Monodelphis_domestica Locus ENSMODG00000008452
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000008452
Monodelphis_domestica
ENSMODG00000008452
2
SNORA14
1906..2040
17823
TCTAGATTCCATATTGACACAGGTGAGAGAAGAATCTGTATCTTCTGACTTCAAGCCCA
GAGGTCTTTCCTAACTGGAGTTGGCAACAGGGAACTGGCATTTAGAGCCTGTAAATCGTG
GACGACCCTAGATCAGGATTCGGCTTTTTTTTTTTTAATCTTTGCAATTCTGTATAGAAC
ACAATGGAGTATGGAAGCTCAGAGGAAGAGAAATAAGTTGGAAGGTTATTACAACAGCCC
AGGTACAAATGGCAAGGGCCTCCAGCAGGATGTCGTTAGTGTTGTACAGGGGACACTTTG
GAACTTTTCCAGAAATAGAATAAGACTTACAATCTGAGCATCTTAAGGAGAGGGAAGGTT
ACCAGGGAGAGTTTGGAGGACAGCCGATTGGCAGAAAATAGGGGAAGAGAACTTTTTCAT
TAGAATGACACTCACTGCTTGCCTGGCACCAGGTAAAATAAGACATGGTCGCTTCCGTAA
TCAGCCTAAGTCTATACAGGGTGGGTGGAGTCGAGGGGTCATTTTACGGCCAGCCTTGCT
TGTCCAGGGAGCAGCGTTCCTTCATGCCAAGTGTTTGCTCTCATTAAGAGGATATGTTTG
CTCCAGAAAACACTGCCATTCATTCATTTAGCAAATGTTTATATCTAGAGTTTTTTAGGC
GTAAGTCACGAACTTGGCGTATTCACCACCTGTAAAATTATCATTCACTCCCACCAGTCC
GCAGACTTTGCCCAACGTGGTCAGATCGCGTCCCACTGCGCATGTGCGCAGCGAGGGCAG
CCCCGAAAAGTGAGACCTTTTCTCTTCAGGCTCTGCCCTAGACTTCTAGGAAGTGTCGCT
CTTCAACTACGTCAGAAGCGGAAGTAGAACGCAGAGGGGTCCTTTTCCCCTCTAGCTGAC
TCCGCCCTCGACGGAGCGGAGCGAGCTATATTCTCCTCGCTTGGGGTCAGCGGGGGACTG
CACTTGTGTTGCCACTTCCAGCGCGAGCAGCGGCTGGAAAAATGGTGGGACGAAGTGGCG
CGATTGCCGCCGGCGTGTGCGGTGCGCTCTTCATTGGCTACTGTATTTACTTTGATCGCA
AGAGACGGAGCGACCCTAACTTCAAAAACAGGCTCCGAGAACGTGAGTGGGTCCCCGCCC
CCTCCTTTCATATCCCAGTCCTGGGCTTGCAGTTGTTCCTCTCTCCTCATGTTTCTTCTC
CTAAACCCCTTTTTTCGCGCGGGCGCGCGCTTTTCTTCTCCCTGTGGGACCACGCATAGC
TTAGCTAACGGGCTCCACTCTCGTGGCCAGGGCCTGCCTTCCGCGCACGTGCCTTTTGGT
AAGACCTCCCGCATCCCGGAGAAAGCCTTTCCCTCGTGTGCGACCCTTCCTACCCATTTT
CTTGGAGGAAGATCCCACGCCCTTTCCCTGAACCCCCCCGCCTGGATGTGTGTTGGATGC
GGTGGAGGGAACTGGGCCTCTGAAGCCCTGGCTACTATGGGCATTTGCTTTTGAAGGGCA
GCATGGCCTTTCCACGTAGGTTGTAGGAACTTGGAAGTCCCTTTTCGTGGGTGGGGCAGA
GGCGAATTAGAAAGGGTTAAGCCTTGGCGGTGGGTGAGGACTGGGACCAGGGCTTCTTAA
TCTTTTCAGCTTTCAATCATCCTTTGCTAGGTTAGAATTTCTTCGTGGTTCTCCACTTTT
CTCCTTCTCTATGCTGCGCAGAGATTCTTGACTCTCCTTTACCTTTTAGGTTTTAGTGTC
TTTGTTTTTGTCCATCCCTCTTCCCCCATTTCTTTGCATTGTCAACCCAGGTGATTTTTT
TATCCCTGTTTGTCCCAGTGGCCATGAGACCTGGCACTCACTGTCAAGCATTTCTGCAGT
TAATGTGGAAGCTGAAACCGGTTCACAGGAATGCCCAAATGTCCCACCGCATTCTTAAAC
CCTCTTGGTAGCCTTGCTCTAAGCTTCCAAGATATGAGTGAATGCCACAGAAAATTGCAG
ATGAATCCAAAATGCTAGGTATTTTCCTCTGACTTGGCATTATTTCAGATCTGTGACAAC
TTTTAGAGAAGATGCTATTTTGGGAACCGGATTTATTAAATATGGGGGGGGGTTCTGCCT
TTCCAACAGTAGAAGACCTAGTTTGTTTGCAAGTTACATATTTAAAAAATTTGGCTTTTT
CATTTTAAAACTGCCTCAGGCATTTAAGTGTATTCTTTTCCTAGGACTATTAGTCATTGA
ATCATGGGATTGGCAGAGAATTTTGGAAGGTCATAATTTGACTGCAACTTCTAAGGAAGC
ATTGAGTTACCTTTGGAAGGTAGCATATTCAATTGTCCTGACCAAAATTCAACAACCACC
CATCATATCATGTATGTGGTTGGTGTTTCCAAAGGTTTCTAAAGTTTCTAAAACTTCCTA
GTTCATAATAAACTTTGCATAATTCTGGACAATTCTGTGATTTCAATGCTTTTAATTTTC
CATACTATAAATAGCTTTTCAGTACTTTAGAACTTTTGAATTATTAATTGGAAGAATCTT
CCACAACCATCTCTTTTTCATTTGCCAAGTTACTGGAGTTGATAAGTCAGGCAAGTTGTC
CATGGTCACCTATTTGAGGCACGATTTGAAGTCCTTCACCTGATTTTATGTTCAATAGTC
TGTCCCCCTGTGACCTACCTTTATTTAAAAAGACAAAGGGAGAAAGAAGCAGTTCTGCAA
AATCAACCAAGTCATATAGAATATAATAGTAGTTAACATATATAGTGCTTTCTATGTGCC
AGGCACTGTGATCTCTTTAACTTTTTCTTTTTGCACCCCTTCTTCTGGACCAAGTGAAAA
TTACAGGCATGTAAATGGTGGAGGAAAGGTGAATTTGAATTATGTAAATTTAGGGTAACA
AGGAGCCTAAAGAGATCTAATGTCCTCATTATGGAGCTGGGAAACTTGAGGCCATGAAAA
GTTAAGTGATATGTCCAAAGTCTACAGTTAGGATTAGAACCCATGTCTCCTGTGTCCAGT
ATCCATAGCTGTCTCGTCTACCCTTATCATTCTCTTATTACTTTGACAAATACCAATGAC
CTGATTAACAAATCCAGTGCCCTTTTTTTCCTAGTCTTAACTTTTCTGGTTTTTGACATC
AAGTATGCCACTCAATTATCTGATTATCTTCTGTTTTCTTTAATTGCTTTACTGGCTGTG
TTCATTCTTTTTTTTCTATCCCCTTAATGTGCTTAGAATTCCAGAGGTCTCTTATTAGTT
TTCTTCTCTAGCTGTATTCTATACTTTCCTGAAATCTGAAAGCCACAATCCTGAAAGTCC
TGTGGCTTCTGCTGTTCCCTCAAAAATAACTAGAACCTAGAACCTTCCATAACTCCAGAC
CCACCTCTCCAAACTGCCTATAGTATATCTCCATTTGAATATCTTCCTGGTGCTTGAACT
TAATTAGCTACCTCATCTCTCAGGTTCATTTAGCCAAAAAAATCCAGTGGATCTTGAATG
GTACCCTTTTCTATGTTTCCATTGCTACCACTCTAGAACACTATCACCTGCCTATTGGCA
TTTTATAGATTTTTCTCCTGGTACTTTCCTTGTATTTTCTTGCCTTCATTCTATTCATAA
CCTAGGTACAGATTAAATTCAAAGTAAGTTGAGGAAAGGTTGGATATCAGTAGAATGTTT
TCCCATCCATCTTGAAGAGATGAGGGAGGGAGGATTTTTTAGGCAAATGGGGAGACTGAA
CAAAGACCAGAGTAGAGGGGAAGGGGAACAGAAGGGAATGAGCATGTACCCATCTCATCA
TACTATGTTCCAAATACTGTGCTAAGCATTTTATCAATATTCTTATTTGATCCTGACAAG
TGCTGCTAAATCTCCTTTTTTGCATTTGAGGAAACCAAAGTAAAATTTTAAAGGGCAGAA
TTGAGTGTAAACTTTGGAAAGAGAAAAGCCTTCTCCAAGTTTGGAAATTTGTAGTCATGC
TTCATTTTTGGCCAAGATATTTCATGAGAGAACTTTGCCATCTACTGGCCATTTTAAATT
GAGACAAAGCCATTTTAAACATCCATTATTATTGCATGATAAAACTTAGGAGTGGTAACA
ATTATATCGGTTTCATTGATATTTATGTTACTTCATTTGGCAGAACTAGTGTTTTGGAAA
GATCTCTGGTTATTGTAGTCAAAAGGTCTAGGATCATTAAATTTTTTGTTCTGCTTACCT
TGTGATCTAGTAGTATTCTTATTTAGCCTCATTAACATGAGAACATTTGTTTTGACTTTG
GGTGTTCAAATTCATTCTATTAATAAATTTGTCTTCATGGTAATCATTATTTTGATGGAG
ATATTTTAAATTATGGCCTATGAGCACACCAATTGGGAGTTGTCTACTTTACTTAGTACA
TTGAGGATTTCCAAATTGTGTATGTTGAGCCATATAGAGCTAATTAGATTTCTGGACCTG
GAATCAGGAAGATTTGGGTCCTAATTTTTGCCTCAAACTTTCAAGTTCTGCATCCTATCT
CACAACATTGTTGTGATGATCATGAGATCATGTGTAAAGCTTTGCAACCCTAGAGCAATA
TGTTTGCTATTGCTTTATTGAGACTGTCTAGTCAACTCTTCTAGCATCCCAGGTGTATTT
TCATCTTGAAAGTATTATTGATATATTGATATTGTAACCTAAGTACTCAAATACCAGACA
CTTGGTCATGTTACTTATTGATCATTGTATTTCCAAATCTTCAGTCCAAAGGTCAGAAAA
ATTTCCGGACTGAGCATTAGCTGCCACCTCATTGTTAGACCACATTGATTAACCTCCTCT
ATAATTACATGATTGTCAATTGATCCAATGTTAAATCCTATGTCATGCCACATGTTCATT
AGCTACCTCCCACTATTCTCCAATAAAAGTTTGGGGACACATGCAGATCCCTCTCAATAC
CATCAGAGGAGCATGCACAATGGAGCCTATGTTTTTCAACTCCTTGTGTCTTGAGTCTTT
ATTCCTTTGTCTCCCCTTTACCCATTTTCCCTCAGTTTCAAATCTCCTTCTTAGGTCTCC
ACCCACCAAAATGTTAATTTGTAACCTCAGGTGGTCACAACTCTCATTTTATAGATGAGG
ATACTGAGTGAGGCCCAGGAAGTTCAGACAGAGGCAGGCTCCTTTGACTTTTGAAAACCT
CTGCTCTTTGTCCTCTGCAATCCTGCATCTGAGTTTTAATCCTGATTTCAATGACTAAGC
ATGTAACTTGGGTGTTCTCTTTCTAGTTTCTTTCTAGTGCCTGTCTATACCAACAGGTAG
ATTCTGACAGGATATTTGAAAATAATGCAAAATTTCTAGTTATCAGATTTTAGGTTTTCT
GTATATCTGCTACTGTATATAATTGCTTATCAATTTACTACTCTTTCAAGTTAATTATGG
GGGGTCAGTCATCACTAACAAACCTTTACATACTCTATAATTAGATTACTTAGGTTAATA
TTGCTTCATGCATTACCAAATGATACTTAAATCTATTGGAGTCTATGTCAGTGTTGCTAA
ATATGGTGTGTATATATAGCTCACTATAGGTACTATGGTTACATCTTGAATTTATGGCTG
GAATAGGTCAAAGAAAGAAGGGGAATTCTATAGAATTGTTATAATTAAATTAAACTGGTT
TTTAAACTAGCCATGTAATTTCTCTCCACATGGCTCCCTCACCACAGTCACCTTCCTATA
GAGCATTCCCTGAGAGAATAGAGAGAACTCACTTCCTGGAATTCCCTCTTTTATTCCTTC
TCTCTTACCTGGATCAATAACTTCATCCTTTCAAAAGGTCAAGTGCCTAGGTCACTATCC
CATGATCCAAGTCCACTGTCTTAACTCTAACACTCTAGCTCTAGCAGTGCTGGGACACAG
TAGGGGCCCCAGAGGTGATCCTGGGAGAGTCCTTCACACAGAATCTTTTCATTCACAGAC
ATCCATCTGTCTCAGCTCAAGTGCATGATCATTTGTAGAACAGTTAAATTATTTCAAAAC
AATTTTATATACGTTGTCTTTTTTGATCTTAACTCTGAGGTAGGCTTTTGCAGATCATTT
CCAATTCTAAGTTAGAGTATGCCTTTAAGTTATTCAACCATTACTATTTAATCACTATTT
TCATTGTCAAATGAATGTGTATTAAATCTGTTACAGGAAGAAAGAAACAGAAGCTTGCTA
AAGAGAGAGCTGGGCTTTCCAAGGTAATCCTAATTAAGAACCTGTACTTATACAGACTAT
TATGTAAAAATGTATTAATAGATTTTAAATCCATTTAAATGTATATATATTTTTATGAAT
GTAGAAATTTCAAAGTATTGCATTTAGAATTTTCAGTTATAGTTTATTCTTTAGGTATAG
TTATTTCAATCATTTAAAGACTGAACTGGAACTGCAAGTTTTTAATATGATATAATTGTG
CTGCCTTTTTTTAAGTGTGAGACTTAATACTTGGATATCTTACTGTATCATTGATGCTGC
TCATAGCTTTTCAAAGGCTGTACCAGAAGTATGAAATGACCTCTTGACAGGTTCTATGAA
GTTATAAAGACTTCACATGACTTGATATGAACTGCCTGGATCCTTGGAAGTATTTCAATA
AGCAGGTTTTTAGATTTATCTTGATATTTTCAGAGGCCTTGTCCAGTTATAAATGCTAAT
TCTGTCATCTCTCAGTTTTGATTTCAATTAACCTCCCATCTGTGCTTTTCTGGTTATCAG
TAAAAATTATTGATGAGGACAGGGCCATTAAAGACACTAGCTGACATTGATTCATTAGTC
ATTGTTTTGGGGAAGCAATCATTGGAGTTGTATGTATGATGGACTCCTTCAAATTCCATA
TCTGCTACTACCTGTGTAGCTTTGAGCACACCAACTTTCTGGGTCCTCAGTTTGCAAAAT
GAAAATGTTTTGACTAGTAAAATTTTGTTTCAATCTGTAAAATTTATTTGATTTCTTAAG
ATCACCTAGTGCCTCATTTCATATTATAAAAATTAAAGGTAATCATCAATAATTAAAATA
TTATATCTGATCATTAGAAATAAAGGAATAAAAGGGGGATACAAAAGGAAAACCGTATTA
CCATGGCTAATCAGCCTGTTCAAAACCCCCAGGCTTACTACCACCATGCTCATCCACAGG
AAGGAAAGAGACCAGAGTAGGAACGCCCACTGAATTTATCCCCTCTACCAGAAGTACATA
ACATGATTTACATGACAGGAAGTCAGTGGGCTCCTGCAAAAATGTAGTTTTTAGGGTAAC
ATTTTTAATTGCACAATAGATAGATGAAAAAGCTTAGGTCCAGAAGAGACTAATTGAGGC
CTTATTGAAGGCCTATAAAATGGCTTGGTTATAGAAGTCTAGAACTTAGATCTTGATTCT
TAAGCTTTTTATATTTCCACTTTATATTGTCTTATTGATGATAGCCTGCCATGTGGGGGT
TTTTTCCCTTTTTAGTACCATCTTTTCTAGAAGTTGAGTATGGAAAAGAAAAGGAAATTT
AATCCAACTCATTAAATTTTTTTTGGCAAGTTTAAGGGCATGCATTCTGCATAGAAGCAA
TTTTTATCTTAGTTGATAGAATGTGTTTGAGAATTATACTTACATAACAATTACAATGAG
TCTTTTGCTTCCCAAACTTCCTATGGGCAGATGGCAATAACGGTAATAACATTCTTGAAG
TAGTTTGATGTTTCCAGAGGCATCATGGTAGAGTGGATAAAATGCTGAGTCAAGAACACT
TAGACATTGGCACTCACTTATATAAAATACAGAATCTGAGTTGAAATGGACCATATCAAA
CATTTAGTCCAATTTATACCCGAACAAAGATAAATCTCAGGTGCGAAGCCCTTGTAGCCA
GCTGGCAAAACTTCCTGTTGGGTTTACAGATTAAAATGTAATTGAATATTAAAAAAATAA
TACAATAAAATTTTTTAAATTTGAGGTTTTCTAAGTCAGGATGCCATGGGCAAGCTTCAT
TTCTATTTGAATTAGGCTCCTGCTCTCCGACATGCCCAGGAAGGGATCATCCAGCCTTTT
TTAAGTTACCAATATCTTTCATATAGGAATACAAATCATTTGAACTTATTGGGTCCCTTA
AATTTTTATTCCCCTTTATTACTTTTTGGTGATTCTCTTGTTCTGTATTTGGGCATGAAA
TTTTCTGTTTAAATCTGGCCTTTTCTTCAGGAATGCTTGGAAATCCATTTTATTAAATGA
GCATACTTTCCCCTGGAAGAATGTGGTCAATTTTGCTGGGTAGTTGATTCTTGATTGTAG
ACCCCATTCCTTTGGTTGCTTTCCAGGATATCCCATGCCTTCTGGGCCTTCACTGTTGGT
GCAACCAGGTCTTGTGTAATCCTGATTCCATCCAGTCTTTTTTGAAGACCTCATACTTTT
TTGGATGACTCTTATTATGACTTATTTTTTAATGACTCTTAATTGTTAGCAAGTTTTCCT
TTATATCAAATCTAATTCTGCTTTTCTGTAACTTCCCTGTTTTTCTCCCACTAGAGAGTG
GGAGAACAAATAGTTTAGTGAAGAGTGTTGGAATTATAGGGCCCCGAGGTCCAAATCTGC
CATTTACCCCTGGGGTGATTAGGCAGGTCCTGTAACCATTCTGGAACTTATTTTCTTCGT
CTATAAAATGAATGGGGGCCATTCTTTTAGGACCCTTAATTCTCTACATCTATGATCCTA
TAAATTGAATGTTTTATGACTTTGAGTACTTGGTTTCTCCAGTTACCAGTGATCTCTTTA
ATTTACATATCTGACTGAGTACTCCTTAGTCTCCTTTGCTAGACTTGTACCAGAACTGGA
GTCAGAGGTCCTGGCTTCAAATCCTGATTTTTGTCACCTATTCCCTATTGGTGCTTAGGT
GAATTTAACCCCTCAAGATCTTAATTTCCTCAGCTTTAAAATGAGGAATTTGGTCTAGAT
GACATAGTTGGCTTCTAGCTCTTATATCAGTGATCCTGGAATCTTTATAGTAATTGTTTT
TCTTTGCGTTTTAAGAATTTTATTCTTGGGAGCTTTCCTTCTTACTTGGTTGGCTTTTTC
TTTAGAATTTTAGGCACCAAGGTCCTATCTACTCTTGGTATTCCTTGAAATTTAATATTC
CCAGATCTAGGATGTATATTAGACTATACTATACTTCTCCTTTATCACAAATTCTAAGGT
GGACTAGTTGCTTTACAGCTGAGGAGAATTTTCACTGTTGAACTGCAGCACTATCATGTA
TTTTATCAAACATAAGGACCCCTGGGCCTTCCCATTTGCCACAATATAGGACCCTTAGGT
ATTCTGGACCTGTATACTTTTTTTTGTTTTGTTTTTTCATTAAGAATTTCTCCAATTCAA
AAGGGGGGAAAAACCCTTATTGTAATGGATATTGTTGTTTTTCAACATTGTTTTTCAATC
TTGTTCGAATCTATTGTTCCCATTAAGGGTTTACTTGGGAAAGATGAGTAGTTTGCCATT
TCCTTCTCCAACTCATTTTATAGATGAAGAAAATTAAACATGGTTAAGTGACTTTCCCAG
GTTCACAGGGCTTAAGTGTCTGAGGCCAGATTGGAACTTTGGAAGATGAATTTTCTTGAC
TCTTAACTCCCATGCTTTATTGTGCCACTTAAGCTGAGCTAATGAATGATGCATGGTCAA
TCAAAACAATTTCCCAATTTCCCAAATTGGCTATGTCCAAAAATGAACCTCTCATTCAAC
AGCTTGAATCTTTAACTTGTCAGAAGATACATAACAGATTGTGGGTCATTTGGAATCATG
AATGGTTGTCTCATTTTTTAATTCATTTTTTTTTATTTCATTAGTTCAGAATATTTTTCC
TTGGTTACAAGAGTCCTCTTTCCCTTCCCTCTCCTCACCCCCTCCCATAGCCAATGTGCA
ATTCCACTGGGTTTTAAGTGTGTCTTTGATCAAAACCTATTTCCATATTTTTGATGTGTG
CACTAGGGTGATCATTTAGAATCTCCATCCCCAATCATATCCCCATCAACCCATGTGATC
AAGCAGTTGTTTTTCTATGTTTCTTCTCCACAGTTCTTCCTCTGAATGTGGATAGCATTC
TTTCTCATAAGTCTCTGAATTGTTCTGGATCACTGCATTGCCACTAAAGAAGTCCATGAC
ATTTCGATTGTACAATGTTCTCCTGGGTCTGCTCCTTGCACTGCATCAATTCCTGGAGTT
TGTCCAGTCCACATGGAATTCCTCCAGTTCACATGGAAGTTCATTATTCCATCACCAACA
GAGATACCACAATTTGTTTAGCCATTCCCCAATTGAAGGGCATCCCCTCATTTTCCAGTT
CTTTGCCACCACAAAGAGCACAGCTATGAATTATTCTTCTACAAGTCTTTTTCTTTATTA
TCTCTTTGGGGTACAAACCCAGCAGTGCTATGGCTGGATCCAAGGTGCAGGCAGTCTTTT
AGCACACTTTGCAAACATAGTTCCAAATTGCCTTCCACAATAGTTGGATCAATTCACAAC
TCCACCAGCAGAGCATTGATGTCCCAATTTTGCCACATCCCCTCCAACATTTATTGCTTT
CCTTTGCTGTTATATGAGCCAGTCTGTTAGGTGAGAGGTGGTTTTGATTTGCATTTCTCT
GATTAGGGGATTTAGAACACTTTCATGTGCTTATTAATAGTTTTGGTTTCTTTATCTGAA
AATTGTGTCCCTTGCCCATTTATCAATTGAGGAATGGCTTGATTTTTTTTTGCAATTGAT
TTAGCTTAGCTCCTTATAAATTTGAGTAATTAGACCTTTGTTAGAGGTTTTTATTATAGA
TTGTTTCCCAATTTGTTGCTTCCCTTCTAATTTTGGTTGCATTTTTTTTTTGTACAAAAA
TTTTAATTTGTAATTATTTTACATTTTGTAATTTTTTCTTGCTTGATCATAGATTGCTGA
GGTCACTTATTCCAAGTCTATTCCACTGATTCTCTTTTCTGTATCTTAACCAATACCATA
CCGTTTTGATGACCACTACTTTATAGTATAGTTTGTGATCTGATACTGCTAGGCCACTTT
CCTTCACGTTTTTTCATTATTTCCCTGGATATCCTTGTTATGGTTTTTCTAATTCAGTAA
AAAAAAAGTTTCTTGGTAGTTTGATGGGTATTACACCAAATAAATTTGTTTGGGTAGGAC
TGTCATTTTTATGTTAGCTCCTCCTACCCAGGAGCAATTAATATTTTTCCAATTATTTAG
ATCTAGTTTTAATTGTGTGGGAAGTGTTTTGTAGTTGTGTTCATATAGTTACTGTGTTTG
TCTTGGCAGATAGATTCCTAAGTGTTATATTGTCTAGGATGATTTTAAATGGAATTTCTA
TTTCTAATTCTTGCTGCTGAGATGTGTTGGAGATATATAGAAATGCTGATGACTTATGGG
TTTATTTTGTTAGTTGTTTCTACTAGCTTTTTAGTGGATTCTCTAGGATTCTTTAAGTAG
ACCATATCATCTGCAAAGATGATAGCTTGGTCTCCTCATTGCCAATTTTAATACCTTCAG
TTTCTTTTTCTTTAATTGCTACTGCTAGTGTTTCTAGTACAATGTTAAATAATAGAGGTG
ATAATGGGCATCCTTGTTTCACTCCTGATCTTATTGGGAAAGCTTCTAATTTATCTCCAT
TGCAGATGCTTACTGATGGTTTTAGATATATACTGTTTATTATTTTTTGGAAATGCCTTT
CTATTCCTTTCTAGTTCAATACCATCTTCTTAACCATCTGTTTACTTCCCTAATCTTCCT
TTCTCTTCTGAGCCTTTGCCTTTGATCAGCAGCAGTTTTGAAAACTTTATCCACTATCAT
TCTTTGGTTTCTTGCCTAAGACTTCATAAAACTATAGATTTCTTGTAATAGTATCACTTG
TACTGTACCCACTTGAATAAACAAGAATTGGGGAGTAAGTAGTCTTCAAGTTTGACAATC
TTAGAACTTTTCTGTCACAACCTGAACTACTCATGCTCTAGGGAATGGCAGAATTCTTAT
TATCAGGTCAACAAATAGCTGCCATAGACTCCCCATAGGATGGCAATCGCCAAACATTAC
TTTTCATCTTTTCTTTAACTCTTATTGAATGATCACTAACTTGACAACATACGTGTATTC
TCACTAGAGTATAGTAGACAAGTAGTCATATAGCTTCTCCAAGTTTAAAAGGTGTTTGTA
CCCCTCCCTTCCCCCCTTCATATGAAGTCTAAAATTGCCTTTTCCTAACTTAACCTATTA
TTGCTTTTGGACTCGGACAATGGAAGTATAATTCCTCCCAATGGCAGTTCTTCAAATATT
TGAAAACTATCAGTCATACCCTAATTTTTTTGTCATTCCTACTTCACTTTCATATATTCA
TTTAACTCAACTTTGTTACTTTAACCTTAGGTCTGTTAGCTTGAATCCTTCAATTAAGTC
CTTCCAGATTTATTTCCCTCTTGCTCTCCATTCATTTTCTTTCCTTGTTCACAATTCCTA
TTACTTGAGCTGAAGGACAAGAAGAATCATCTTTTTTGAGCTAGAAGGAATCCTGAACAT
TATCTAGTCCAAACCTTTCATTGTACAAGTGAGGAAACTGGCCTAGGTTAAGTAACTTAA
CCAAGGCTACTAAATGTAATCCTGAGATTTAAGCCTGTTAGATTCTAAATCTAAGCACTC
ATTCAACAGTACTATTTTGGTTTTTTTCTCCTGTTCCTTTCCTCCAACAAATCAAGACCT
TCTGTGGAAGGTCTTGACTTATTATTACCATTTTTGTTCCACAGTTTGTTAATTAGCAAC
AAAAGGGTAAATTTACAAAAATACCCCATAGCATCTAGGAAGGGATTACTAGCAGTAATC
CATTTCCTACTGAAGTTCTATATTACTCTGGACAACAGAGATGCAAAAGTTAAATGACTG
GCATCATATTGTCTGGCAAATCAATTTTAGAAGATAGTGACTTGTCATCTTTAGGATTAA
GTAAAATGTATGTAAATTGTAGTATGAAAAAAATTAGCATAATCAAATTTTCTAAACCAT
ACTTGGTTTTGCCTATTGACAAGATTAGAGGCTTGAGTATGATTTTGAGATACTAAAAAT
GCATTTATGTTATTGGGAATGACATCTAGTTCTACTTGATTTTGGGATAAATTACTTACC
TAGCCCCTTCTAATGTTTTTCATTTCTGCTGTTCTTTGAAAAACTACACTACACTAATGA
AACTTTCAGGTTCTCCCCAGCCTTTTCTATACTTAAAAATATAACTGCAGATGGCAAAAC
GTGGTACTGTTCAGTATCAGTATGATATAGTAGAATCTACTGTCAAGCCACTGAATGTTG
CTGGAGCTAGTTAAGAAATCATAAATACTGGCTTCAATTAGAGTTAATGTTGTACAATTT
TGCCTAGGCCTCTACCGCTACCTGGCAAACATTTTTCTGACTTAACATAATCCCTATAGC
AATTTCTCCTCAAGCTTTCCACTCCTCCCACCCTCTTTCTCTTAGTAGATTATTTCACTT
TTATATCTTAGCAATCCAAAGAATGCTTGGTGGCTACCAGTTCTCTTAATGATAAATTTC
TGTTTTTGTTCATTCTACTTCCCATACTCGCATACATTCCTGCTTCCTTACAGGATCCTT
TGGCTTAGCTTATCTCATATTTATCTCCTGGTTACCTTCTTTGTCTTTTTCTCTTTTGCC
GTTGTAAATTGGCACTTCTTTTGTCTTTGTATTATCACCAGTGCTGTTCTTTGCAATAGG
TACTTTTACTATTAGTCTATACTCACTTAAGCTCTTTAAGATGTTTGGAAACTTTAACAT
CCCAGCGAATTTGTTTTCTTACAGATAACTGCTATCGGTTAACAAGCATTTATTGAGTAT
TTAATATGTGCTAAGCCCTGGGGCTGCAAGGTGACTCAGTGGATAGAGAGCCAGGCCTGG
AGACAGGAGGTCCTAGGTTCAAATATAATTTCAGACATTTCCTAGCAGTGTGACCCTGGG
CCAAGTCACTTATTACCCCAGTTACCTATCCCTTAAACCTGTTCTGCCTTGAAACTGATA
CTTAGTGTTGATTGCAAGACACAAGGTAAAGGTATATATCCATGCGTGCATGGTAGGCCC
TGTGTGAAACACTGGCATTAAAAGGAAAGTCAAAACAGTTTTTGGATTCATATTCCAGTG
AGGACATCATACAGACAACTATGTACATAAAATTTCTCCAGAACTCTTTGGATCTTTTAC
CTCCATTATGCCCTATTACCTTATCAATTTTTCCCTACTTTGCACCCTAGATTATTATCA
ATCAAACATTTATTGCTTTCTGTGAACTATGCACTGTGCTAGGGGAAATAAAAGTAGCAA
ACAGAAGCATGGTTATATTCTATTGGAAGATGCAACTTGTTCGCGAACAAGTAAATAAAA
GACATTAAAAATATATATATATATTATAATATGCAGGAGGTGGGGAGGCACTAATTGATA
ATATTGGAAGTAGGGAAAGACTTCCTAGAAAGATGTGAGATTTGAGCTTTAAGTTCCTTT
GAGCAGGCACTGTGTCATTTATCTTTGTATTTCCAACACTTAGCACTATTTGTACATAGT
CTAGATACTTAGTTTTATTTTTTTAAGTACTTCAATCAGGTTAAAGTCATTACATGTTTT
GCCTATAATCAACAGATCTGTGCTGATTTGCTGGATTGGTGTGACCAGTGAAAAATACAT
TCAGTATCAGAAATGCCTTGTTTTCAGCTGACTATATTGAAGTTATAATATTTTAGAGGT
ACAACCAACCTTTTGTGATTTAGTCCAACCACCTTGTTTCTACTGATAAGGAAATTTCAA
ATTCAGACTTCCTAAGTGATTTGTTCCTGGTCACATGTGTGTAGAAGTTGTTTCATAACT
CTCCATCAGTGTTTTACTGGATTATGCTGAGATTGTCATTTTTATTAGCCTTTAATATAC
CTTTTATACATTTCTAATGTTACTGAACTTTTAGAATTTAAAAAAGCCTCAATTAATTTT
CTAGTTTCAGATGGCCTATTTATCATTAAATATAAATATTAAATATTTGAAAGTAATAAT
AAAGATTAGTTTTAATTTTGCAAAAATGAATGCTCATTAATAGTAGTCCAAGTTAGAAAT
TTTGATAGTTTCCTAAATTAAGATCTGTTTTCATTATAGTTACCTGACCTTAAAGACGCA
GAAGCTGTTCAGAAGTTCTTCCTTGAAGAAATACAGCTTGGTGAGGAATTACTAGCCCAA
GGTAATTATCATGAAAAATACAAAATTTTTTCTTTTGATTATGTCCTATTCTAAAGAAGA
ATCAAAGACTGAGACTCCACAGTATTTTAGCAAGTTAGCTTGAAAGGCCATCTGTGAATA
GGGTTGACCTGATTTTCAAAATAATATCTTAAACTATGGCTGAGTCTTAAAAGAAAATTC
AAATCTGTTATAATAAGATCAAATAAGCTAGAGTACATATAAAAATGGCCAATACAAGTA
GGTTACTACAATATTTATATGATTTTCCATAATATAGAAAGAATTTTGTAGAACATGTTT
TGAAATTCTGATTTTTAAAATTCAAGTATTATGATACATTAATATAAAATAAGTAGGTTC
GTGTAAATGGAATTTTTTTCTATAATTTTTAATTTAATAGATTATAGCAAAAAGTGCTCT
TTAAGGGGAAAGACTGCAGGTTCCATAAAAAACATTGACATACATGTAATTCTTTTCTAG
GTGAATATGAAAAAGGTGTTGACCACTTGACAAATGCCATTGCTGTCTGTGGGCAGCCAC
AGCAATTGTTGCAAGTTTTACAGCAAACTCTTCCACCACCAGTGTTCCAGATGCTTCTGA
CTAAGCTGCCTACAATTAGCCAGGTAAGAAAGTGGAGTTTTCTGCCGCAATCAGAAAGTG
ACCTGTAGCATCTGAAAATTAAATTTCCTTGTTTTGAAAATGGAATTTAAATGCCTTCCT
AGTAAACTTGTTAAATAATAAAATTCAGTCATAAAGTTTTAGAATAGCACTCTAGGCATG
TATATAGGCATATATATCCTGGCAAGCAGGATAATCATAAATATGAAATATGTAGTAGTG
GTAGTCTCTCGGTGACCAAGACTATTGTCTTTGTGCATTATCATCTATTGATGTACCCTC
ATGTGGCTTTGAAGTCCAAAGACTGAAATATGTAAGAGGTGGGAATGGTTGTGGGAGGAG
AGCATCATCAAAGTGTAATGGCTAAGTACCCTATTAATTATTAATTAATAATGACCCTTC
AGGATGATCTCTCCTAGCTGGGTTGTGATATTTAGTTGGAATAGGACTGAGTGGACAAAA
AATTCCATGGACTTGGGAAACCCAAAACCAGGGGTTAAGTTCTGTTTAGACCTTGTCCAT
AAAAGAATATGGTGTCAGAAGTTAAGGGTACACAGTGTTGATTTTTATAGTACAACACTG
TACCTGAGCTCTTGAACCAGTGATTCAGAGACAGGCCACACTGCAGTTTCTAAATACTTA
TCTATAAGAATTTAAAATTTTCTTAAACTAAGATTTTAGCCTCTGTTATTGACAACAGTG
ATTTCATTTGTCTTTTTTTTGCATTACTTATACCTTTTGAATTAGTTATCTTTTTATTTT
TAACTATGAAAAACTACATCCTATTTTAAAAATCATAAAGTGGATTGGCTAGTAACATAT
AATTTCAAAAGTTTTTTTGTATGAAACTTATATACATTTCCTTTTTTTTCCTCCATAGAG
AATTGTGAGTGTACAGAGCTTGGCCGAAGATGATGTGGAATGAGAAACATGTCAACATAA
TAAAATCTTAATAAAAAAATTTAAATAATTCTTAGCCCAGAAGATGAGCAGCAATGGGGA
AAAAAGGGCAAACACACTAGTTATGGACTATGTATTACACTGAAATCTACCAAAGTTAAT
TCTAACTTTGTGTAGGTAGGTTTGCTTGGATTTTATTTATTTATCTTAGTAAGAAGTGTA
TTTTGGTAAAAACAAAAAGAACAAATTTCATTTTATAAATACACTATGAATTATCTAAAT
ATCACTAATTTCATTAATTACTAAAATACGCATATATGTTGTAATATACATATGACATGA
CACTCCTACATGTTAAAATGCCCAGTGCTCATTTTTTGACAAAGTTAAGGCAATAAAAAG
TATTCTGCACTCTGTTACAGAGGTTAAGGGTGGATTTGATTTATCCTAGTAAATTTTGAA
GCATATTAGACAATTTTTTTTAATTCACCAAAGCTAACAGGCTGTGAAGTCATTGGATAT
AAAGTATTTCCCATTCATAAAGATAATAATGGATACATTTTGGAGATAGTTTATTTTTTG
TGTATAGGGCAATAGCTGTTAATCACTTCAAAAAATCCTTTAGAAGTTTAATTAAAGCCA
AGGTTATGAGTCCTGGATATTTATTTTGCAATTCAGTTGGTGGAAAGAGCACTGAACTAG
TAACAATCAGGAAATTAATGTTCTAGTTCTGTTCTCCCATTAACTTATACGGTGATTGAC
ATAGGACAAATTACAGACTATCACAAGAACCCCTGTAAAATGAGAGGTTTGTATTAAATG
AGTTCCTTTCAGTTCTATGATTATTTTCCTCATCGTCAAAGCCACTTAGTTATATCTTTT
CCATACATATTTGTCTTTACAGTCACACATTATTGCATATTCCAAAATGGTTTCCCTCTG
CCTCTTACTCTGTTTAGCTTTTTTTGTTTAAAAATCAGTTGTGAAGAAAAAAATTTCTGA
TAATTGACTATCCAAAAGTAAAGTAGGTTATCTCAGGATATTGTGAATTCCCTAGTCTTT
AGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 6156..6202, 15159..15240, 15720..15862, 16738..16823
1001..1121, 6156..6202, 15159..15240, 15720..15862, 16738..16779
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved