Monodelphis_domestica Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica EIF4A1
Monodelphis_domestica
EIF4A1
2
SNORA48
2373..2516
6790
TGAAACCATTCTGGTTGGGATGGGGGGGGGGATTAGGTTCGCTGCACTACATTAACTCT
GAGGGACATGCCACCTTCGATCTGGTCATTTTCCCGAATTCCAAGATTAGTACCAAAAAC
TGGGAGGGGCAGTTTGTAGAGGGAGTTTGCCCGGAGTCTAGTGCCCAGCGGGCGGATCCC
TCTTGCCTTTTGAGAAGAGGAATGGTGAACTGCAGAGAAGTTGTTCCACTTTTCTTTGGG
GGAACATATTGGGGTGTGGGCAGGCGACACCATTTTTCGAAAAGGGGTCCCAGGATGTGG
CTCGTTCCACCCAGTGGTACAGAGGGAGAGAAATGGCTGCTGGGTAGTTTGGATTCGAGG
ACTTTGCTTATACAATAGAAGGGGACGAGTATGTGCTGCTCTGAAATTCTTGACCCATTC
TGTGCCTTCCCCCTTCCATTTATTAAGGGTTGTGCAATTCCTCCCCTCCCCCCCTTACCC
AGCTTGGCTTCATTGTGCGCGAGGCCGCTACTGCCGGAGGCCTCCCACATCCGGGCACAC
AGATCGGCGCGGTGGAGGGGAGGAGGGGTCTGGGCGAATCCACNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTGGACTAGGCCGTGTGCAGAGGCTGCCCTTCCCAGCCACAT
CCGGGCGATCTGGGGGGGGGCAAGAGCTCTGTCTTGCCCGGCTTTTCCCCCCTCCTAATG
AAAATGGGGTAGGGGTGGGGCACCATTTTATCAGGCCTTAAGAGAACATTAAGCTCAGGA
GGTGGTTCCTGGGGAAAGATCTTGTAAGCCCTGTTTTTGATGGGGGGAAAGCTAATCAGT
GGATTGAGTGAAGAAACAAATTCCCCTACCTCTCCTCTTGGGGAGGGCAGAGGAGAGGGG
TCTTTTAGGGGAGAGGCTGGGCCCTAAGGCTCCTAGGGACAGCCTATAATTCTTCCATCT
CCAGATCCAGAGACAATGGCCCTGATGGAATGGACCCTGATGGAGTCATCGAGGTAATAT
GATTATCTACATTGTGTTTTGCTTTTGTCTACAACTTAGCTCTTACTATCTCATAGGGCA
TCAGGGTGTGGGGCATATTTTTGCTTTTCTCTCTTCTCCCCCATCTTATTAAAATTCCCC
TAAACAAATTTTTAATTCAAGGGGGATTTGTTTTTAAACAATAATATTCTGGGGGGGGAG
GAGGGAGATAGCCTTTTCACTGCCCATCTTAACTGGCACCTTATGTCATCTGAGACATAA
GGGCCCATAGGATAAAGTTTTGTTGAATAAACATGCAGTTCCTTTGGGAGTAGGAAAATT
TTTGATATACTTTATAGGGCGTGGAACGTTATTCATTGGTTTATTTCCTGTGTTGTGTTC
TGATTTTCCCACAATAGAGTAACTGGAATGAGATTGTGGATAGCTTTGATGATATGAACC
TCTCAGAATCTCTTCTTCGTGGTATATATGCCTATGGTTTTGAGAAGCCATCTGCTATTC
AGCAACGTGCAATTCTTCCTTGTATCAAGGGTAAATTTTCTAACTCTTGTTCCTAGTTTG
AAACTTTTTTTTTAACCCCTACCTTTCACCTTGGAGTCAATACTGTACTGTGTATTGGGT
TTGGGGCAGAAGAGTGGTAAGGACTAGGCAATGGGAGTTAACTTGCCCAGGATCACATAG
CTGGGAAGTGTCTGATGGCTGATTTGAACCCAGGACCTCCCATCTCTGGGCCTGACTACC
CACTGAGCCACCCAGGTGCCCCCTGATACCCTATTAATATCTGTTGTGAATGCTTTCCCT
AAAAACCATTTCTGTATTCTGTTCTTCTAGGTTATGATGTTATTGCTCAAGCCCAGTCTG
GGACCGGGAAGACTGCTACCTTTGCCATTTCCATTTTGCAACAGATTGAACTGGACTTAA
AGGCTACACAGGCCTTGGTTTTGGCACCTACTAGAGAGCTTGCTCAGCAGGTAAGACTTC
TCCAAGGTTAGGTTAGGTAGATCAGTCCTTGTTCAATTTAATCCTATTCTGCCTTAGGAA
TTAATTTGCCTTAGTAGGCAAAAAAAATTTTTTTAAGTAAAAGATGTAATGGGTAAGGTG
ATAGTTGGGTATCCTGATTATTTCAGGTGTGCTTCCTTCTCTTAATTCAATTGTCCCCCA
TAATTAAGGGCCCCTTTTTTCTGCCTTAAATCCAGCAACCAACGCCTCCAATTTCCTGAC
TCAGAAGAGAGTTAGCATTCTGGGTGGAGCATGGCAGTCTGGCTGGGCAGGTTTGATGGC
CATTTTCTTGCCGGCCATACACATTTTTCGCCACACCCCTGACACTGGGTAGAGAGACAC
CTGGTTGGTGGTGTTCTTCTCATATCAGTCAGGGGCATAGCAACTGTATAGTCCAAGTTC
ATCCCAGCTTGATGCTTTGCTTGGTAGTCATAGCTGGTTCATGCCCTGGGCACATAACCA
TCTCTTAGTCTTAGGTTTCCAATTCTATTTAAAGGAGGGAACCCGAAAAGTGATAGTGTC
CAACTCTTGGTTACTGTTCTGTTATTGATTTCTTCCATTAGAACCAATAAAGTAACTTCA
GTGAAACTTGAAGTTAAAGGAAATGGGGAAAGTGAAGTAATGTCCTTCAGTCAAAGGGAA
TATAGCTTTGTTCATGCCAGGTAGTAATTCACTGAAAGCCAAAATAAATCCAATCCCCGT
GTGGCCTGTCTACTAGCCTTCCATCTGGAATCTGGCTAATTCTAACTTGGCAATGTATTT
TAAAATTGCATTTGGAGGTGGTATTTATCTCTTTCTTTAAGGAGAACAGAATACATAGAT
AACATAGACTAATTTGGGGAAGATTATTATGTTGTGATTTTTTTTCTTGGACCCAGATTC
AGAAGGTAGTTATGGCATTGGGAGACTACATGGGTGCCTCATGCCATGCCTGTATTGGAG
GCACAAACGTTCGGGCTGAAGTTCAGAAATTGCAGATGGAGGCTCCCCACATCATTGTGG
GCACCCCAGGCCGAGTCTTTGACATGCTTAATCGGAGATACCTATGTGAGTATTACTTAC
CATTTATGCCCCTTCTAGGTTTCCTAGTTCAAGGTGTGTATTTCCCATTTGCTCTGTGAT
GATCCCCCATGCGTGTCATCTGAGCTCAGCTTCCCCTGATCTCTCAGTTCCAAGTGGGTG
TTTTGCCCTCTGGTCTCTGGGCTGGCAGTGGCTTCTGGGCACATGATCATAATTTAACCC
TGAGAGCAAATTGTATCAGAAAATTATTATGGAGGCTTGGGGTTTATGGAAAAGGAGAGT
TTCAGAAGCCTTCTTTGTTTATCTTGCAGCTCCTAAATACATCAAGATGTTTGTTCTGGA
TGAAGCAGATGAAATGTTGAGTCGTGGTTTTAAGGACCAGATCTATGACATATTCCAGAA
ACTCAGTGGCAATACTCAGGTATGGGGAACAGACTCCCAAGTATCTTTCCTTAATCAGTT
AAAAGCTGTTTAATCTATTGTTCTTCTTGCCTCACCCATTTTATAAATGGTGAAACTACC
CTTGGGTTGTGGGATAAAGAGCTAAGTTTTAGATCTGTTTAAGTTCACATTAAGTAAGAA
TGACAACTGTACATATTACTCTGTTTAATCCTGAGTTTTATTTGAGAAAGGGGGAAATGA
TCTTATTTTGCAATGTGATTCTTCTATTTGGAGATCTACACAGAAAAGTGAGGGGGGGGG
GAGGAGTGGGGAATGGCACTAAATGATGACAGGCTAGTGTGGATTGTGAGGTGTGGGTTA
TTAGAGAGGATCCTGGTGATTTTCAAGAACAGGGCAGAGACCAGAAAAATACTTAAATTT
CTTTTTTTTTTAAGGTGGTACTCCTGTCAGCCACCATGCCTTCAGATGTGTTGGAAGTGA
CCAAGAAGTTTATGAGGGATCCTATCAGGATTCTAGTCAAGAAGGAGGAATTGACATTGG
AAGGCATTCGTCAGTTTTACATTAATGTGGAACGAGAGGTGGGACCCAATGGAGAAAGGT
GGTGTGTAGCCAGGGGAGGGAAGGATTCTGTCGAGATTCTGGAGCACTGGCCCTGACTGG
TTTCTTCCCCCAAAGGAGTGGAAGCTAGATACCTTGTGTGATCTGTATGAAACGCTGACT
ATTACCCAAGCTGTTATCTTCATCAATACCCGCCGAAAGGTGGATTGGCTCACTGAGAAA
ATGCATGCCCGTGATTTTACTGTCTCTGCAATGGTGAGTTTCTAGGTGTTGCCTTTTGGT
ATCACTTCCACTGGACTTTGAGAGAGCTGATTTTTTGATGTATGCAGGTTCTGCAATTGT
TTCCATTTCTGGGAGTCTGAGGGCTGCCACAGGGGGAAACTGAGTGAGACACTGAAATCA
GGACCTGACCAGGGATGCAGAAGGGAGGGGGTATGTGAGATTTTACCCCCTTCCTTTACA
GTTGGTCACCAATTTTGCCCTTGGGAAGGACAACTGCCTGTCTACCATTCCATTCTGTCC
AGGAACAGACTGAGAGCTCAGGGGGTCAAGCTGCTGCTTATATAGCTAGCTGTATGAGTG
GAATGGAATGAATGGTGGACCAGCAGTCTAAATCTAATTTATTTGGCTTTTGTGCCCACA
GAAAAATCTCATCTTTGTCTCCCCACAGCTTCATTCCTCTCCTGAGCACATGCTTGGTTA
TTAACCCCTGTGACAGCTCTCAGGACCCCTAAGACTCCCCCACAAATGAAACAATCAGAT
CCCCAAACAAATCTGTCCAGTATCCTTTTATTACTAATCGCCTGAGTCTATTCTTACTTG
ACCTTTTTTGTTCTTTCCCCAGCATGGAGACATGGACCAAAAAGAACGTGATGTTATCAT
GAGGGAATTTCGCTCAGGCTCCAGTCGGGTGCTTATTACCACTGACCTATTGGTGAGCAT
ATAGGAAAAGTTTGACAAAAGGGGCTCACTTAATCCCAAGGAGATTTCTGTCCTTTGCCT
TAACAGTGTAACTTCTTATGGTGAAATAGGGCAGTGGGGAATGTTTTTGACACCATCTGT
GCACAGGACCATTGATTGCCTTTGCAAATTAAAATTATCCTTGATCCAAACTAGGCTAGA
GAGCACTCAAGTCATTCTGACCTAGTTAGAGACGATCTATAATGGTTCTAGAATTATTTG
TAATGTAGTTGTAAATTTTTTTTCTTCAGGCTAGAGGCATTGATGTTCAACAAGTATCTT
TGGTTATTAATTATGACCTTCCCACCAACCGGGAGAATTACATTCATAGGTAAGTAGGGC
AGAAAACTATCCAACACCTCAAGAGTATTGAACTAGATGACATCTTTGGGGATAAAAATT
TTTTTATATGAAACAACAATTTGGGCTCCAAGGTAAGAGCTGGACAATGGGCAGTGGGGG
TGTATTAAGTGACTAGCCCGGGGTTACACAGCTAGGGAAATGGCCTGAATCCAGGACTTC
TTGTCTCTAGGCCTGGCCCTCAATCCTTTGAGCCACCTAGCTGCCCACCACCAGTCATTG
CCTTTTGATTTATTCCAATTCTAAGGTTTCTCAGCTTGCTCTTATATTCTTAAAAACTAT
CCCCAGAATTGGCCGTGGAGGGCGATTTGGTCGTAAAGGTGTGGCCATCAACATGGTGAC
AGAGGAAGACAAGAGGATCCTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGA
GATGCCTCTCAATGTGGCTGACCTCATCTGAGAGGCTTCCCCACCTGATTTCACCCAGGG
CCCTGTTCTCTGGGATGGGGGGAGGGGGAGCTGGAAGGGAGGGGGGAACAAGGGATGGAC
ACCTTTGTCATTTTTTCCTTTTTTTTTTTGACTTTGAATAAATGTCAATTTTTGAGGCAA
AAAGGAACTGTGAACCTTTAGACACCCTTTTCTTTGGGGCAGGTTTATGCCCTTGGCGCC
GACATCTCCCTTAACTCCAAAACACTAATTCAACCCATCACTGTTTCAAGCCAGTCTGTC
CCCCATTCCCAGCAGCCAAATACCTCTCTCCCAAAAAGGTAGTTGAGAGGCAATGATTAG
CCATTCTACCCCACTCCCTGTTCCTGGACAAAATTTGGGAGACTATCCCCTCTCCCCCCC
ATGAGGCTAGAATGGCTCAGTGGGTTGGCTCACCCTCCCAGGTAAAGGGAGCAGGGGAGA
GAAAGTAGTCATTTTTACGTTGTTTTGTATAGTATTTATTGATTCAGGAAAAGAAACCAC
GAAATTCTGAATAAAATTACTTGGAAACTGCCTGTTTGGGCTTCTTATTTTTTTTATCTC
CCCTTTCCTCAACCCATATCCTGGGTAGTATTCACAGGGGTGTCTCTTTTACAAGGTTAT
ACATACTCTTTACCCAGGGTTTAGGGTCATCTACACATAGTATTTTCCACCCTAGCTCTT
CCCTTTTTTGTTATTCAGCCATGTTGGACTTCTTTGTAACCCAGTTTGTGGTTTTCTTGA
GTGATTTGCTGCTTCCTTTTCGATTAAGGACTTGCCCAAGGTCCCACAGCTAGTGAGGCC
TGATTTCAGGTCTGTCATGGTCCATTGTGCCACTTAGTTGCCCCAGTTCTTCAGCCTACA
AATATCCCTTACCGCTTAAAGCATGACCATTGATCTGGAGATGAAAGACTTGTATCTACA
AAACCAGAAGAAAGGAAGGTGGGAGGGTATATGATGCAAAAAAAGGAAAAACCACACAAA
TCCCTTAGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 1457..1589, 1890..2029, 2936..3104, 3389..3498, 3914..4057, 4155..4292, 4882..4971, 5249..5328, 5646..5790
1001..1072, 1457..1589, 1890..2029, 2936..3104, 3389..3498, 3914..4057, 4155..4292, 4882..4971, 5249..5328, 5646..5787
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved