Monodelphis_domestica Locus ENSMODG00000002583
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000002583
Monodelphis_domestica
ENSMODG00000002583
2
SNORD55, SNORD38, SNORD38
1550..1631, 1971..2043, 2503..2574
3760
AGACATGACGGACAAGGACTAAACCAGGTCCTTTTCCCTCCAATGGAGGCCATCCCAAC
TAGAACTCACCTTTTCCGGTAACCCTGACCATTCCCAATTCTCGAGCTCAGCCTTTCTCA
GTCCTGCCCCTCCCCCCAAGGCCGCTCTGCACGGAAAGTGGGGAGTCCCTGGTCAGTAAG
CCTTTATTCCATGTGTATGTGTGGGTACATGGAGACACGTAATGGCAGACACAAAATTCG
TGGTGCTTAAATTGGCAAGGTTTTATTCTTGATCTACACAGAGAGTCGGGAAGCTCTTAT
CAAGCTCCTATGTGCCAAGCACTCTGCCTGGGATTACAATCTTGTCTTGACACTTGGCAG
CTGAGTGACCCTGAGCAAGTCACTTTACCTACGGCTGCCCCAGTTTCCTCAGCACTAAAA
TGAGGATAATAATGGCGCCTAGCTCCCAGGGTTGGAAGGGCCATACGATACGATGGTGGT
AAAGCACTCAGCTCAGCGCCTGGCAGGGAGCAGACGCTAAGTAAATGGTGGCTGTTATTG
TTATCACCAGACGAAAAGCACAGGAATGGGGGGGGGGGGAGAGGGAGAGGATCGAAAGTC
CTACTCCACAAAGACCAGGAAGTTCTTACATGGCCCACGTGACCCCACCCCTGGCTCGGC
CCGGCGCGTTAGTGACGTCACCGCCAGGCGCCCGGAAGTGACGGCACGCCCACAACTCCC
CCCTTTACAAGCCGGCCCGTGAGCCTCTGCGCTCTCTCTTTGCTGCTCGCGCCGACCATG
GGTGAGGAGCTTGGGTTCGTCCGCCGCCATCCACAGCCATCCACCCCCATCCGCCCCCAT
CCGCCTCCATCCATGGGCCGGGGCGTGCTGGAACTGGACTGGGGGGCGCGGGGGAATGGG
ATAGGGCGGAGGAGAAGGAAGGAAGGGCCGGAGCGGGAGGTGAGGGTGCGGGGAGCCGGG
GCCGGGCCTGATTCTGAGCCTGACCGGAGCCGCCTCCACATCCGCCCGCAGGGATCTCCC
GGGACAACTGGCACAAGCGCCGCAAGACCGGGGGCAAGCGCAAGCCCTACCACAAGAAGC
GCAAGTATGAGCTGGGCCGGCCTCCCGCCAATACTAAGGTAAGAGCCCGCGCGGCCCGGG
AGCCCCGACCTCTCCTTAGTCCCAGCCCGGGCCCAGAGCTCCGGCCGCCCGCACGGGTTC
AGGAGCCGCCACTCTTCCTCCCCCTCCCCGCCGCCACGTGAGTGATGATCGCCGGAGCCT
TAGGGGTCCGAGCCGGGCCGTGCTGGTCCGAGGGCCGCCGATGCTGGGGCTACTCTGTCA
TAGTTACACTGACACGTGCCGGGGCGCCCCGAACCCGCGACCCTTCTCCCCCCACCCCTC
TGACCCCGTCTCCCCCCGTCCAGATTGGCCCCAGACGCATCCACACAGTGCGAGTCCGAG
GAGGCAACAAGAAGTACCGGGCGCTGAGGCTGGACGTGGGCAACTTCTCCTGGGGCTCCG
AGTGTGAGTGTGAGGGCCCGCGGGAGGGGGAGGGGGAGGGCGCCGGGCAGGGCGCGCTGA
TGACACCTTGGTTACTGCTGCAAACACCGAGATCCTGGTGGGGATGCAAACCTTGGAGAG
CTGAGCGCCGCCGTCCCGCCATGGCGGGGTCAGGGTGGGCCCAAAAGGGCCTTTTCCAAA
GCTCCAGAGACAAGGGGAGGGGAAGCCCTGGCCCCTCCTAGGCCTCATGGGTTGTGCTCC
TCGCTTAGGCTGTACTCGGAAAACCAGGATTATCGATGTGGTCTACAACGCGTCCAACAA
CGAGCTCGTCCGGACCAAGACGTTGGTGAAGAACTGCATCGTGCTCGTGGATAGCACGCC
ATACCGCCAGTGGTATGAGTCCCACTATGCCCTGCCCTTGGGCCGGAAGAAGGGAGCCAA
ACTGGTACGAGACCCGTGGGGGGAGGGGGAGGAGTGGGGGGGCGGCCTGGCCTTCTGATG
AGGAGAACCTTGTCCAGTTCTGCTACTGATGTATCAGAGATGACAGCTTTGTGTGCTGAA
GAAGGTCCTGCTGGCTGGTCGAGTTGGGGGGGCATGCAAGGCCCAGAGTGCTAGCTAGCA
GCCTTGGGCAGGCAACTGGACTCCTTAAACCAGAAAAGGACCAAGATAGCGGAGGCTCCA
TTCAGTCTACCTAAGCTATCCACAGCCTTGAGAGGGCATGCAGGGAAATGAAGCTGTTCT
TGGAAGGTCCTTCACAGCTTGGGCCGTCTCTGGTTTTAGGATCCCCAGCAGGGGGAGGGA
CAGCCTCCTGGCTAATCAGTCCATCTACTCCGTTTGCTCCAGACTCCTGAGGAGGAAGAA
ATTTTAAATAAAAAGCGGTCAAAGAAGATCCAGAAGAAATATGAGGAACGAAAGAAGAAT
GCCAAGATCAGCCCGCTTCTGGAAGAACAGTTCCAGCAGGGCAAGCTCCTGGGTGAGCAG
GGGGAGATCCCATGGGTGGGGTGGGGGGCAGCAAGGACCCGAGTCTCCTAGTGATGAGAA
CCCTGTCCAGTTCTGCTACTGAGGCTGAGTGACGACAGAGGTTTGTCTGAAGAGACTCCT
TGTGTGCCAGGGAGATCTGGGAAATGGGGGCTCCTGGCCTGCCCTGATAGCCTGACCTCT
TGTTTCTACAGCCTGCATCGCATCGAGGCCAGGCCAGTGTGGCAGGGCAGACGGCTATGT
GCTGGAAGGCAAAGAGCTCGAGTTCTATTTAAGAAAGATCAAGGCCCGGAAGGGCAAATA
AGCTCTAACGTGGACATTTGCTAATGGAATAAATCCCCAGATTGTTGGCCCTGTGTCCTG
TGCTCATTACTTGGGAGTAAGGCAAGTGGGGGGGGGGGCTTAGAGACAGCCTCTGTACTC
AGCATTGTTAAGTGACCCACTGGCCCTCCCTGTGGCCAACTGGGCCTCATCACAGTGCAA
GAGTAACTCCCCTCTTTACAGAAGGGCCAGGCCTGCTTTGTAGGCTGCCCCTTTTGGACT
GGGGGTACATCTGGCCAGCATGGGGCAGGCACCCCAAGAGAAAAGATGGCCCTTTGGATG
AGGAACCCCTACCCCAGCCCACAAGTGGCATGAGCAATACCCCTGTGTTCTAATGGGGGG
TGAAGGAAGATAAGACTCTAGGCATTTTGCTAACCATGTACTACCTCTGCTCCACTTCCT
CCACCTCCTGCCTTCCCAGCCTTTCAAGCCCAAGACATGTCTGCTCTTGAGACCACGGAC
TTTGTTGGCAAAAGCTTGTGTGACAAGGGCTGTGTGTATATAGTGGGATTTATTCCTGTA
TTGGTCTCCTTACCCATTTTTTGAACATCTGGTCCTTTCCTCTAGCCAAGGTGCTATAAA
TAGCAACCCCATTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 1403..1502, 1748..1923, 2322..2451, 2651..2760
1001..1117, 1403..1502, 1748..1923, 2322..2451, 2651..2757
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved