Monodelphis_domestica Locus UBAP2L
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica UBAP2L
Monodelphis_domestica
UBAP2L
2
SNORA58
24829..24968
42723
TGAGTAGTTAGAATTAAATCTATTCAGGTTAGAGTGAGCTTTCCATATGCTGTTCTCTA
ACTCCTATTAGCGCAGTCAGGAGATGACTTTATAGTGCTTCCCCATACAAGTAAGACTGT
GTTAGGTACTTTGGTCTTTGGCTAATTCTGCAATTCTGGGTTGTTCTGCTTCAGAAGAGC
TGTGGAAAGTAATAATGGCAGTTGTGAGCCCTAAGAGTTTGGGGTTTGTTGACCAGCAGG
TTAGATGGAGAAGCAGCTGCAAAGACAAGAAACAAAGATTGCTGCTGGGAGAGCTGGTGT
TCCAGGCAAAGTCACTGGAGTTAATATGTCTCTTTTGGAAGGCCTTAGTTTAAAAAAAGC
CTCCACATCATGTGTACAGATGGAAACTTTAAAGGGGGTGGGAGGATTGGAAAAAGCGCC
TGGATTTCAGAGGTAGAGGTTATGTATTTCTTTAGGTAGGAGTACTTTGAACTGATTTTC
TTCCTGTGAGTGTGGGTTAGTGATCTTTTTGGAAGGACTCTACTTCTACCTTTTGGTAAT
TCTATAGTTTTAAGGCATTTGAGCAGACTCTTATCTGTGTGAAGGGGTTGGTCTTGGGGA
GGGCTTTTTGCTTTTTTGTTTTATTAGCAGGTTGCTTAGGCTTACAGATAGCCACTTGCC
AAGGACTAGAAGAATTAGAACAAGCTGGTAACTTTTTTGTACTTTTTTTACATGGCTGCC
CATCATCAAGCAAATAATAAACACAATACACTATGCTATACAAAATGGGTTAAAAGCCAT
AGTCCCTTAGGAAACTTATCAATCTAACTATGATGTTTCCCCAAAAGCAGCATTCTCTTG
GTTTGCTGGGCCTAGATAAGAATAATATAAAGTTTTTGATTAAGGGGAGTGAAAAGGAGA
GTGGTAAATATATTTTGACCACATTTAATCTCTAATAAAAAATTTTTTTTAAATCTTTCA
GCATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACATCAGTGGGCA
CTAACCGAGCCCGGGGAAACTGGGAGCAGACACAGACACAGAACCAGACACAGCACAAGC
AGAGGCCACAGGTAAAGAAATCTGAGGGAAAGTAGAGTATGGGCAACCCAAATGGCTGAT
TGAGCCTTACATCCAGCACAGCTTCATTCTGTGCTTTGAATTTTCTTTCTATATTCTGTT
TTTTAAGATTAGACCTTAGCTCTCCTATTCTCCTGATGCTTTCTTTGTTAATATCATGTG
CTGCTACAAAAGAGCTACCTTCTTTTTTTCTTTTGCTATTTAATGTTGCTGTGTGAGGCT
TTGAGAAAAAGGATTAATGTGACTTTTGTCTTTGGGTACCCCCTGTGGCTCCAATTTGGT
GATAGCACTTCTTTTCTTTTTCTGGGTCCCTAGTATAATATCTTCCTAATTTCTTAGATT
TTTCTAGTGTGACCCCACTCTTTAGCCCATATGTGTCTAGCCATTTTCTGACTTCTGGGT
CTGATCTGTTCTTTCCCTTTTGTCTTTTGTCTTGTTCTTTTGGGGCCTTTGGAAGGTTTA
TCTGGTTTTCCCTTCAAATGGGGACTTGGCCTTTACTCTAAGTTTTTTTTCAAAATCATC
CAGTAAAGACACCCTCGGGCATTGCTCAGTTACCAGTTTAAAAGGATAAATTAACCATCT
GGGAACTAAACTTTATAGGTTCTTTTGAATATTGGTTTAGATGAGATCTATTTTCAATAG
TGGTGGTTGATTAGTCTATTGTGAATAAATAATTCATATTTGGTTATTAATGTGATTAAT
GAATTATATTTCATTATTTGGTTGGGGGGAGAATTTTGCTCAGAGTTTTCCCTTTACTCT
TTTTCACCACTTCTCGAGGTTCTTTCTAGCACATGGCCCCTTAAGGTTGTTACCAAGCAA
GTCATTATAGTCCTAAGCACCTTATATTCTTATAATGATCATTCAATAGGAAGGCTTATT
CTATCCTTGGCCCAAACTTGCTGTTCTTAAGATATTTCCAGATTTAGAAGCAAAAAGGTA
GCCTTGGAAATTGGAATAGGCTTTTCTAATAAAAATTACAATTGAGCATATGTCTAGAAT
TGTGACCAAGCTACTTTAGGGGATAACGTTTTAGAAACTTGTTCCTATGGACAAAACTAC
ATTAAACATAAGCAACTTCCTCTTTTTAGTGAAATGACTTGAGAATCTGAGAACTGTATT
AATGATTACTTCTCTCTCTTTAAGTCTTCTATTCAATGTTTACTGGGTTGCTTCCATGTC
AGCATGAACAGAAGGAATACTAGACCTCAGAAGACTTGGATTTGATTGCTTAATTCTTAA
TCCTACTACTTTTTTTATGTCTTTGGGCAAATCAGTTAATATTTCTGAACCACAGTTTTG
CTCTTCTATAAAATGGGGATAATGATACCTGCCCTATATATATCTACCTCACAGGGTTGT
TATGAGGGTCAAATGAAATAATATTAAAGTGCTTTGTAAACTGTAAAGCACCATTAGTTG
TGAGGTGGTTTTAGAGCCCTTGGTGTCCTATCAATTGTAAAGGGAAAGGGAATCCAGGAA
AGAGATTTGAAATTACTTTGCACAGGCACTGCCCTCACTGCTTCTGACTATACTTTTCTG
ACCATACTTCCTGGTTTCCATCTCAATTTATAGGCTACTGCAGAACAGATTAGACTTGCA
CAGATGATTTCGGACCACAACGATGCTGACTTTGAGGAGAAGGTGAAGCAAGTGAGTATA
CCAATTTACTATGATTTTGAGGGATGGTGGATGATGACGAGATAATTGTATCAAGTAACT
ATACATGCAGAAGGCATTACTTATCAGGATACTGATTTGCCTGGGGACATTGGAAAGATT
ATGTAATTTATATAACCTGAAATGTGATTGACCCAGGCCAAGAATGAGTTCTTTCTTTAG
CCTGAATTTCTTATTTACTCTTTTGGATAAGTATATTGTTTTGAGAGATATGACTTTTAA
TTTGTAATTAATTGTTGAATAAATGGATAAATGCTTATGTGTTTTCTATATCAACTTCAA
ACTGTTGTGGCACCTCTACCTGGAATCTGCAAGACCTCAGTTCATGTATGGTCTCATACT
TTATTAGCTGGTGACTCTTGACAAATCACTTAACCTATCTATGTCTTAGTTTACCCATCC
ATGAAATAGGAATAACAATAACAGTTACTTCCCAGAGGTAATTGTGAGGATAAAAATGAG
ATAGTATTTGTAAAGTGCTTTGTGACCTTAAAGTGCCATATAAATACTAGTGATGATGAT
GGTGATGGTGCCTTAAAACACCAGATTTGGTGACCTTTGTTATAAGCTGAGTCTTTTAGC
AATAAATGTGTGTTGAGGATTTGTTCTCTATTTGGCACTGAGTTAGTTTTGCACTAGCCT
AGCATATATAAACTCCTATACCCAATCCTAAACATATAGCCGCCATGAAATGAAAAATTC
TGCTTTTGGACACAGAACCTCAAAATGCCACTTTTTGTGTTTTTCAAGGTGTTATTATCT
CTTTGAACCATCTCTCTTCTACCGCTATTCCACCCTTCCCTCACCCCCCTCCCATTTTTT
TTGTGTGTGAGAGATACAAACTGGCTCATGGTGATTATAGTCTTTCTCTTTGCAGCTGAT
TGATATCACAGGCAAGAACCAGGATGAATGTGTGATTGCTTTGCATGACTGCAATGGAGA
TGTCAATAGAGCTATCAATGTGCTGCTGGAGGGGAACCCAGATACGGTAGGATGCTTACT
TAGTATATAATATTGTAGTTTGGGGTGCAATTGGGAGATTATAATTCCTGCATAATACAA
AATGAGGTTGCACACTTTCAACAATGCATTGCCCTCACAAACAACGGGGAATGCTTTTGG
AATTTTGTTTGCAGCATATTACAGCCTTATAAAAAGGTGCCAAAAGATTAATAGTTCACT
GTGCACGTGTATGTTTGTGGTGTGCTCTTTATTTTAACCAGTTATCCTTCCTTTAAGGAG
ATAACAGTGGTAGGTAAACAGATAAAATGTGTCTCTTCTGCTTGGCTCAGTATAAATTGT
AATTTATTCTAGGCTAGTGACTTATTTTCAAGGTTGTTTTTGAATTGGAAGAGGCAACAT
TTGATACTCTTGTTTATTAATCATAAGACTGATTGGACATTTTCATGGCTGAATAGGCAG
TCACAATCTGTGCTTTATTCTTAACTCAGTATGTTCCCATCAAAATAGGCTGAGGATCAT
ACAATGCTATTTCACCTTTTGAAACTACTTGTGATAAAGAAGGAAAAATAAGTTTTGTAG
CTTTTCTCACCTTATTAACGAAGAGAGAAGGGTAGGATAGTTAGCATGGATTGAGAAATT
CTCTTTATTTTTCTTGAACAAAACTATCCACTTTTCTCCCCTGCCTTTCCCCCCCATTTT
CTGCCCAAAATGTTTGTGGAGAATGATTAATTTAGAAGAAGTTTGAATTTCAAGGCTATG
AACTTATGAGATTCTTGTGAAGGCAAGGGTCTTTGACTTTAGCTACAAGACATGAATTAC
GGTATACTTTTTAAACTCAAGAACATCTTTTCTCATAATCTGTTTTTATCACTTCTAACT
TTACTTAACCTTGCAATGGAAAACTGAAGCTGAGGAATGCCAATATATACCATAGATTCA
CCAGTCTTTCATGAAACCAGTGGGAAACAAGATAATTTTTCAGTAATTTTAAATTGCTTG
GGTAATTGAGATCTAAACAGTGACAGTGAGAAAGGTGTAGAAATTCACTGTTTGTGTAGG
ACCTATGTGTAGATGTCATCCACCATGACATTAATATCAAGTTTAGAGGGAAGTAATACT
TCCCTTACAGTCTTCTCTCTCCTTCTCTTCCCCCTTTCTTTCCCCTAAGGTTTTAGAATC
AGTAGAAAATCCAGGGGCCATCAACTTCTGCTTGTTTTGTTTTACTTGAATCTGATTTCC
AGGTTGTTATAATAATGAGACTATTTAACCATGGGCAATTAATGGTGCATTGAAGAACAT
AAAATGACTCACTTGTTGTAATGTGCTTTTCTGGGAGGTAACTTGGATTGGAAGATGAGA
TGACACGTAAGAACTATGGATGGAACATTTGTTCTTGAAAGGACAATTTTTATTGGTTTT
ATTTGATAATTGCTGATGATTAAGGCCACTGCTATTTGGTTTATGGAATAATTGGGAAGC
TATCTCCTGCCTGTCTTGGTTTATGAAATGGAACCTCTGCCTGCCTTGCTATTTTAAAAT
CTTTGTCTGTGACCAATTCTGAGCATGTAGTACTGCTATGTGAAGAAGGGTGCATTGCAT
TTGAAGCTTTTAATATTTCTAAAAAGTTCACCTTCTCTGAGGTGTATGTTTGCAGAGTCA
TTTAGCTGATTTTTTTAGTTGTAAGTCTTCTTCAAACCCGTTTCATTTTTTGAGAAAATT
CCTTTGGCTATAACCTAGAGGTTGAGTTCGTGTCCTTAAGAAAAGTGAAAAACCCATTTA
TATCCTTGGTCCTGACAGTCCTGTAATTGGGCATTTACAATTCTAAAGAATTTGGAAACA
AAGATCCCAATATATCTCAAAAAATTCAGGTGGTACTTTTTTTGATATAAGGAAGAACTG
GAAACAGGTATCCATTGATTGGGGAAATTGTCAAATGCCTATATGTCATAATAAATATAT
CAAAGGCATTATTATGCAGAAAGGAATGACAATTATGAGGAATCAGAGATACTTGAGAAG
ATTTAGGTGAGAGAAATGAAAAAACCAATAATGGATCTTTAGAACAAATAATGAAATATA
TCTCCTTCCTCTTTAAGAGGTTGGTTCTACCAAGGCATAGTGTTGTATATACATTAGCAA
GTACAAGTTACTATTTCAGGAGTTTTTGCTTCACTTTTTCTTTTGTTATAAGGAAAGATT
CAATTCTAGCCAGTGGGAAAGGGAAGTATTTCCAAAAAAAGACTAATATGAGAACAAAAG
GCATCAATAAAATTTAGTTTAAAAATTGAAATAAGTAGCATATAAGCAAAACAAAGTAAA
TATTTTTTAGTGCCAATTCTACTTTTTGTTTCAGTTGGCTAGACTTAGATAGATGATCTT
TTTTTAGGGGATGAATGGAGGGTGAGACACTGGCTCAAAGACAATTTGTGCTCAGTTCAA
AATAAATGAGAGTCAGACAAGTAAAGTCTTTTGGTTGATCACCCATGGTCTTAGAGGAAC
ACATGTTAAGAATGGTCTTGGAAATAATCTTAGCTGATCAATGACTATAGATGCTTTCCT
TATCGGAAGGACCATACTTATAAATTATTAGCCTGTAACTTGACATTTTTCTTTGTTTAT
GACTTTCATTTGTATGGAGGATTATACATGGGGGAATACTTAGAGTTTGAGATTGAGAAA
AGAGGTTGGGAAAATGCTTGGCCATCTTAGATGCAGTCTTGGAAGAGTCTTATGAAGAGT
CTGTTCTTTGCAGAGCAGTAATTTCTTTCCTCCTCTTTTTTTCCCCCCCTTTTTAAAGCA
TTCCTGGGAAATGGTTGGGAAAAAGAAGGGAGTCTCTGGACAGAAGGATGGTGGACAGAT
GGAATCCAATGAAGAAGGCAAAGAGAATCGAGACCGAGACAGGGATTATAGTAGGCGACG
CGGTGGGCCACCAAGGCGGGGAAGAGGCTCCAGTCGTGGAAGAGAGTGTATGCGTGTGGA
CTTAACAAAACCTACTATGATTTATTAAGGCATAGTGAATAGAGTGCTGAACTTGGAGTC
AGGTTATATTGTTCCCATGGAACCATAAGCAAGTCGTATAACCTCTTAAAATCTTAGTTT
CCCCATTTGTAAAATGGATCAAACACCTATACACACTATGTCATTAAGTTATGAGGATCA
AATGAGTTAATGGATGTAAAATGTTCTGCAAATCTTAATAATTAATGTCAACTACTATAT
TAAGATGTTTGGACTTCAGGACATAGCTGTGTCCTTCCATGGGAGAATTCAAGGAGTCTT
AAACCACTCCTCCTTTCTCCTAATCACCTTCCCTTTCATGAAGCTCTTAGTGTCCCTTAC
ATAAATCCTTTTCTATCTGTAGTTGTCAGATTGATGTATAACCATCCCATAATCACTTGT
TTAATCCAGAGCTTTTCTATCAATGGAATTCTCTGTTTATAGCCAGCATAAATGTGCAAA
TACTCACCTTTCCCCAAATACTGTAGATATTAAGATTATTTTTATAGTCTAACTCATCTT
CTCTTATGCTGAATATGTTCCTATTTTCCATGTTATAATTAGTTGTTTATGCATGTTTAT
ATTTTAGTTCGGGGCCAGGAAAATGGACTAGATGGTGCTAAGACTGGAGGCCCATCTGGA
AGAGGCACAGAAAGAGGCCGAAGGGGCCGTGGACGAGGCAGAGGTGATCATCTTGCTAAA
TTGGGGGCAAAAAATTTATTTGCTGACTTTTTTTTCTTTAGGAGTTTGTCTTATTCTTTT
TTACATTTATTTTTTAAATTATATGCAAGAATTGAGAGTTGCTGGGTTGGGTGAGGGATA
TAGTCAAAGCAATTTTGGTTGTTTTTTGTAGTGGGTATTGATGCACTTAAATGAGTATTT
AACAGATTAGGCAGGAGAAGGGGATCTTTGCTCTTAGTAATTATTTCTCATATTAACTGA
TCCTCTATTTGAAACTGTCGAGAGAGCCTTTTTATTAAACTACCCACTTAGCATCTATTA
TGCCAAAGCTTCCTCAGTAGGTGTAAGACTAAAAAATGAATGAATACTCAAGTATTTAAA
TTTATAGGATTTAATAACAACAAAATGAGAGAAAGGGGTTTCCTTCAGCTGAGTGAGCAG
AGCAAAGAGCTGGAGACCCTACAAGCCAAAGACAAGAAGCCCTGCAGTGTGGGTTTCAGC
AAATTTATAAACAAACCCACACCAGGGGGCAATGCAGGGACGCAAGACAAGGGAACCCCA
GAAAGAGTAAAGAATGCTGGGAAATGAAGTCCCTAGGGTACAAAATTTTAAAACACACAT
AGGTTTTATTGTATGCTTTACATATGCTTTAAGACTTTCCTCCCTCCTCCCCCCCCCCCC
CTTTTTATTTTTAGGTGGCTCTGGTAGGAGGGGAGGACGATTTTCTGCCCAAGGCATGGG
GTAAGTTTCATTGACTAGGAGTTTTGAAAATAAGTCATCCCCATTCTCTTTATTTTTTGG
TGTCGCCATAATTAAGATACTATGATATCTTAAAACAATTACAACACACACAATCCCATT
CTAGATTAGAATAATAATTGAAGAACACTCCAATTCCACAAAGGGCAATAAGAAAAAGGG
CATGTTGCCTTCTATCTCTGCTTAGAAAAGTGGTTGCTGCTTAGATTGATCTCTCATCTT
TCTTGGCAGTTTCAGCTGAATGCAGATGCTTGTTACTTCCCTGAAATCCCTTAAGAGTTT
TGTGATGGATAGTACCATTTTAGTCTAAATAGGCAATGTGCAGTTGAGACTACTCTGAAA
CATTGTGTAGGCTAGTGAGAAAACAACAGACAGCAAATGGGTTTTGTAAAGTGAAGCCAT
TCCACACTGGAATTGGAGACAGAGGAAGGTTCAGGAGTTTCACTGTCTTCATTATAGTGC
TGTTTGGTGGCAGTTCTTAGAGATTGGAGCTTTTGAAGTCTTGTCTCCTTTATTTTAGAA
CCTTTAACCCAGCTGATTATGCAGAACCAACCAACACCGATGAAAACTATGGCAATAGCA
GTGGCAATACGTGGAACAATACTGGCAGTTTTGAGCCAGATGATGGGACGAGTGAGTTAA
TCTTTATATGTTCTGTTATCCCCCTGGGAATCTGGGGCACTAATATTTTTGGGTTATTAG
AGAAAAGTAGAAGAAATATTTGGGGGTAAGAGAAATAGAATTAGTTCTAGAATTCACCAT
TTGAATTTCTAAAATGCATTGTAGTATTCATTGAGATATCTCTGTCCTTTGAGCAGAATA
AATGGCATATCTAAACCACTGTCTACTGAAGGGAAGGAGTATCCTAATCGGAAATGACTG
CCAGTTTGCTTTCTAGCACTGAGGCAGAAAAACCTTTCACTTCTCTATCAGGGGGTCTGA
GCAACATACAGGCAAGAAAGAGGTCCTCAATTCTCCCAGTGCTCTTCTTCAAATGTCCTT
GGGTGGTAGAGCATTATGGGGCTTTACCCAGGTTACATGTATGTTCTTCTGAGCCAGCTT
TGGTACCTGCCTGCAGAGTGGATGTGTGTGTTTAAAAGCATATGCTAAGTTTGTGTGGCA
CTAACAAGATGTGTGGTGGGTTTTTGTTGTTGTTTTTGAGGGGTGGGAGAACGATATGTG
TGTTTTTTTAAAATATAATATGGGCTCCTTGTTTTCCTTGGATTCCTTCCACTTTTGAGG
AAATCCTTTGGTTAAGCAGTTGTCCAATACCTGGAAAGCCTGTTGTTAACACTTTTCTAG
TCTTGAGGAATATTTAGATACCAGCAACTTAGAAGACTACAGTTTCATATATTAACCCTT
TTACATCTAGGCAGGAGTTAATTTCTAGGATTTTAGGGGGTTCTTTGGCATGAACTAAAG
CTCTCATCCAAAAGACATACCCTTAATTTTTCTACTTAACTGCTATCTCCTATGAGTCTA
CTTTGTCCCATTGGATGGAGGCTTGAAGTTTTTACTGACCAGATAGATACCTAGAATTCT
TATTATGCCTGACCATTCTGTCATAAAATATCCTGTTTCTATTTTAACTCTTCATGTTGT
GGAGGTACAACCTTGGGAGGCCAATTCTTCATTCTTCATCCTTTGGACGGGTAGAGGTAG
CTGGGGTTTGGGTCTTTTTTAATATGAACATTGAATTTAATGTGTTTTTGTTTTTTTAAA
TCCTTACCTTCTGTTTTGTAGGCCTGGCTCTAAATCCACTGAGCCACCTAGCTGCCTCTA
AAGTTAATATTTTTGATCACCAGTTTGATACTTATCCCATTGGTCTTAACTGTCTTAATT
GAGAGAGCAAATAGAGGCTTATAGAGATATCACTTTTAGTTAGAAAGAGTAATCAAATTA
GGATCCCATCCTTAGATTGTAAACAGTAAATTTATCTTCAACAAGAAACTGACTTACAAA
GTCTGCTAGAGTGGGAAAGTGGGAGGTTTGATTTGGAAGATTAAGAGTTTGACAACCTAT
GATCTATGACTGAATGAAATTGTATGTAATGTTACCATCCATCATCTTGTTAGTGTTAAA
GCTCTAGGTATAGGTTCATGCATTTCCATCATTGTTAATTCATGATATGAACATGTCCTC
ATGCATGATCCATTTTTGTGTTTTCATAAAAGCAACTTCTAGCATCCTTTCTTAATTTAA
ATTTAGAAGAAAAAAATCTACCCCCCCGAATATCCACAGGTACAGTGGGAGTTGTGTACT
GGGGACAAACGTTTTCATTCATAAGCAAAATTTCACTGGTTGTTTTTTCTTTTCTTTTCT
TTTTTGTTTCAGGACTTGATTTCATGGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTG
AGACTGCTCCTGGTATGATACATCCAGGCGCCTAACTGCCCCGGATATTATTTTTATAGC
TTTTTATAAATTGAAATATCTGTGGATATGTCATTCTTATTTCTTGCTGTTTCTGTCTGT
CTCTCAAATTTTTTTCATTTAGTGAATATTTGATGTTTGCTTTCTATGTTTTCTGTTGGA
AGGAAACCATAGTTTTTTGTCATCAAAAGCATTTCAACTCCCACTGTTCCTTAGTCCTCT
TGGCACACCCTATCCTGAACCCATTCTCAATCATGCCTGTATGAAATAATATCATTCTGG
TGCCTTTATTCTTCTCTCCAACAGTCACCAGAAATTTTTCTTTCAGTTAGTCTCCTTTTG
ACTATGCAGGTTGAAGTTTGTGAGAGGAGGAAGGAAGAATGTGTGTTTTCAGAGGAAGAA
TAGGATATAGTTTACTGCTTTAAGTGGATTAGAGTTGGACCTCTGCTTGGATTGAAGACT
ATCTTATCTCCTGTTGGAGAGTTTTGTTAGTTCCTGAAAAAGTTTTTGTGCCAACATATC
TCTTTCTTTTGGAAGTGACAAGCTTTTTACTATTGTTGAATATTCAGAAGGATTTCAGAT
GGAAGTTGCAAGTGTAACTTGAGTGCTTTCCTTTAGAGACAAAAATATGTGAGTCTATAG
GCTTTATTTTTTATCTTGGTTCTGTCAAGAATCTTTTCCTTTTGTGAGAAATATAATTCT
CATGCTAGTTAGGGAATTACTCTTAGAACTGGTCTTGGGGAGAAGAGTGAAGGAGGTCTT
CTTTCCCTTATCAGGCAAGTGTCATATAATTCTTTAGTTGTTGAAGAAAGTCTTAAGAGT
ACATCAGAATTCACCTGATTTTTAAAATAGTGCTCCCCTCAATTCCACCCCCTAACTGAG
AATAGATATGAAATAGAAGATGATAGAAATGTAGAATTAGAAATTAGGGCTATATCATAA
GCCTTCTTGTACTTTTAGTCTTCTTCCCTATAGACCCCATTACCCCAAACTATAGTAGAC
CAGAATTAGTTTTTTAAATTAGGTAAGGTTAGAATAGATCTGATGGGAGGAGTCAGTATA
AGAAATAGAGCCAGATTTTCCCAGGTCCAATTGAGAAAAATAATCAGTGTCAAGGAATAG
TGTTCTTATTTAATACAGTTTTCCCTATTCAATAGATAGACTTATTCCTGATTGAATATA
GGAGTTTGAGATTATATCCTTTAGTATTGACTTTGGTGTTACATACTTTCCATAGTGTTA
TTTTCAGAGGGATCAGATCTTTTATTTAGTATCTAGTGGAGCTAGTCATGGGTATGTCCT
TACTTTGAATTGAAATAAATGGCAGGTAATAATTGTTCACATTTCTATAGTTAGGCTTTA
AAATCAGCAGCTTTTTTTCCCCCTCACAACTACACTGTGAGGTAGATAGTTTAAAGTAAT
ATCCCTATTTTACAGATGAGAAAACTGAAAACTCAGATCATGTGACTGATGTCACAGTAA
GTTCCATCTAGGATACAAACTTGGATCTTCTGACTCCCAAGACTACTTTATATTTCACTC
CTCTAGATTTAGATCCCTGTCCTTCCTTCACTGTTTTGTCTTCACTCAGCATCAAAATCA
TTTTTTACTGGGTCCGTCTGTGCTGCTAAATCAGTGTTGCCATCTCTCTTTAAATCACCT
GGGATGTTTTTTTTATCCCCGTTAAATAAGCTCAGTTGCATGCTCTTGTTTATGTTGCCT
TTTACCATCCTGCTATATATGACTTGGCCTTGGTAATTCCTATCAGGCCAGAGGGCTAAG
TGCTTTGAAGGATATTGCTCTGTGGGAGGTGGGGTGGATAGTTTTTCCTGGCTTCCTTCA
GTTGAAGTGATTGTAAAAGGCAATGATGGTGAGTGTGAAGCCATAATCCCATTAAAATCC
TATATTCAGAGATGCCACTTTGGGAGGGTCCATGATCTTGTGCTTGGAATTTTTTTCTGA
CTGCTAAATTCCCATTACCTCTTTGCCTGAAAAACATTTTAGAACATCAAATTGTTTCTG
CAGTATGTCTTACCCCATAGTGTTTTAAGTCACTTCTCAATTCTTCCCTTTGTTCCTAGG
TGCATGGAGGACTGCGACAGAAGAATGGGGCACAGAAGATTGGAATGAAGATGTAAGTGC
TTCCAAACTTAAGTCCTCTTAAATTGAACATTCAGAGGTAGAAGTTGAAGTCTCCACTCC
TTATCATTAGTGGTCTAAATCAAGTCTTAGAAACCTGTGAATAACTGAGAGATATTGACC
CACTGTGACCAGTTTCAGTTGACATGAAAATATGTCACCAGGGATAAGTAAGGTCCAAAG
AAGCCACATTATGGAGGGGCTACACAGATACAGATTCTTATCACATAGCTATACCATGGA
ACTCTATACATGTACATAGCTATAGTAGCTTGCTATAATAAGACTTACTGCCAGGAAAGA
GACAAGTCCTGGAGATCACTTTGGAAAAAGCACTCTGGTGGCATTAAGTTCTGTAACAAC
TGCTAAGACCCAATATAACCAATTCATGCCTTGTGCTCATGAAGGCATATTTTTATTCCA
TTGTCATTTTAAGCCCTTATTCCTTGCATAACTCCATAAGTCTATTATGGACTCTATATG
AGATACAAAGGAAGTAGAAGGATGGATGATAATGAATCTTTACCTTCAACTATATAATCT
AGTTAATCTTATGGCCCTTTCATTTTTGTGCCAGCCTACTTGTGAGAAGGATGCATGTAT
TTGATGTTACCAGACTCCATTAGCATACCCCTTCCCCACTTGCAACTACCTAAAATTACA
AATAAAAGCTCTCTAGCACCACTTGGATATATGTCACCTGTATTGAAATAATTATATCCC
TTTTCTGAGCTTGAAACCTTCATGTTCTGAACCTGAGTTGATTTCCAAGAATGAGTCTCC
ATTTTGTTTGGTAGTTGTTGCTCATGTTTCTGTTCTTTGTGAAGTCTTCGCTGTGGGTGA
CTTAATGGCCAAGGAAATTACAATATCAGATACCTTTTTTAATCCTAGTTGCCAGGCTTT
TAACTATTTGCTCCAAGGTATTTTAAAATCAAGATAGTGACTGATTTTATCATTTGAGTG
TTTTATTTATTTATTTTTTAGTTTTATTTAATTGGATGATCTAGGCTATTTTTCCATGGT
TACAAGACTCATGTTCTTTCCCTCCCCTCCCACATCCTCTTCCCGTATCTGATGCACAAT
TCCACTGGATTTAACATGTCCATTTGAGCAGACTAACTTGAACATTTGAGGCAAATTTTG
TTATATTCTCCAGAAGCTTGGAACAAGTATTTGGTTTAATCATATGAAAAAGTGATTCTC
CCTGTCCCCCTTTTCCTATTTGATTATTACTATTTCTATTCTATCTAATATTCTATTACT
ATTTCTAAAATAAAAGCTTTTCATAAAGCCAAACTCTTCAGTCATAGACATTATTCTTTT
ACTTGTTTGGCTTTATTTTATGGAGGGTCAGCGTGATACAGTAAAAAGAATGTTTAAAGA
ACCCAAGTTTGGATCCCAGCTCTGCTTCTTACTTTCTATGTAACTTAGTCTCAGTTCCTC
TTCTATAAAATGAAGGGGTTGGATTAGATGCCTCTCTATAATATCTCCTTGAAACTCTTA
AATCTATGATCCTCTGAACCTTTTGATCCACTACTTTGTTGGGTTTCCTGACTTCACATT
CATTATGAATAGAATCAAAGCATATAGGTAAGAAGCATATCTGTGTAAACCATTCTTCCT
AATTGCAGACCAAAGTACCTCAATGCTATTGAAAAAATAAGGTGTTTGGTTTATCAAAGG
TCTAGATAGCACAGCTTTCTTTGAGGCTAAATTACCCTTTCTCTGCATCTCATTGAATAT
GGCCTATTTGGAACTGGAAGTGACTCATTTCTTTATCTCTGTTTCAGCTTTCTGAGACCA
AGATCTTTACTGCCTCTAATGTATCTTCAGTGCCTCTGCCTGCAGAAAATGTGACAATCA
CTGCTGGTCAGAGGTAAGAAAATGGTATAATAAACTTAGTTTTAGTGTGTCTTAGATGTC
TATAGAGATGCATTTTGAATAAACCTCTCTTTTTCAATACTTTTAGGAACTGCTAATAAG
CAGTTTTAAGTGATTGCTATAAACTAAGACCAACAAACCCAAAGCACTAGCTTTTATTAA
AATGTGACTCCTATGGAGGGTAGCTAGGTAGCTCAGTAGATTGAGAGCCAGGCCTACAGA
CTGGGTTCAAATCTGGCCTCAGACAACTTCCTAGCTAGGTGACCCTGAGCAAGTCACTTC
CAACTCCCCTTGCCTAGCCCTTACCACTCTTCTACCTTGGAATTAGTACATAGTATTGAT
TCTAAGGAGCAAGGTAAGGATTAAAAAAAATGTTAATAATAGGGCCACTTCAGTTCTCTT
ATAAATGTTTTTGCTGTCTTCCTTACATAACTATCCATCTTCTTTTCTTTGGGCCTTTAT
ATAGACTGATGCCAAGGAATACATACATCTTTTGAAATTTCTACCTCCCTTCAAAGCTCT
TGATTTTCTCTATAAGTTTTAAGTGCTGCTTTTAAACCAGTTGAACTTAAAATGTTCCTG
GCATTAAGTAAGGCCTACCATAAACTTAATTTCTTGTATTATTGGGATTCAAGTGAAGAT
TTTCCTACCTACTTCTGAATTTTGAAAATTCAATAGACTATCCACTTTTTTTACAATGCT
GATTTTGGAATGGTCAAAATTCTAGGATTTATTTAGGTCCTCATTGGGTATTGAATGACT
AGTTTTATTCCCTATCCTTCAGAATAGCTACAACGGTCTAGATACGAGATCCCAAGGTAG
ATTTTAGAGTGGCACTAATGTTAATAGTTGTCATTGTTCCTTGAATCAACCCTGTCACCT
ATTGGATTTGATGTGACATTCTTCCATTTAAAATAGCTGTTGAGGAGGCAGCTAGGTGGC
TCAGTGGATTGAGAGCCAGACCTAGAGATGAGAGGTCCTAGGTTCAAATGTGGCCTCAGA
CACTTCCTAACTGTGTGACCCTGGGCAAGTCACTTGACCCCCATTGCCTAGCCCTTACCA
CTCATCTGCCTTGGAACCAGTACAGAGTATTGATTCCAAGACAGAAGGTAAGAGTTTTTA
AAAAAATAAAATAAAATAGCTATTGAGAAGTTATGACAAATATAGGGTGTTAGTGATGAT
GTTATCCGAAATGGCTTTGGAAGTGGTATAAGACAATTTTTTTGAAAAAATCTCAATATA
ATTTTGTGTTATGTGTTTTAGATTTTTATAAATTGTGGATGAAATATATTAAAATTTCAA
AATTTTGGGTGAAGTTTCCAAATTTTAACAAATTTAGTATTGTCAAGTTCCCACATCAAA
TTAAGACTTTAAAGGTACTAAATTATTAAATTTGTGCTAAAGCAAAGCATTAGAAAACCA
TATACCTGGTAAATTGGTACTACTCTATTCATAAATTAGCATATTGCCTATATATTGTTG
GAGATTCTGTAGAAGATAAATTGTAGATTTTGTCATGTGATTTGCCTTTCAGCACTTAGT
GATGCTATAATTGAACCAAGGTTATTGGGGAATGCTTGAAAGTTTCTGCCTTTATTCATC
AATTGCTATCTCCTTCTTTGTTAGGATCGATCTTGCTGTGTTACTAGGGAAGACACCATC
TTCAATGGAGAATGAATCAACCAATCTGGATCCATCTCAGGCTCCTTCCCTTGCCCAGCC
TCTGGTGTTCAGTAACTCAAAACAGAGCACCATGTCACAGCCTGCATCAGGAAGCACCTT
CTCCCATCATAGCATGGTAAGTAGGGGAAACCTCTTCACCTGTTCCTGTCTCATCTCTTT
CAAGAAGTAGTCAGGAGCTAAGAGGTTTCTAGTGTCTTTTTTTTGCCATTCAGATATAGA
AATGGAGTAGAGTTAGCTATAGGTAAAAAGTTGATTTCTAGCCAAATAAGACCCTTATTA
AGTTTGAAAGAGTTAACAAACAATTTTTATTGAGCACTCACTGGACCCAACATACATTAG
ATGCTTCTCTTCAAGAAGGAGAAAGGTTGCTTCAAACTAAATTGTGAACCAACACATTTT
TTCTTACTTTTGAGGTTGTGACAAGATTACACAGCTGACAAGCAACAAATCTTTCCTCTT
TCATGATGGGGGCAGAAACTGCATTGTTTTATAAACCAAATCCTTTAACTTAAAGCACTT
TGTACCATGTGGCTTAGTCTTTAAAAATAAAGAAAAACATATGGTGGTAAAATTAAGCCA
AAGTGTGATATCTTGTGCTAGGTAGAGACTGAAACAGATGTTGTTCTTGTTAAGGTCAGT
GAATTTTGAAGCAAGTAATTCTGGAAGTCTGAGTGAAGAAAGTTAATATTTACAGAGTCT
TCCTCCTAAAAGGTCCCTTGGAAATCATCTAGTCCATCCCCTTCATATTCTAGGTGATCA
AATTTAAGTAGTGTTTAATGAGGTCACAAAGCAACTTAAGAGTCAGCTCCAAGGAGCAGC
TGGGTAGCTCAGCAGATTGAGAGCTAGACCCTAGAGACAGGAGGTCCTAGGTTCAAATCT
GGCCTCAGACACTTACTAGCTGGGTGACCCTGAGCAAATCACTTAACCCCCATTGCCTAG
CCCTACTACTCTTCTGCTTTAGAACCAATACACAGTATTGATTCCAAGATGGAAGGTAAG
GGTTAAAAAAACAAAACAAAACAGGTCCAATTCTTCTGCCTCCTAGTAGTACTTTTTACA
GAATGGAGGTAGACTGGTGCAAGAGGATATTTAGGAGAAAGATACTATCCTGGGCCATGA
TTGAGTATCTTTTTCAAAATCAGATTAGTGTGTCCCTCTTAATTTTGTTGCCACACACTA
AACATATTTATAAATGAAGTCCTGGAACTTACTGGAGCTATGAAATGCAGTTGGAACCTG
AACTCTGCTGCATCTGGAATCAAGAATATTTTACATTATGATCCTAAAGGGTTTATTTAG
ATTTCTTGATACTAGAGAAATACCTATTGGTACTAACCTCTAATATTTCCCATTACTACC
ACCTTAATTTCACACTTTGTTCCATGTTGCATTATATTTATACTAAGGATATTTTGCTAG
ATTCCCTCCCTTGTTTAGATTATGAAATAATTCTATATACAATTTCATGTAGTATAGCCT
TTTAGAGAGAATGATAAGTTTGATTCTTCATTGGGCTTTGAACTCCCTAAGACAGCATGT
GTTATACATATAGTAGGAGTGTTTGATCAGGAGTCAGAAGATCTAAGTTGAAATTCTGAC
ATTGCTCTTTACTATATCTGTGACCTGGTGCAACTTGCTTCAGTTGTCTAGGCTTAATTT
TCTTCATCTGTAAAATGAAGGGGTTGAACTGGGTCCAATCCAGCTCTAAATCTAATGTTA
TCCATTATTATCTAAATTTTGTATTTCTGCCAGGAATTTACATAGTGAGGGGTGTAAATG
TTGATTGAATTAAATTGATTTCTCATAAATTATATTCCAGTATTGACCTGTTTTAAAAAT
CACTTTAGAATTCTAGTATTTTCACTTAGATATGATGTGGTATGTCAGATAATGAAATAT
TGTGAAGCATTTTTCTTGTACCATGTACTAGATGAGTGCTTTATATTCACTAGAGATATG
AGATTTTCTCATATAATCCTTTAACTTTGACTATAATGCCTGTAATTTATTATCTTGCTA
TTCCTGGTAGAGATTGATGTAGAATGAGAGAAATTGTGCCTAAGCTGCAGTCTGATGAAT
TCTAGGTACAAAGAAGACTGCTGGCATTATGTGGTGAATAAGTGCTAAAGAAAGATTGGG
ATAAATTTAGTTCCTTGGAGATCTTCTAGAACAAGTGAACAACTTGATTGATCTGGAATG
GATTGGAGTCAGTTTTGAAATGCATTTGGAGCCTGAACACTTCATAATCAGTAGACTAGT
TCTTTTATCCACAGATTGGCGAAATGGCAACACTTGAGCAACTGATAGGACCTGGACTTG
GGTATCTTTTCTGATTTTAAAACTCAAGATAAGGCATAGAACTGATAATTCACTATTGAA
GCCATAAAATTTGATTTATCCATTGTAGGATTTATGAAAGCCTTTTGGCTTCATTCCCCT
CATCTCATCTACTTTTGAGCAGAGAAGAGAAACTCCCAAGAAGTCCTTTTGGCTTCTTGT
GGAAAAGGTAGAAGTGGAAATGAATCTTGATTATTGGATAAAACGACATTTTTGGATTAC
CTGTAATACAGTTCTTTGTGGTTTTCTTGTCCCCTGTTGTCATGGATAATAAAGTTGGTT
GTTTTATAAGAACAGCCAATGAAATTTTTCCCTGCAGGAGGTACAAAGGTATAATATAGT
CTTGACTCATCTTGCCTATGTCACTCTAAGCTAGTAATTCCATGTGAGAACACCTTAGTG
AAATTCTGTGATTCTGTCTTGATCTGCAGGTGAGCATGCTAGGAAAGGGGTTTGGTGATG
TCGGCGAAGCTAAAGGTGGTAGCACCACAGGCTCCCAATTCTTGGAGCAATTCAAGACAG
CCCAGGCTTTGGCCCAGTTGGCAGCTCAGCACTCTCAGTCGAGTGGGAGCACCACCACTT
CCTCTTGGGACATGGGCTCTACAACACAATCCCCATCGCTGGTGCAGTATGGTAAGGGAA
GACAGGAGGTTATAGTTTTAATGTTGCTGCCAGTGGGTAGGTAGAGATGTATGGTGGGGT
GAGGAAAGGGGCAGCCAAATGATGTTTCCCACATTGTTTTTCCCTGTCTAGATAGATTGA
GCCTAGGCAGTTGGGGAATTGCAGGAATTTATGAGGCTATAAATTTTAATTTTTATCTGA
TTGAATGGGTTCTTATATTTTGGTCTGAAGGCCTTGCATTGACCAGGAGATTTCACAGAG
CTTCTCCAGGTTCACCTGGGTTGATATAGAAAAGCAGATTTTCCCACTTTGGAGAGTTCA
GAACTAGGAATAGGGCTATATATGAGTCTACAAAAGTGCAGCTTCTCTGTTTTATATCTC
TGCTCTAGAATGGTGATGATGCCAATCAGAATGAAGCCAGCCTCTTGGTCTGCATTGAGA
GTGCTGATACCCTTAGGCACAATCTAGGACTCTAGCCCATAGCTTTCTCAGTTTATTCTG
TACCCTTTGCTTGGTCTCACACATTTACACATGTTTTTCTCAAATAGATTTGAAGAACCC
AACGGATTCAGCAGTCCACAGCCCTTTCACAAAGCGCCAGGCCTTCACCTCATCTTCAGC
CATGATGGAGGTGTTCCTGCAGGAAAAACCACCTGCTGTGACCACCTCTACAGCTGTACC
TCCGGCCCCTTCCTCTCCATTGCCAAGCAAGTCCACCTCAGCTCCACAGATGTCCCCGGG
GTCTTCAGACAACCAGTCCTCCAGCCCCCAGCCAGCTCAGCAGAAACTGAAGCAGCAAAA
GAAGAAGGCCTCTTTGACTTCAAAGGTACTTGATCTCTTAGCTATGGGTCTTGGCAAAGT
TTTTATAAGTGCCTCTCATGGTAGATATCTAAGGCACTAACTTAAGGCAAATCATTCAAG
GTCATAGAGGAGTTAGGAATGTCCCTAACTTGTTGCCTTTATTTGATATTTTTTATTTAA
ATTTTTATCAACTTTTTTTATATCGCCTTAGTTTCCCAATGTATCTTCTCTCCCTGCCCC
ACATTTCCTTTCCCAGAGAGCTATCCTTTATAACTAAGAAGAGAAAAACAATTCAGCAAA
ATTCTCAACATAGCAACAAAGTCTGAAATTAGATGCAGTACTCCATAACTGTAGTCTCCA
ACTCTGCTAAGAAGGGAGAGAAGGGCATTCTTATCTCTTCTGTGGAGTCAAGCTTGGTTA
TGATAATTTCCTAGAATTCACTTTGGGGTTCCTCCATTTATAGTATTATAATCTTTATGT
ATATTGTTTTCCTGGTTCTGCTTATTTCATTTTGTACTCATATTAGACTTCCCCAAATTA
TCAGCATTCGTATTCATTGCTTATTAATAGCACAGTGATACTTCATTATATTTATGCTTC
ACAATTTAGTCATTCCCAGCTAAAGCATCCTCTTTGATTCTAGTTCTTTGCCAGTATAAA
AAGTGCTGTTTTAAATATTTTGGTTTATGCTGAGTAGTGGGAATCACCTGAGGTTGTAGT
GAAGAGGCATAAATAAAGTCAGGAAGAGTTGAGTTCAAATCTGGTCTCAGATAATATGTG
GACAAATATTTTTATCTCTGGAAGCCTCAGTTTCTTTGTCTGAAAAAAACAGATAATAAA
AGCACCAATTTCACAGGATTATGGTTAGAATCTAATGACATAACATACTTAATGTCTTTT
TTAAACTTTAAAGAACTATATATACATGTTAACTATTACTATCCTTGCTATCTGAGCGAA
AGGGTATAGGATATTTTAGTCATTTGGTTAACAGTTCCCAGTTATTTTCCATAAATTTAA
TTTAGTGTAATGTGTGACAGTGAAATCTTCCAAAATTAAAGAACAATGTCACTTTATGAA
CTGGTTAAAAGGTTTCATTAAAACTCAAGCCCTCAGGGGCAGCCACGGCTCAGTAGATTG
AGAACCAGGGCTAGAGATGGTCTTGGAGTCAAATCTGGCTTCAGTAACTTCCTAGCTGTG
TGACCCTGGGCAAATTAATCAATTCCCATTGCCTAGTCCTTATGGCTCTTCTGTCTTAGA
ATTAATACACAGTATTAATCTAAGACAGAAGGTGAGGGTCTAAAAACAAAACAAAACCAT
AAAACAAACCCTCTGTGATTCTAATGTAATATTGTTGTGCTATAAGAAATGACAAGCAGG
ATGCTTTTGGAAAATTTTGGAAAGAGTAACATGAATTGATGCAAAGTGAAATAATCAGAA
CCAGAAGAACATTGTACAGTGATGGCAATATTTTTTGATGAACAGTTACTGCCAGTGACC
TAGTTATTCTCAGCAGTGTAGTGATTCAAGACAGTTACAATGATTTAGAATGCCATCTGC
CCTCTGAGAAAGAACTGGAATCTGAATGCAGACTGAAACATACAGTATTACTTTTTTCTT
TCTACTCTTTTTCAATTGAGACCTCTTCCAAAATGACTTGTATGGAAAAACATTTTACAT
GATTGCATATGTAAAATCTTAGGTTGCTTTCCATCTCCTGGGAGAGGGGGAGGGGTAAGA
GAGAGGGATAGAATTTGGAACTCAAAACTTAAGAAAAAGACTGTTAAAAAATTGTTTTTA
TATGTAATTGGGAAAAAATAAAATGATTAAACAAACAAAACAAACCCTTTTTCCTATGCC
TCTTTTCTACAGATTCCTGCTCTGGCAGTGGAGATGCCTGGCTCAGCGGATATCTCAGGG
CTAAACCTGCAGTTTGGGGCATTACAGTTCGGGTCAGAACCTGTCCTCTCAGAGTATGAG
TCAACTCCTACCACGAGCGCCTCCTCAAGTCAGACTCCAAGCAGCCTCTATACCAGCACT
GCAAGGTACAAGTCAAAGCTGCCTGCCACCTTGTGGTTTAGGTTCATGTTACTCTGAGAC
TGTTGATCTAAGATGGTGATCTTAAATCTGTTTGGGGTAGGAGAGGAAAAATTGAAGTTA
GATCTTTCAGAGAATTTTATTTTAGTTATTGATGTTCTTATTTTTAGTAGTACTTGAAGT
CAACACTATTGAGGTCATTTCTCATTTCTTTTAAGGTAGTAGTAACATGCTTTTTTGGAT
CCTCTGGTAATTCTTTAGACTTAATGCAGATGACATGTTAAGTATAGATTTCAACACAAA
TGAACAGCTGGCTTTTTGGAGGCAGCTGATGGTATAAAAGATAGAGTACTGAACCTGGAG
ACAGGGTGACTACAGTTCAAATCCAGCCTCAAGACACTTAACTTTCTGTGTGACCCTGGG
CAAGTCATTTATCTTGTATGTCTCAATTTCCTCAACTGCAATAAAATATAGATAATAATA
GCACCTACCTTGCAGGGTTGATGTGAGGACCAAATGAGATAATATTTATAAAAAGTGTTT
AGTACAGTGTCTGGTATATAATAAATATGTCTATATAAATGCTTATTCCCTTTCCCATCC
ACTTAAGTATTTTAAGTGTATGCTTGGGGAGGGGACTAATATGTAATGTACATGGTAGGG
ATGGGTAGGTGTGAGTGAAGTTGTACAATGTAATTGACATTCAAGATGTTAACAGAGATC
TGGAAAAAATAGTTGGGTCATTCATATAGTTAGAGTAAAGGATGAATAACTGAACAGCCC
CTGTACTACAGCGATCTCCATGGTGCTGGAAGGTTTGGGATAGCTAGGCCCAACTCAGAA
ATGAGTAGCATTTGCCTGAGACCAGCCTACCTACTGTTGCAAAATGTGATTAATATAGCC
CTTGTCAGTTTCCTAAAAATTTTGTGCAACTGAGGTTTGTGGTTTTGAACCCCCAGAAAA
GTGGGTCTAGTGTCCCAAAGGAAACGAGTAGATTTTTTTTTCTGTCTTTTTTCATAGCCC
CCTAGGAGAAAGATAACATAAAGAAAACCTTGGACTTACATGATCTTGTTCTCTTGTAGC
CATTTACTTGGCAGGTGTGAAAAGACTAAGTAATTATCAATAACTTGTCTTTTTAAAGGC
CTAAAGTGAAGAACGAGGTTGAATAAAGTATTGGGAAATAAAGAGGCTCCTGGAGAATGA
AACTAGATCATCTCAAGGAAACCCTGTCAGTGACCTTGATAGTTATATTAGTAAATGTTG
TGTTGAGTTCCCAGGAAGTGGTCCTGAAGTTAACTGTTCTTAATTTGAGTAATAGAAGAT
GAATCCTCAGCTTAACTTGAGTAATAGAAGATGAATCCTCAGCTTAGGACTAAATATGTG
AATGTTCATTGGATGAGGCATTATTCCAATTCAAATTCTTCTTCATAACTTTTTCTTTTC
TCCTAAAAAGAGAGAAGACTAAAGATCTGGAATAGCTAATCTCCTTCAGGAGGAGAGATG
CAAAAGATATTTTGTCTGTCTCTGTTGTTTAGCTATCAAGAGAATAGGAAGTAGCTTGTT
GTTGAAAGGTGTGCCGCTTAACAGAATTAGGACCAAATAGGTAGAAATAAGAGGGAAATA
AATTTAAGTTGGATGACTACTTGTCAAGGAATTTATAAGCCTGATACACAGACTATGCAT
GGTACTTTGCAGGTTAGTGGAGTATGGATAAAATGGATTTAAACTTGGGTCTTTCTGAGT
TTAACTCATTGCTATGTAACCCATGACAAGTCACTTAACCTCAGCTTAGTTTCCTCATTT
GTAAAATAAGGATAATAATATCACCTACCTTGTCTGTTTAGGAAGATCAAATGAGATAAA
GTACTTTGCAAACCACAAAGTGCTACCTATTAGAACTGCTTAGGATTGAATATTGTACAG
GTTCCTATATGGATTTGGAGTTTGAACTTTTGACATCTAAAGTCCTTCTCATTAGTGTTA
CATTTGGTGAATCCTTTGTGCCTTCTGATCAAAATTACCATCAAGGTTTTCTAAACCTCA
TCATTGCCTGTGCCACTGGTATTATGACCATATGTTGTATCCTGGTGGTTGCCTGGAGGA
ATTGGAGATTTACATTTGGTTATGTGGTGTTGCAGAATTTCTGTATGGAGACTGAGATAG
CCCTGTAGCTTAATAGGGCCCTTCCTGACAACTCTGGCCTTTTAATAAGTTTGATCTTTT
CTGTTCCTTATATGATTGTATTTTTCTGTTCATCTCCATAGTGAGTCTTCATCTACAATC
TCATCCAACCAGAGTCAGGAGTCTGGCTACCAGAGCGGCCCAATTCAGTCGACAACCTAT
ACCTCCCAAAACAGTGCTCAGGGCCCGCTTTATGAACAGAGATCCACACAGACTCGGCGG
TACCCCAACTCCATCTCCTCGTCTCCCCAGAAGGACCTGACTCAGGCAAAGGTAGGTTGT
TTAGCAGTCTCTGGGAGGTGGTTGGGAGAACAAGGGGATGAAATCCCTTATGGTTCAACA
TTTCACTTTGCTACAAATGCTGCAGAGGGTCCTTGGGGAGCACCTGGGCAGAAGCAGGAA
AGGAGAGCACATTGCTGCGATTGGGCCAAGCCCAGCTGACTGTTCTCTTGGCACCAAAGA
ATCATTCTCCCTGGAGGAATAAATGTAAAGATCCCAGCTGATGGAGCAGGGTTTGTGTCT
AGTCTGGTGCCTGCCCCATCTCATTGGGATATCAGATTGCTAGTGTTAGGTGCATACCAG
TAGACCTCATCTGACTTTGCCTCATAGCCAGGTGAGGGGGACAGTGTATGCAAAAGGAAA
TGTGAAGTGATTTGCCAGATACAGGCTGCCAAATTGATGGCTTGACTGAACTGCATTACT
TCCATATTCATTCCCCCTAAGAATCACTGGTCTGGGGCTCTGAGCATTTCCAGCATCTTT
TCAGGGCTCTGGGTTTCCTTGGTAGATTGGGAGTCATCACTTACTGTCCCCTAATGCATC
CAAAGCTTACCCATTAAGACTCCCATAAATTACTTTTCTCAGTCTGGGTGTGGGGAGTGT
TAATCCTTTGATTAACCTGTAGATTTCCTCTGAATTCTGGAAGAGAAGGCTTGCTGGTAG
AGGCTGAGCCTGGGCAAATGCTAACCTGCTCCCCTCACTCAGGTCTGTCTATTTCTTGCT
CCAGAATGGCTTCAGCTCCGTGCAGGCCACACAGTTACAGACCACACAATCTGTCGAAGG
TGAGTTTTCTCATATTTTTCTGTAACTGAAGGTTTTTTGTTATTGTTGTTTGTTTTTATA
ACCTCTGTTCTAATATCTATATAACCAGCATTTCTCAAACTGGATTGCATAAAGCTATTT
ACAAGGATGCCCATGAAAAAGAAAGTTATATTGGCAGATAGAACAAATCAGACAACCCAT
CTGTTTTGCTTTGTTAGTTGAGTACAATTTATCTCTGTTCCATAATTACAGGAAGCCATT
AGATATTGGTGAGGAAGACGGAGATAAAAAGATAAGGTTTCTTATTCCTGTAGAGCCAGT
CTTTAAGAATATCCAATAAACTTTGATATACACTAAGTTGATTGTTGATTTTAGTAGAAG
GAATTTAAAATAATCAGAATTTGTTTCCATTAATGGCTTTTTTTAAAACTACTTGTGCAG
ATGTGAATAATTAGACAAGATGAAAGAACTTGAAGGGATGAGAAAACAAAAATGTTAACC
AAGGTGGATAGTAAAACAAATATTCACAAACTTTGGTTCAAATAGAAAAGAAATGCACAT
ATTAAAATCTATATTCAATTTGTGCTAGTAATTCTGGCATACAATAATGACAGAAAAATT
TAAAAAAATCTTTCTAATGAAATTATATAGGCATTGTATTGATCAAGAAACTGAGTTAAA
AATTATAAAACTCTTTCAAAGTAGAAATGAATTAAAGCAATCTTCCTATCCCCCCTCCCT
AATTTTTCCTTATTTAAATACTTGGGGAAATAAAAGATTTTGATCTTTACAAGGGTGCTC
AATCCATCCAATATTCTCATTTATAAAACACCCACCTATAGATAAAGGGTAAATATACCC
TTTGGACTAAAGCTATTTATGATGATGAATTCAGAGAGAATGGGGGGGAGGGGAGGAAGG
GAGGTTTGAGAACCAAGCCTAGAGATGGGAGGTCCTGGGGTCAAATGTGGCCTCAAACAC
TTGCTAGCTGTGTGACCCTGGGCAAGCAACCTTCCTTTGCCCTTACTGATCTGCCTTGGA
ACCAATATATAATGTTGGTTCTAGGACAGAAAAAAAAGTTAAAAAAAAAAAGAATGTAAA
TCAAAGTTTTTTTTTTTTAATCAACATCATTTGGTAATTGGTAGACATTCATTTACAAAT
ATTTTTAAATTCTTACTGGAAGAGTTTTACCTAAGTTTTGTTTAAAATGAAGGGTTCAGG
GACAGCTAGGTGGCTCAGTGGATAGAGAGCCTGGCCTGGGGAAGGGATATATTGGATTCA
AATGTGATCTTTAAGATACTTCGTAGTTGTGTAACCTTGGGAAAGTCACTTAACCCCCAT
TGCCTACCCCTTACTGCTCTTCTGCCTTGAAACCAATACTAAGTATTGATGCTATGAGGG
AAAGTAAGGGTTTTTTGGGGGGGGGGGGGGGAGAAAGAAAATAGGTTCTATAGAAATCAA
AGTGGATTGTTATGAATAATTCACATGTTTGTACTTGAGGCAACTTCGAATAGTGGCCAC
TTCTTTGCTCTTTTCCTACCTTTCTTTGCAAGGTATACCTTTTTTCTATAATTTTAATTT
CCTTTTTCTTTTCCCTTTCTCCTTAGGTGCTACTGGCCCTGCGGTGAAATCTGACTCACC
TTCTGCTCCCACCATCCCCCCTCTCAATGACACAGTATCTGCAGCTTCCTTGCTGACCAC
AGCCAATCAGCACTCGTCTGCATTGGGTGGTTTGAGCCACAGTGAGGAGCTTCCAAATAC
TACCACCACTCAACACAGCAGGTGAATGGATGGGGATGTTGCTCGTCACAGTAGTCTTCT
GGGGTCCTTACTAACACTCAACAGAGTCTACTGTCAGGAAGGGTTTCAAATTCTGTTGAG
CTCAACTAAAGTAAGTCCATGTGAAGCATTTTATAAACCTTAAAATTCTATAAATCACTG
ATGGGCATTATTATTGACAGAGGTTGCTATAGCCCTGGCTTTGCTGTAATCAGATGATTT
AAGAACTTTGGAGGCAGGGGACAGCTTGGTGACACAGTGAATAGAGTACTAGGGATAGTG
TTGAGAAGACCTGAGTTCAAATCTAGCCTGAGACATTTCCTAGCTACCCCATTTACCTTC
CTTTCCCTTTCTATCTTAAGAATTGTTACCAGGACAGAAAGTAAGGATTAAAAAAAAAGC
AAAAACAAATTTTGGGACAAAGAGAAGGTTCCATCATTTTCCAACAACCACTTGTTTTAC
TGATCAAATAGAGTAATTGTTGATCCTCTGGTTCCTCTCCTTTTTTCATGATTCCTTGCC
TGATTTAGCATCCCAAGAAGAAATAAATGGCTGAAATCTTTTGACTGATAGCACTTTCTT
TTTTTTCCGTCTAGCACATTATCTACCCAACAGACTACACTTTCGTCATCATCATCTTCT
GGGCGAACTTCAACATCAACTCTTTTGGTGAGTATAAGTTGACATTGCAGCTGGGGAAAA
GGACTTCCTTATGTTTACTGCCTCCTATCAGGAAATTCTTTATTCTTCACTTCTATGCAT
CTTACTTTGTTTTGTGCTCCTTAGTTAAGTGTTAAGTCACTTAATTCCTCTATAAAATAA
AAATGATTTTAAAAAGATCGATATAAAATGAATTGTGTGTAAGTGAAAATGAGTACTTCA
TCCATAGAAGGTAACTTAGTAAATACATGTTGAGCTAAATGGTGCCAGTTTCCTACATAA
CTGCTTTCCAAATTCCTTGATGTACAAAGGTTACTTCAGGTTGGTTTTTTTTTTTCCCCT
TTAAACAAATTTTCTTAAGAGCTCAGATGATTGCAAGTGAGAATGAGACAAGAGGATAGG
GGTAACAGAGTGATGGCAAGTGAAGTAAGGGGTGAGAGAATAGAGCCTAATGGTAACAGA
GGGGTACACCAATCATTTGAAACTTCAGCACTGTACATTCATAAGTCACTGCTATAGTAG
TTTTGTTCAAGTCATGTTCAACATTCATGACCCCCATTTGGGATTTTCTTGAGAAAGGTA
CTGGAGTGGTTTTCTTTTTCCTTCTCTATCCCATTTTACAGATGAGGGCATTGAGGCAAA
TAGTTAAGTAGCTTGCCCCCAGGATCATCTAGCTAATAAGTGTCTGAGGCCAGATTTGAA
CAAAGGAAGTTAAATCTTCCTGACTCCAGACCTATCACTCCAGTCACTATATCACCTAGA
TTTGCTTTAATTCAGGACTTTGGGTGGCTCTTGAAAGTTGCCAAACACTTATTATCTTTT
TTTTTTAATTAGACCTATGATTTTATTGATTTAGACAACTCTCTTTTACCAGTGCAGAGT
GTGGCACCTTTTCTTCAACTTGTTGAGAGTTGTCTGAGGCTCTGAGAGTGTGGCACCTTT
TCTTCAACTTGTTGAGAGTTGACTGAGGCCCTGCGAGGTTAGATCATAAGGTCATAGATT
AAGAGCTAGAAGATACCTCAGAGGCCATCTCTGTGATCTTTTGACTCAATCACAGCCTTG
TGTGATTCCTTGCTGTTACATTATGTTTTCTTTTTCACTTGGCCTGGCATGTGCATTACA
TCCTTGTCTGAACCATTAAAATGGAGGCCATACTTGGAACTTTTAATAGCAGAATCTTAT
CACCTATTTGTGGCATTTCCCTCAAAGTGGCTTTATCCTAGAGTACTAATTAAACAAGAT
GTTTCAAAATCCTCATCTTTTCTAGAGAGGAGAATTTGGGTAGGTGTTTCTGGATCTCCT
TTCAAATATTTTTTTCCAATCTATTCTGGAATTCAACTTAGCCTACCTTAGTCTGAGGCC
TGGAGAAGTTAATTGAGTTGCCTATTAGCAGAGTTGACCACCTGATTCCTAGACTAGTGC
TTACTACTATACAACATGATTTTATTAGACCTAAATTTGCTAGGAATTGTAGTTAGAATT
TAAATTTTTTGAAAGTCTGTAAAACTTCCAGGTATTTGAGAAATTTTATTAATTATGAAC
TTAGGGATAAGGAACTGTCTTTTGCCTCTTTTTGCATCCTTGGTGCTTAGCATAATCCCT
GGCACACAATAAGTGCTAAGTAATTTATTGACTGACTAAATTTAAAATACTACTTGCCTT
TAAGCTCCTTTCACCATTCTTATTATGATGAAGTTATTTCTTCTGTCCCTTGAGATTTAT
AGGTCCATAATATTTAGAGTTGGAAGAAATTACTGATATCCTTTAACCCAACCTCCTCAT
GGTATCTTGTCCAAACTGTGTTCCAAAGGAATCCCCACTAGAGTACAGCTGCCTGAGGGT
TGTTTGATTTCACTTTCAATACATTCAAGGAGAGAGAACCTACCATATCTCAAAACAGTC
ATTTCCACTTATGGGTAGCTCTGATTATTAGGAAGTTTTTCCTGACATAATTTTGTTCTT
TGTAATTTATACCTGTTATGCCATTTGAGGCCCAAACAAACAAATCTAATTTCCCCTGCA
CATGACAGGTCTTTAAATTCTTTATTTTGAACTCAGGTTTTCTGATTCAGATCTGTGCTC
TTTCTATTATAAAATGCTAATTTTTTATGGGGTTCCCAGTTGTCCTTGTATTTGAGTAGG
TATTTAATTTCTGACCTGATATGACAACTCTTTTCCTGGATGATGGAGTAACTCGGCACT
TATGTCCCAAGGATTTGTCTTGGATATGAGACATGTTTTGGTGGGTGCCACATTCTCATC
TTGTCTTTTTCTGGCAGAGGCTAGTTACTTGGGCAAAAGCAGCTTTGCACATCCCTGACT
AGATTGTGGTATAATGAAAGTAGGAATAATTTTGAGGTCAGAAGATCTGAATTCAGATTC
CTGTTGAATGTCTTGTTTGTGGCCTTAGGCCAAGTCACTTTATCTCTCTATCACTTTATC
TTTCAGTTGAGATTATGATGATATTTAGAAGCTTAAAGAAATTTACATGTATTGAGTAAT
TAGGGTTTTTTTTTCCTCTCCCATATGGTCTATTAGAAGGGTAACAAAAAGGAAGCCATT
ATGCATGACCACATAACATTCTCTAACACCAGGAATGGCATCTTTAGATCTTAACTTTGC
TTTTTCTCATATTAATTAGCATAGCTCTTCAGATGCCTTGTATGAAGTTTCTTTCCATAG
TAGTTGTTTTCCCTTTCCTGATTTTTAGAACAATAGTTCTTAGCTAGAATGGTTCTGTAT
TTGAGAGACTAATCCCTAAGACCTCTGCTAGCAAGGTGGGGTTATATAATAGTCTTCCCA
TTGCTTTTGAATGGGGTGCTCTTGTATTCTCCCAGCTCTTCTGATTAGATGTGCTCATTA
CTTATTTAGTATCAGGGTCTTGGATTTCTTACCTAAAGCAACAATTTCTCTTCTCTTCCA
CCTCTCTACCTCCTGTTGTTTTTGTAGCACACAAGTGTTGAAAGTGAGGCGAGTCTACAT
TCTTCCTCCAGCACTTTCTCCACTGCATCCAGCACAGTCTCGGCGCCTCCCCCTGTGGTC
AGCGTCTCATCCAGCCTAAACAGTGGCAGTAGTCTAGGCCTTAGCTTGGGCAGTAATTCC
ACCGTCACCGCCTCAACCAGAAGTTCAGTCGCCACGACTTCAGGTAGCCCTATTTGGGAG
GTGGGTGGTACCCAGTACCCCTTTGGGTTAAAGAGGACAAGGAATGGTCATTTATCATAT
TAGAAGTGCCCTTTCTCTTTCAGGAAAAGCTCCCCCAAACCTTCCTCCTGGGGTCCCACC
GTTGTTGCCTAATCCATATATCATGGCTCCAGGGCTGTTACATGCCTACCCGGTAAGTGG
GATTTGGGAGATATCTCTGAAGAGTAAGGTTGTCCTCCTTTTCCCCTCTCCTTTAGCTTC
ATAACTGTCTACAGAGGAGGTATAATAAGAATATTCCAGAATAAGCTAATTGGAATCAGA
TATAAAGAAGAGTTTATTTATTTATTTTTTTGGCCTTCCTGAATCCAGAAGATGAATGAG
GTCTAGTCAGGCCTTCCCATCATCTATGCCTATAGTGGCTTTTTAGTGGTTTGAATTTGA
GACCTGTCTCAGTTTCTCTTAAAGAAAATAATTTTCCTCTCTATGTCTTTGACACCCTTT
GAGAAAAACTTATGTTTGAATTTTTTAACTTTGTTAGGATAGACTCCAGACTTACCAGAA
GATTGGACATATCTAACTTTCTGATTCCAAGAATGTTAATTGGAGTTCGTGTGAGTGCAA
AAAACCTAGCACGAACTCAGTAGATTAGAGTTGAGGTGTCACTGAATGAAAGAGTATATA
ATTTGACAAGGCTTTTTTAGGAGATTTTATAACAGATTTTGAAAAAGGTGGATAAAAATT
GATTAATGGGTTTCTTCCCTCCCTCCCTCCTATTTTATTAAAAATTCTAAAACAGAAGAC
CTAGGCAATTGGGGTTAAGTGACTTGCCTAGGGTCACACAGTAAGTGTCTGAGGATTACT
GGGTTGGGGACCTCTTGTTTCTAGGCTTGGTTCTCAATCCACTGAGTCATCTAGCTATTC
ACTGATGAATGGATTTTTATCCCAGCTCTACCACTATGATTATAAAATTACTCTTTTGGC
CCTTTTGCTTTTTCCCCCTTTAAAAAAGAAATAAATCATATGTGTTTTTTTCTGGTCTTT
TGGAATTATTCTCATTTAGGGGATAGAATGGAATTTCTCTTTTGAAACTGGATTTTGGCT
TCTCTTGACTCTTTTCTTTCTTGGCCTGTCCTTGCCATGTATGAGTATGGTTAGGAAGGG
TCCAGTGACTAACCTTCCCTCATCACAGATACATCTATATCTTTCAGCCACAAGTGTATG
GTTATGACGACTTACAGATGCTTCAGACAAGATTCCCCTTGGTGAGTATGTGGGGTAGAG
TCCTGATGAAAGAAGGTGCTTAGAGAAACTAGGAATTTATGGGAAGAAGTGACTTCTTAA
TGCAATAAGAATTATATGACAAGTTGAGACTCCTACTCAACATTCCTCAGTGTTCTGGGA
CCCTGGGTGTCTTACTTTCTCCTTGGGAAAAGGCTTTGTACTCTAGAGTGATGTCTATTT
GCTCAAGAAAGTAATCTTGTCTGTTACTCGGAAGGAAAAGACTTCAGCAGGGCTAGGATA
TATATCAGGATAAAGGATCCATATAGGTACTTGGGCAACTTAAACTGGCACACCAGTAGA
CCTTGTGTAACTGCCTGTAGTCACACAAGGGGGACAGTGTGTGCCAGAGGAAGCAGAGCT
GCTGTGAGCCTATGGCCAGCACTATCAGTGGTTGGCTGTATCACATTACTCTGACATCTT
GTTTCTGATCCTCTGGAGAAGCACTGGAATGGGGACTAAGGCATGGAGTCTCATTCTCCT
TGTTCTGTTTTCTAGGATTACTACAGCATCCCGTTCCCTACACCTACCACTCCGCTGACT
GGGAGGGATGGTAGCCTGGCCAGCAACCCTTACTCTGGTAGGATTGGGATGGGGCTGGAC
ATGATGGGCGCTCATGGGATTTGTCTTTGAATTGTGTAGTCAGCGTCAAGAAGGACTTAG
AACAAATATAAGATGTCAGCTTTGGGCTGCTAGTGGAAATGACTTGTTGCTATGGCCTCT
TCCCAGCTTTTTCTTTTGTGCCTATGGTTCTACTGTTCACCAGCTTTTCTGGGAAAATGC
ACTGGTCCACACTTACCTCATGACCTCATCTTCTAATCTGTAGCTACTTGAGCTCCTCTC
TCCTTGTCCTTCTTCTGGTAGCAGTCTTTTTGCTTTTTAGATGTCTGGTTTCCCTGGTCT
TTATTTTTTCTGATCTGAGATTATCTTGATATGCTTGCCTAGGAGTCAGAATGATCATGA
TCCATGTGATCTTATTGCTTAATCTCCTTGAGCTTTGTTGTCCTTATCTGGAAGGGTCTT
TCTCCACCTCTGACAGGGCTAAGAATCCTAAGAGAATACATGTAATAGGCTTTGTAGCAG
AGCAATGAAGGACTCTGTGAATATAGCTTTCATGTTTCTATCCTTTATTCTCTTCACTGG
CCCTATCTCTCTCTTTCACCCATGTATATGCACTTAATGGAGAAGGGAAGATAACTTTGA
TGAGACATGGCTAGTGAGTGCAAAGGCAGCCCCATATCCAGAGTGATGAAAGAGAGCATA
GATTACCAGTGTAGCAGAAGAAGCTATGCAGAATTTTGAAGGATATTTCCTAAGAATCCC
TTACTGTTGCCCCATGGGCAGCTGTAGCATTGTTACCATCAGTGTCCACTTTAGTGCCCT
CCATGCAATAGGCATTCTGGAAATGTTTTTGAATGTGATTGTGGCTCTGAATCTTTGCTT
GGTGTGTACTCAGTAGTTGGGAGTGTCAGAGAGGTACAGAATTTGATAGCGAGGAATAGG
AGAAAGTAAGGAGGTTAAAATATCCCAGATGGAGGGAATGGCATTTCTCTGACTCACTGG
TACCCAGAAGTTAGCAGAGAAAACCTTTACATGGTCCTTAGAAGCCATAGGGATGTGTAG
ATCTGGGTTTTCATCTCAGCTTTATTATTAAATTTAAAATATGACACTGTAAGTTACTTG
ATCTATTAACTATATTTTTGCAACCTTGAAAAGGTACCCCCCCCCCCAAAAAAAAAAAAC
ACCATGTAATTCCACATTGACTTTAGAGGTGAAGGGACCCTTGTACATTTAGTCTTTCTT
GGCACAGGTGACCTCTCAAAGTTCGGCCGTGGAGATGCCTCATCCCCAGCCCCAGCCACA
ACTCTGGCACAGCCCCAGCAGAATCAGACACAGACTCACCATACCACACAGCAGACATTC
CTGAACCCGGCGCTGCCTCCTGGCTACAGTTACACCAGCCTGCCATACTATACAGGGGTC
CCGGGCCTCCCCAGCACCTTCCAGTATGGGCCTGCTGTATTCCCTGTGAGTACCTCAACT
TGGTCATTTCCTGGAGGGGAACTTTCCAGATCTTCCTTCACTCAGCCTGACTCTTCCCCA
CTGGCTCTATCAGTAGGTGGGAAGGCATTCTTGACCCCAAAGCTTTGGGGATAATGATTA
GTATAAATGAGGAATGTGTTCTTATCTAGAAGTTATTTTCTGCAGATATGTTACTAGCCT
GAACTTCCCTCTCCCCAATTACCTTCACTTGATCATTCTTGACAGCATTGGTAGGATCTT
AGACCTTTCATCCAGGTAGTAAAGTGAGCATCCCACATTCCATAATGGAGTTAAGTTCCT
CCTTTGAACTGACCAGTCTACTGCTGTGAGTTAGGCCCATGGGACAGAGTCTGGGCTGTC
CTCCCAGATCACTGAGGCCCCACCCCATTCCCTTTTAGGTCGCTCCTACCTCTTCCAAGC
AGCATGGTGTGAATGTCAGTGTGAACGCATCGGCCACCCCTTTCCAACAGCCAAGTGGGT
ATGGATCTCATGGATACAACACTGGTAAGCCCAACTTGATCCCAGAAGTCTTGGTGTTCA
GAGGGAATTGGCTATGGGGAACATCTTGGAGGAATCAGAGTTAGGGTTGGAGAGTACTAT
GAAGGAGAGGTGCTAGATATTGGACAGTTGACCCTCAGGTGCCTTTAGCCTCTGTAGAGT
ACTAGCAAAGAAGCTTGGCATTGTGTTCTAGTGCCCACTTGCCTGAATATGGCCTATGCT
CAGGGCATGTGTTTGCTGCCCAGTTAGCATGGCTTGTTAGCATGGGGGACTGAGAATTGG
TTCAGATGATGTCAGTGGAAGTAGGTGGCAATTTGTGTGGCACTAGTAAACTCCAGGGGA
GACAGGTTCTATGTACCTGGGGATTGAGTATGTCCTCAGGAGGCTGTGGCTGCCTCAGTG
CTGTTCTTTTTTATGTGCCTGGGTTTTTCCTGTGGTTTCCTTTTCCTTTCCTCAGATCAG
AGAACATGGAGTGAAGTTTAGGGGTAGAGGGGTTAGTTAGTAGTACAGGAGGAACTCGAA
GGGCAGTGGCCTAGAAGAGGTTGTATCTTTTCAGATGTTCTTTCGAGTCATATGACCATT
CTCTTTGCACAAGCCTGATTGCATGTCTGTGCTGAGGAGACAGCTCTTTAATGACGTGTT
ATTTTTTTAGCTCAGCCATGAAAAGAGTAGATTGCAGGGAGGTGGTGGTGGTCCCTCAAG
TAGATGATGGGGTGAAAGACATTCTGCCTGGCATCTGCCTTATTTTCTTAGTCTTATTCT
TCATTTTCAGCTGCTTGCAGGCTCAGTTATGTATGGGAAAGAGAATGTTGCATTGGTAGG
AGTGGGGTTTGCCTCCTTATGAGTCCCTTAGAGCCTTCAGCTCAGTCTCGGCTCCAGAAT
ATTCTGGAGGCAGCAGCTTTTGTGCTCTTCCCTTCTCTGTGGGCATCAGGTGGGTAAATA
ATTTCAGATTTTTTAAGAACAGAAATAGGGCACGTGACTAGCTACTTCTAGTAGGGTAGA
GGCATGAAACTGTACCGTGTGACTTAGTTTTGTAGTTTTGGGCTGAGAGTTTTTGGGAAG
TCCCGTTGGGACACTCCTTACCTAGGTCCTAAGCCCATCTGCCCCTTTTACCGAGCAGAG
AATCTCTACCCCAAGCACCTTGGAGATGGGACCTGATTGGGGAGGATAAACTCTTATCCC
TATCACCAAAGCTTTAGCTTTAGATACTGGCTGGGCCAGGGTCAGAAATCTGAGAGAACT
AGATATATGGGGTTTTATGGTCCTGTGGTTACATAAGAACTAAGGGTAAATGGGGGACAG
CTTTGCTATTCCTCTCCCTACCCCTTCCCTTATCCCCAAGATTTTGGAAACTTGATGTGA
TTCCTTTCAGTAGTCCCATTTCCCCAACCCTATAGGGGATTCTGGTCATTCCCCCTCCCT
TATCAACCTCTTAAATTCATTTATTTTTATGTATCTGATTCCTTTTAGGAAGAAAATATC
CACCCCCTTACAAGCATTTCTGGACGGCTGAGAGCTAATTTGGCCCATGGCTGGGGGCTG
TGTTTTGTGTGTGTGTGTGAATTTGCACTGAAGTCTTGTTTCAGAAACCAGACCACTGAG
GAGAGCCTGCTGAGCTGAGGCCAGGGCCTTCCTGGCTTGGGGGAATGAGTTGGTGGATAC
CTTCTGGGCTTTTGATCCTGCCCCCCTCTTCCCCCCCTTCCCTACCCCAGTGTGTCTGAC
CCTGTCTTAACCATTTCGAGTACAAGCGGTGCAGCGCCTCTGAAGCCGCAATGCACACAC
CTGCTGTCGCTTTTGATTTCTGGAAGGCATGTAGTTTCAACTTGTAACAAATATTTGTAG
TCTTCAATAAACTGTGGTATTTCTTTAGCTAACTCTGGCGTTCTTTCCGTGCATGTCTCT
CTGGACAATAGGAGCTAATATTGTGCTGTGGATGTGGGGGTTGGAGGGGTGGAAGGATAA
TCTTATAAGTCAAACCCCCAGCACATCCAGAGAAGCCACTGGTTAAATTTTTGGTACATT
TGTGGCTTACTCAGGAAGATAGTAGCAATTTCAGTTCCCAGCCTATTGGTTGGTTATTGA
GGAAAGCTAAATTTGTAGGAAACTCCTGATTTCCCTAGCTTACTCTATTCACCTTTCCAT
TCATCCCTCTCTTTGTCTCTACCCTAAAGCAAGGTGTTTTGGGTAGCACCTATGGTAAGA
GGTAGAAGAATTGATGTTGGGGATCCAGAACTTAGGAAAAGTCTTCAGTGGCTTAACTGC
TATTTCTGCCTCTTGGAGACCAAGTGAATGACTTGGATATATTTTGGTCCCTTTATGAAT
CCTCTTTAGTCAGAGGTAGGGCACTCTGCCTCTTTTCCTTCAAGGACATGTGACTCTTTA
GTGGTCCTCATAGATTTTTGGATATAATTGAAGACCTGTAGGTAACATTTTGTCAGTGTT
TTCTCCTTGGCTCCCTTCCTAACCCAAACTTACACACAATCAGTCTTCATTTTATGGAGT
CATTTTGGGTTTGGGGCTAGACCCTTCTTTGGGAGGGAAGAAGGGTGCCAAAATTATTGA
ACAGTCTCTTCTCCCCAATTTTTTCTTCTTTGCTAGCCAGAAGCCTACTCTTCACCTTTC
TCCTCAGCTTATTGAAACCCTTAAATGATATGATACGGAGATTTGATCAACTTTCCCAAT
CATAGGTGTTTGTAATCCACCCTCCTAGGGAAGAAGTGTTCATACTGTTTCTCCTGTTAC
AACCTTTCACATTATGTTGATATGATATATATATATATAAAACTTCCTTTGGGGTGAAAG
GCATGTGCCATCTTGAGAGGATCTTGCCTGGTACCTTCATTTGAGTGAAGGAGTTGCTAT
TTCTCTTCTAAGTCCTTTTGTTGTTAATCTTAATTTCTTTGCCTACTTAGTTGTGAGACA
GGATTTTCTTTCTCTACCTCTGCCTCAAATAGCTATGACTTATGGGAACTGGGGATTTAT
TTCCAGTGGCCTCTGATAGAGCTAGTCAGGATGCCAGTAGAGGACCCATATTTTTCCTCT
TCCACAAATGGAAAGCCTAGCCCTTCCCTTAATCCTGTTGTATCACTGACCCCTGATTTC
CCAAGGGGAGCCCAGCAATATTGGCTAGCTGACTAGAGCATAGCAGTAAAGGCAAACTTG
TGTTGCCTTTGAGTTTACCTTCTAAATTATTCTCATCCCATCTAACAGCAAACGTGCCCA
CACACACACTTCCCCTTAAGTTTAGGTCCTTGTAACTGGGGTCACTGTCCTGGAATACTT
GGAAGTAAGGAATTCTGCTTTCATTTCTAATTTATCAGAGAAAAACACTGAGGGCTTAAA
GGAAACATTACTGACAGGGTTCTTTGTCCTTTTCCCTCTCAACTATCAATGCTTCCTTTC
TTAAGATAGAGAATGAGGACTTTCCTGGGAAAAGGGGAAATAAATATTTGCCATCAGTTG
GGAGCTTTCCTGCACGTTGTCTGGTCTGGGTTTTTGTGGGGGAGGGATTGCTCTGGATAT
AATGACCCATCTCTCTTTTGGAAAGGTCTTAGTGGGGTATTTAGCCTCCATTTTGAGATG
ACTGGAAGCTGACAAGGTGGGCTTGAATGGAAAGGAGAACCTGGATACTAGGCCTGGAAT
GAGCACCCCATGTGTTATAGGATAGGAAATTAACTATACATAAGGATATAGGTGGAGGGA
GCTTTATTTGTGGTTTGATTACTATAGAAGTTGGTTTGTATCCCTCTCTGGTTCCCCTGG
AACTACTGCAGGAGGAGGGACTTCCTGTCAGGAAGGAATATGTGAGACAGGATATCTGAC
TTTAAACTAGCAACTAACATGATGGGACTCTAAATTGCATTTGAATTGTGTAATCTATGT
GAACAGTGACCTCTATCCCTGGATCCTACATGGTGATCTGTGTGCTAGTTTGTTTAACCT
GTAGACTTATAGCAGAGGCAAGGCCTTTGGGAAAATTGGGGTGAGTAAATTGAAACTGAC
CACTTTTGAGTGAGTATGGAGGTCAGGTAAGGGAGACTGGTTATAGAGGCTGAGTCCCGA
GTTGGCCTCTTCTGTTTTGGCATTCACCTTGACCTGGCTCTGGGGCCCAGGAATTCCCTT
GGTACTTGGATAGAGCTTTGGAGCCTGCTGAGGTAGACATAATTGGGTGGAAAAGTGGAA
GGGTGAGATGATTTTTAAGTTAACTTTAACAGCAATTGAATTCCTGTTGGGATTTGGGAC
AGAGGGTCCTGGAGATTGTTCATGTTACTCTGGTCTGGATATAGGCTTCACTGGAAGCTG
GACTTTCACCTTTTACCCCTTACTTGGACAAGCCAAGCTAATTCTTAAGGAGCCCTTGTA
TTATGGGCTCATTACTTAGAACTGGACTGAAGCTTCCCCTGCAATGACTTAGTTGGAAGA
ATCTCAGATATCATTACCTTGACCATCCCTATTCATCCACTTCTCACTCCCACTTAACTC
AGGGACCAGGGTAAAGGACAGTCAGTTATGTTAACCCTCCTATCTCTTTCTTTTTCAGGT
GTGTCAGTCACCTCCAGTAATACAGGCGTGCCAGATATTTCGGGTTCTGTGTACTCCAAA
ACTCAGGTAACTTCTTAGCCCATTCAGCAGAGGTAGAGAAAAGATACTGGTAGAGAATAG
TGTGTTGTGACAGGGGTGAAGGGTAGGCCTTAAGCTTGGTGTCAAGAGACCTGAGTTCTT
GGATTAGGACAAGCAAATTTAAAAAAATTAATTCTTCTCTAAGGGTTGATAATTTTTTGC
TCCTTCTTACCTCTTCATAATTAAATGAAAGAGTAGAAATGGCAAGTAAAGATGAAGGGG
AGCCAAGTCTCAGTAATCCTTCAACTGACTGAGATTGTTATGGCTCTCACCCACTTTGAT
TTTTGGCCCCTGTCATTCCCAAAGTAGATGAATATAGAAAGAAAGTGATAGTAGGGAAAT
AGAAAGAGGACCTTAGTAGCTGAAGAAAACTTCTAGATTATCTGTGGATTTGATTTTTTT
ATTCACTGTTCCCCAGTGATGTCAGTTTTCTATAATTTGCTAGAGATTTCAGGGAGATAT
CCATGGTCAAGCTTTCAGGACCTAAGAATTTTCCAACTATTCCATTTCTTCTAAGAACTC
AAAAGTAGTTCTGACTGCTACCTACCCTTATGCATAACAATCCTAAATTAATTCAGTGAG
TATCATTGGTACTTTTAATGTATAGTTACATTACCTGATGTGCAAGAATAAAAAACAATG
GAAGTTATGGATATTGGTTTCTTGGGAGTTTCTGGTTTAATTCAAAGAAGTACCAAAAAT
GAAGAATGAAGTGTTACAAGATAGAGAATCAGGAGTAATCAGGAATGTCCTTGTTTGATT
CCATTGTGCTTTCCCTTATCCTTGAACAGCAGTCCTTTGAGAAACAAGGTTTTCATTCTG
GGACTCCTGCTGCCTCCTTCAACTTGCCTTCAGCCCTGGGGAGTGGAGGGCCCATCAATC
CGGCCACAGCCGCTGCCTATCCACCAGCCCCTTTTATGCACATCCTGACCCCCCATCAGC
AGCCACACTCCCAGATCCTCCACCACCACCTGCAGCAGGATGGCCAGGTAAAACACCATT
CCCCTCTTGTCTTTCTTCCCCCACTGATCCTTTCCCTCCCACTCCTTAAGCTGCCTCCCC
CTTCCCTCTTCCCTTCCCTTTCCCCATCTATCCCCAGCGCCGGCCATGGGCACACAACAC
ACACAGACACAAGCGCACACGACACAAGCGGCCGGCAAGGGAGTTGACAGAGAGGGGGCC
AGGTTGGGGAGCTTTTTGCTCAGCCCAGTAGCTACTTGGAGGGGTTTTAAGTCTCCTCCC
CACTGTGGCACACTTTATCCCCTATATTTTCCCAATAGCCCTGGACCATGCCCCACCCTT
CCCCATTCCTGCCACTATAGCTTTCCCTTCTAACCATGGATTTCTATTGTCAAAGTTTGT
CCCTTTATTTTCCATATATCCTGGTTCTGCCTCAGCTACCATATTTGCAGATGATTCTCT
GTTGCCAGCGCCAGCAGGAGGAGCAGGTAATGAAACTCTCTGAATGATATAATTGTACCT
ACCCCCTGCCAGCCCCAAACCCCACCTGCCACAGTCCCAGGGAAATCAAGGAGAAGAGAG
ATTGCGCGGCCACAAATCGGGATACACAGACACACATAGACACACACACATACACCTTGC
TGGGCTCTCCGGCCTCCCCTTCCCTTCTCCTCCTCTCCTTTTTCTCTCTTCCCAACTGTA
GAAGGCACTTGGCTACTAGTATGGATAGGGTTCTTGGGAAAGCATCTAAATCTTGGAGGC
CTTAGACAAGTCTCCCCCCAACCCTGCTTAAGTATATAGGGGTCCAGAGATATGATTGGG
GTGGGAGGGATGTTGTGGAGCCTATTCTGTTATATATATATATGCCCTATATCTCCACAG
CTGAAAGCAGTGTGCTCCTTGTTTTCTAAGGCAGTTTTGCAAATAAAGTCGTAGGGGAAT
CAGCCAATTAAACTAGCAATTTTAACCACTCATCTGAGAGTCTCTTTCCAGATGAATGGG
CTTTTTGGTGGGTTGGTGGGGTAGGATGAAGAATGAGCAGAAATGATGTAGTCCCTTAGA
TGAGCTCTGAAGGTGTCTTGCCCTCTGCATTTTCTTCTTGTCTTGAAATCAGAATTGTGC
TTTTGCTGACCGGAGAGGGACTAGAACTTCCAAGGGTTCCACCGATTATGCAGACAACAA
CTTCTTTGGATTAAGGGCTTAAGGGAGAGTGTAGCCTCTGAATGATCTTTTGGCAGGAGG
AGAAATGGAGGAACATGACAGTTCCCAGGCCTTCCCACCCAAAGGTCTCTGCTAACTGGC
CTCCTTTCTCCTCCCTGTCTCCCCCCCCCCCCCAAAATCCCTTCCCTGCAGACGGGCAGC
GGGCAACGTAACCAGACCAGCTCCATCCCGCAAAAACCCCAGAACAGCAAGTCTGCCTAC
AACAGCTACAGCTGGGGGGCCAACTGAAGCCCTGGCCCTCTTCACCTCCTTGGCCCCCCT
ACCTGCCGAGAGGGCCTCTCAGCCTGACACCTAAGGAAACAGCTACAACACAAAAACACC
TGGAACGGAAGGTCCTGCTGCCCCCGCAGCCTGCCCCAGGCCTCAGCTTCACTTCTGAAA
GCCCATTTCTTTCCTCTCCTACCTATCCTCTTGTATGTAATATAGGATTTGTATTTTTTT
TCCTTTCTCTTTTTTCTTCTCTCCCCACACTACCCTTGCATTCAAGATTATGAAACTCTT
TGCTGTGGGCTCTGGCCTTCCTCTTCCTCTTCCTGCTCACCCTGGTGGTGGGAAGTGGCT
GGGGGAGAGGACCCCAAATAGATATCATCAGCCCATCAGCCCTAAGTCTCCCTTTTTATT
ATTAGGAAAACAAAACAAAAAAACGTCATGAATATGAACAGAATTGTCAGATGAATTAGT
TGAAGTGGTTTTTTTTTGTACTGTGTCCTCAAATTTAATGGATTAATGTGTCTTGTATAT
ATAAAAAGAAAACCTCTACCTTCAGCCTCTGCCCATTCTTGCTTCGTCTAGGATGTCCTC
AGTCTCCCTGATGACCAGCTGGGTGAATAAGTATTACTGTACCAACTGAGCCTCCACTAG
CAGGCTCCGAAGGCAGTGGAATAAAATGAAATCTTCGCCCTTTAACAACTCCTAACCATG
ATGTGCCGGTGTCCCCTTCTTCCTGACCCTAAGAGTCATTCAGCTCAGTTCTCAGAAGCA
TCTCACCTTAGTGTTAAACTAGGGAGTGCCGAGGACAAGGGGGAGAAATTGGGTTGAAAA
CAAGTGTTTTCAGACAGAAAAGCAGTGGAACATGGACTGCTCTAAACATTACTTGGGAAG
CACCCAGGAGTAGGATATACTACACGGGCAGAACCATTTTTTGTGGTTTTCTTGGGAGTA
TGGATCATAATAGTTCTTCCTGTTCTCTCCAAGAAGCTCCTGAACTTTTCTCATTGTGAG
TCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 2673..2750, 3655..3765, 6538..6706, 7327..7422, 8114..8159, 8698..8810, 12659..12711, 14507..14592, 16224..16395, 19049..19250, 19787..20064, 21912..22084, 24341..24530, 25264..25318, 26906..27080, 27674..27746, 30687..30882, 30983..31071, 32087..32140, 32655..32736, 33967..34184, 34598..34703, 39238..39305, 40109..40306, 41631..41723
1001..1090, 2673..2750, 3655..3765, 6538..6706, 7327..7422, 8114..8159, 8698..8810, 12659..12711, 14507..14592, 16224..16395, 19049..19250, 19787..20064, 21912..22084, 24341..24530, 25264..25318, 26906..27080, 27674..27746, 30687..30882, 30983..31071, 32087..32140, 32655..32736, 33967..34184, 34598..34703, 39238..39305, 40109..40306, 41631..41723
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved