCACATAGATGTAGGA
AGGAATATGAGACTGGGGTGGTAGGTGCCAGATCTTAAAATTCAGGCAAAGGAATTTCAA
CTTTTACTTTGTGGCAGAAGGGAGATACAAGAAGACTAGAAATAGTCTAGTGTGCGGTTA
AAAAAAGGCATATAGCTATGAGAAGAGATGCCAGAGATTGGGGAGAACTGGTCTGAGCTT
CTGGTCTTATTGGGCCATTTTTTTTTCCCTGAATGTGCTAAAGCAATTAAGTAAATGTTC
CAGAAATTGATTCAGAAAGAAGGAAAGTTAGGGATGAGGAAACATCTTGAACAAAGACAG
TAAAGGGAGAGGGAGGGTAAGCATGGAATTTCTTAGACCAAGTACCATGAGGGCAAGGAG
AGTTCATGTTCATTTTCTTAACAACAGGTAATAGTCCTTTCTCTGGATTTTGTGGCAGTC
TTGTTTTCCATGCCCTCTTTAACTGTTCTGTTTGTCTATCTTGTCTTTCCATTAGTAACT
CCTATAACATCCACCAAGTTTTGGGCAGCACTCAGTTTCTGTGAACAGAGAGACATTCTT
CCACAGATCTAATTTAAATTCCTTGTAAAGGCACAAATCCACATTTCCTCATTCTAGTCT
TTGAAGAAATAAGTTACAAGAGAAAAGTAGGTAATAAATATTTCTTCCATGGCTTTATAG
TTATTTAACTTGTTTTTTTATTTGTTCTCTTTTATCTAGACAAGACCATCATCATGTGGA
AGCTTACCAGAGATGAAACAAACTACGGGATCCCCCAGCGTGCCCTCAGAGGTCATTCAC
ATTTTGTCAGTGATGTGGTCATTTCCTCTGATGGCCAGTTTGCACTCTCAGGCTCCTGGG
ATGGCACACTAAGGCTGTGGGATCTCACGACGTAAGTACCTACTTGAATGGCTACCGCTT
GGGGTAGGTATTAAACCTAAGTTCTTACAAAAGGATATGTAGGATAGAAGAGGGGAAGAA
GTGGTCTTAGAAGGGCCCTAGAATTCTATAAAGCACTTATGTGTTGTGTCACTTAACTCC
ATTTTGCCATCTGCAAAATGATCTGAAGTAGGAAATGGCAAACCACTCCAGCATCTTTGT
CAAGAAAACTCTAAATGGGATCACAAAGAATCAGACACAACTGAATGACAGAATTATGTT
GTGTGCTCCAGGTGCCCAAGTGGGATTGTAGTTTGAATAGGGAAGATAATGGCTTAAGTA
AAAAAAACCATTGCTTACTTGAATTGGACTTTTAGCTTTATTGGGGTTGAGCATAGTTGT
GGCAGGTAACTAAGGTAGTTTTATGGCCTGGATGAAGCCAATGAAAAAATGGCAGCTAGG
AAAATTGTCTGGAGAAGAATTCTTGAGGTCCCGGTGATGAGACAGATGACATTGTCAGCT
GACCCCCCCCTCGGGACTGAAGACAAGTCCTGCAATTCTGATGGGACCTTCAAAACTAAA
CATAGATATTGTTACCAACAAGATTTCCCAGTATTCTCTCAAGCCTCCCAACTGCCTTAT
TGAGAACAGAATTAGGTGAAACAGACATGGTTGACAGCATCTGACACTGTATAGAAGATT
CCATACATATCTTTTCCCTACTCCCCTAAATCCCCAAATACAGGGGAGAAAAAAAAGTAT
TTCATTATCTTCTGCTGGAAACAGTATTGGTCACTGGATCTAAATCTTCAGCAAAGGGTT
CTGGTTAGTCTAAAGAAGGGGCTGTTTTTTGTGGTGTATTATATAGGAGGCTATGTAGAG
GAGGATTGTGGAAGATTGTCTTGGGAGAAAAGGGATTCATATACTTTAGAGGAATACTGT
CTTCCCATCTAGTGGCACTACTACCAGGCGTTTTGTCGGTCACACCAAGGATGTGCTGAG
TGTAGCCTTCTCTTCAGACAACCGCCAGATTGTCTCTGGTTCTCGGGATAAGACTATCAA
GCTGTGGAACACCCTGGGTGTCTGTAAATACACTGTGCAGGTAAAAAGTCAGCATAGGAT
TTATAGCTCTATAATATATGTATTTCATGTCAAAAAAGACCTGAGGTTTGATTGTACTAT
AACTTGAATTATAAGTGTAGTATGGTTTACCCTACCCTGCTCCATCCCTGCACCCTCCCT
CTGTAATAAAATGTGTGCTATCTGGACCAGTAGTCAATTTAATATTGAGGTTTTGTTAAT
GCAGAGTATTTGGCTGATTATACAAATCAGCCTCTGCTTTAAAGGCTCTTGTACACAAAT
AAATATAGATGTGTGAGTTCCTTTCAGACTTTGCAGAGTTTCTTCATATTTTGAGTAAGG
AGTAGTACAAATTGACTTCTGTCTCTGAAATTCCATTCTATAAGGTATGGTGGCTGTGAG
GGAGGCAGTATACTAGTATGGGATATGAATTCAGATGGGGTGGAGTTACTGGTGTTACAG
TAAATTTATGGTTATATTCCCTGCTTTGGTACATGCATGAATATGATAGGAAGCATTTTC
TCATCTACTCTAGATCCCTTTGAACCAACTATGATTGTAAGAAATATAAGTCAACAGAAC
CACCTCAGCCATATAATTAAAGACAGGGACAGTAATAATTGTGTCTAACTTTGATTCTGA
ATATCCCGCAGGATGAGAGCCATTCAGAGTGGGTGTCCTGTGTCCGTTTTTCACCTAACA
GCAGCAACCCCATCATTGTCTCTTGTGGCTGGGACAAACTGGTCAAGGTGAGAATGATCA
AAGTGGATCTAAGTGTTGGCCTCCTAGTATGTTCTTAACCGGTTTCTGATTTTGGTAGTC
TTATTGGTTAAAATTACATTACCATCACTATTTCAAGGTCTTCACTTGAAAATATGGCTA
AAGATACACTTTCATTGCTTTGTTTTTATGTTACCATCAGTTTTCTTCTGAATTCTTATT
CTTTGGTCTTTATAGTATAATTCAATTATGTTTATATGAATTTGTTCAGTTACATAGTGT
GGTAGGCCACCAATTTTATTTCATCTTGCTAGAGAAAATATTGCTGTGAATGGTTGGTAA
ATGAAGCTTTACCTCTTTGATCTCCTGGAGCTAGTTGCCAGTTATATCACTACATTGAAA
GGCTACTAATAATTTAGACATTTTTCTCTTACAGTTAGTTGCAAAAATTATGGTCCAAAA
TGGTTGGAACGATTCTTAGCTATAGTGTATTAATTGACTTATTTACTGAACATTTTCTGG
GACTTCATATCAGCTTGGAGAGTGAGGCAAAACATTTTGATTTAAGTTATGGTTGTATTA
ATAGAATATTTTCATGATGGCTGACAATTTCTTTATGCTTCATTCTTTTGAGGAATAGCT
CTTGAGTTTCCTTTATGTCTTGGTTCTCAAACTTGTTTGATTTGATACAAAGATGCCAAC
ATGCCACTCAAAACTAGGAAATCCCTAGTTAAAATATGAATGGTTCTTGATTATTCCTAT
ATTGAGTATGAAATTCAAAAGCTGGGGTTAACATTCCCAACTCTGCTTTTGTCACCTAAG
TTAGGAAATAACCTACTTTATCCAGGTGTTGATTCTTACACAGCTATAAAAGGGGGGAAA
TAATCTTTGTGCCACTTAGCCTACTACTCAGGATGAAAGGATAAAATGGTATGAATGTGG
TAGCTATTAAAGAATAAAAGTTAGTCATGAACTGAAGCTATGTTACTTTTATCCCATAGG
AATACAAATCTATTCCAAAACTCAAAGGAGGCTTTTCCCTTGTATTATCATAGTTTGCCT
CTGATCATCTTCTCTTTTCTTCCATATCCCTAGGTCTGGAACTTGGCCAACTGCAAACTG
AAGACAAACCACATTGGCCACACAGGCTACCTAAATACAGTAACAGTTTCTCCTGATGGC
TCTCTCTGTGCTTCTGGAGGCAAGGTATGAGAACCTGTTACTTTGGATATATCATTTGAT
CTTTTAGGACAGCTAGGAGAGTAAAATCCTGGTTCCTTCAACATCTGTAGAAACAGGGGA
AATGACAAGATTTGAGGTTTCATAGGCAGTTCTAGAGCTGAGGGTGAGGGGTGGTAGTGG
GGTGGGGAGGGGGAGAAAAAAATGAAATTAAATGGGCTGATTTGTAGTTTGGATTTTAAA
GAAATGAACTGTATTGGAATATTCTTGAATTCTCTTTAGGATGGTCAGGCCATGCTGTGG
GATCTTAATGAGGGCAAGCATCTATATACTCTGGATGGTGGTGACATCATCAATGCCCTC
TGCTTTAGCCCCAATCGCTACTGGCTCTGTGCTGCCACTGGACCCAGCATCAAGATTTGG
GTAAGTGATGGATTTCAATTCAAATTATCTAGGTTTCAGAGAAATATTGGTGGAAAAGGT
CCTAGGGGGCCATGGTAGAGCTTTGATGAACCCTAACATGCCATCTGACTAATCTTGCTG
AAACCCAGAGGCTGTTTCTGAGCAATCTCCTGGTACCCCCAAGGTCTGAAATTTGGGAGG
GTTTGGGGTGTTGCCTGAACTGGTAGGGAGCAATCTTGTATGTGTATGTCGTTTATCTGA
TGGCCTTTAGAGGAAAAAAGCACTGAAGTGTCTTATGGGATAGTTTGGTGGATTGTGGAG
TCTGATACCACCTGCCTTTCTAGCACTTAGTTGCAGCCTCTGTAAGCAGGGGTGGGTGGG
TGGGTGGGGTGGGGTGTTAAATACCTATTTGACAAGGTTATGAGACTCAAAGGACTGGAT
GTATAATGCTTTGGGAACCCTAATACATAATGTAATTCTAATTACTGTTAATCTCAGGAT
CTAGAAGGCAAGATCATTGTGGATGAGCTAAAGCAAGAAGTGATCAGCACCAGCAGCAAG
GCTGAGCCTCCCCAGTGCACCTCCTTAGCCTGGTCTGCTGATGGCCAGGTAAGTCTTCCT
TTCTGCCTTTCTTGACAGGGTTGATTGTTTGAAGAAATCCATGGATACACTGGGAAGGAA
TTGTTGAGTGGTCCATGACTCTGTCCTTGAGCTTGAGTGGATTGCTTAGAATTTAATTTA
TTGGAGAAGTAGCACACACAGAACAATGGGAAAGAAACCTTGGGTTTGAATATTTTGAGT
TCACTTTTCTGGAAAATGAAAGGATGGAGAGAAACACATCCTTTGATTTGATCGGCCTGT
TATTTTGGGGGCCATTTAAGTGCTTTTAAATGTGCTAGTTCCTGGCCTCAAGGAACTTAT
ATTCCAGTGTAAGAAAAAATACATAGAAAATTAAATAGAAATTGTATATTAAATTTCTGA
GGGATGGCACTATCAGCTGGGGTTTAGAATAGGGTTCCCATATGGAGTGTGGACTGCATT
CTAGGCATGAGGATGGTCTGATCTTAAGACATGTCAAGGATGCACTTGGGGGTACTGTTA
TTATGGTATTATAGAGTGAAAGAGAAGGGGCCTTTTATCTTGTGATTTGTGTGTGTGACA
AATGATATTTGTCTCTTCCTGCAGACTCTCTTTGCTGGTTACACAGACAATTTGGTGCGG
GTGTGGCAGGTGACCATTGGCACTCGGTAAAGGAGTCAACCATAACTCAGATTTTGAAAT
AAAGACCTTAATTTCTGCCTTTTGAAAAAGTGAAGTTGTATTTTTTTTTTGATTGGTTGA
TCTGGCTTCTCAATCTGGACCTCTGCTCTGAAGACACTTCCCGCACCTTCCTATATGTCC
CTGACAAGAGAAGAGGATTTAGTCTAAAAGCTGGCAAGTGGCTTTTGAGGACAGATTCCC
AAAGTCACAAAAGATGATGGGGTTTACCGAAGAACACAGATTTTTGAGGCAGAATCATTG
GCTCTGATTATAGTTAAGGAAATAGAGAAGAGCAGCAAATGCTCATTTTATGGAGTGTGC
AGGAAGTGGTGGAAAATAAGTTTTTCTGTACAAGAATATGGCATCCTTTTAGCTGGCCCT
CAACTAGCATTGAACTTATATATATATATGTGTGTGTGTGTGTGTGTGTGTTCTCAGTTA
ATTTTGAGACTTGAGCTAATCTTATATATACCAAGCCATGAAATCCAAAGACATGTAAGT
AGAGAAAATAATACTTTTCACACTTAAGGATGAAAGTATATTCATGCAATCGCTTTAGGA
AATATATAGTTTGAGCTAGTAATAAGCTATTTGTGTTTAGAAAGTAAAATTGATTATTTT
AAAAGTCAAGTTGAAATTTTTATTGGATTGTTACTGCTTCCCTGATAATCTCATTAAGTA
AATTGGGAATGGGGGTTGATTATTTGGATGTCCTATGAAGGCCTTCCACTAGTGCTACAT
TTGGAACCCAATTCTCTGCTCAACAACCTAGGCTTTCTGAGCACAAGTGAAGTTATGGAC
TGCTTGACAAGGGGGTCGAATCGGGAGTCTTCCATACAAAAAGAATTCATGTTAGGTGTA
CCTTTAAAAGATGGTAACTGGGGCCTGACGGGCACTTCCTCGTGAGGATTCAAATAGTAT
GGTAAAAACCAGTGGAATGGGTGTCATGATCAGGGTTTGGATTTTGACTGCCCCTTACAG
TGTGGCCTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1110, 4059..4230, 5172..5319, 5951..6046, 7113..7223, 7479..7619, 8097..8207, 8784..8851
1002..1110, 4059..4230, 5172..5319, 5951..6046, 7113..7223, 7479..7619, 8097..8207, 8784..8846
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved