Monodelphis_domestica Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica RABGGTB
Monodelphis_domestica
RABGGTB
2
SNORD45, SNORD45
1585..1667, 2714..2796
6734
TGGGGAGGTGCCCCTGCAGGCTTGTGCAGCCAGGCTGCCCAGGGCTCCTCTTGGGTGGG
TGTGCTGGAGGTTCGCTGTGGCCCAGGAGTCTGCATTTCCAGTTTAAGGGGCAGGCCCGG
CTGGAAAGAACGATTTTTGCACAACTTGATGCCGGCAGGCCCTTCCCATCCCAGTTAGGT
TCTTCACATGCTAACTAGTAGGTCCACCGGAAAGCAGAGCCTCTGCCTCTGCCCCAGTTA
CACAGACTGCACAAATGTGACAGTCTAAAAAGAACAGGACCCGGCCCAGCCCCCACAGGT
CTGGCCCCTGGCAGGGCATGCTTTGTCCTTCTGGGGGGCCCACAAGGAGTGGGATGGACG
CCCCCTTGGGTGGGTTGCTCTGGTGTGGCATCTGCGGGCCTCCTAGGCTCCTCTTCTCAG
CCCAGGGCTCCCTGGCATCTGAGCAGAGGGGAGGCCCTAGGTGCCTGCTCTGCCCCGGGC
AGAGCCTGGGACTCTTCAGCCACTTCCATGCTTAGGGCACTCCGGGTGTCCTACAGGGGT
AGCCCAAGGGCTCAAGGTCGGGCCTTGGACACTAGCTGGACAGTCCCCAACCCCTGCCTG
CCCCTGTTTCTCCTTTGTAAAAGGAGATGCAGAAGGGCATGGCAACCCCTCTGGTCTAGC
TGCCAGGAAAGCCCCAGGCGGAGGGGCCCTTCCGCCCATTTTGCAGATGGCTAAGCCGAG
GCTCCTGGTGCACAGTGGGCACAAAATGTGCGTGGCCTGCCCTATGGATAGGTTCACTGA
AGCCTGGAGGAGCACAAGGACCGTGCTTCCGGCTTGGACAGGGTCGCCTGCTCTTGCCGC
TCCCTCCGTAGACTCAGGCGCCCTCTGGCGACCGTATCTGAACTCCATTTGAGGCCGCGC
AGACGTAGTTCGCGGGAGGAAGGCGGCCTGGACAGAGCGCATGCGTGGGCGACGGGCCTT
TTCTGAACCTGCACACGCGCCGAAGCCAGTCCCAGAGCAGGGGCGGGGCCCTTCGGGAAG
GACAGGGCGGGGCTGCCTACGTCGGCGGCGCGGCCGGGGCCTGCGTGCGCGCTGACGTAA
ACGCCGAGTGACTTGGGGCTCCGGCCACCGTCTTCGGTCTTTCCTTCCGGCCTCTGTCAT
GGTGAGTACTGTCTTGTGGCCGCTGCTGGCCGGAGCCGTCCCCCGCTTCCCCAGGGCCCC
TGGACCTGTTTCCCAGCCACCCCGTCGCTGGGGACGGGCCGTCGCGCGGGAGGTGGCGGG
GCCGGAGAGCGGGGTTCGCGTCGGTACGGTTGGGCCTCCCTGGCCGGGGCGGCCTGCCCC
GCGGGGCGGTGGGGCGGGCGCGTGCTTCAGCGAGCGGCCTTTGTCTCCGCAGGGGACTCC
CGAGAAGGATGTGAACCTCGGCGCCGGCGCCCCCGACACGCTGCTGCTGGACAAGCACGC
GGCCTACATTTGTGCCTACGGGGCCAAGAAGGACGACTACGTGCGTGGGCCCGCGGGGGA
GGGCTCGGGGGGAAGCAGGGGGCGCCCCCTTGTGCGCTGAGCCAATGCTGGGGACCCTGG
AGTGGGCCCGGGGGCCGAGCCTGCAGGTCAATGATGTCTTGGCATGTATTAGCTGAGCCG
CCGCTGATGCTTCCTACCCGGAAAGCTCTAGAATTACTCTGAGACCGTGCGGAGCCCCGG
CCTGGGAAGGGCCTTCGACCCTCCAAGACCACCCCGGGGCAGCAGCTAGGGAGGGGCGGG
GGGACCTAAGGCCAAAAAACCCTCTCCTTGCGAGAGCACGGCCACAGCAAGGCTCTGCCT
GGAGCTCCGCTAAAGGGCCAAGAGGACTGGAGAGCGGAAGAACCGAGTTCTAATTCTGCC
TCTCCCGGGCTTGAACAGCCCAAACCCAGCCCCGTGCTGGTCACAGATCTCTAACCCAGC
TCCTGTGGACCTTTACCTGGAAACTTTGGGGGTTTTGTGGGCAGAGATGCAGGCGGGGTT
GCCCTTCCTTGTCCAGCTCATTGTAGGCAGACATCCCTCTGGGGACCCACAGCTAGCACC
TCAGTGCAGAGCTGAACTCCTTGGTGACTCGGTCCAGCACTACCACCTCCCTGTCCTTCT
GCCCCTTAACGGGCCTGGCGTAGTTGGACTGAATTCTGATTGGTTCTGGGTCCGGATGGT
AACCACGGACCAAATTAAGAAGGCATCTTCTTAATGGGAGCGACTAGATTATAGACTCCC
CCTAACAAGAGTCTTGGGCTCTTCCTGTTGACCCCTGTGAGTTAGTTCGGGAAGTTCTCA
AAGTTCGGTCCGTTAGCCTGGCCTCCCACGTTATCCCCGGGGTGGGGGTGCAGCAATATC
GATGCGTTTGTAGAATTGGGGTCTGATGTGCTGGTGAATGTGGTCCCTTTAGGAATACTG
TATGTCCGAGTACTTGAGGATGAGCGGAATCTACTGGGGATTAACGGTGATGGACCTCAT
GGGACAGCTTCACCGAATGAATCGGGAGGAAATCCTCACTTTCATTAAGGCGTGCCAGCA
TGAGTGTGGTGGCATCAGCGCCAGCCTAGGCCATGATCCTCATCTCTTGTATACTCTCAG
TGCTATTCAGGTGAATATGTCCCCCTCGTTGTTGTGATTTTCCCATTTGGGGAGCAGTGT
GCAGGCGAGGCCTAAATCCTCAGTCCTGGGCCCAGCTAGCCCTAACCCTGGTGAGGCTCT
TGTTTCCACCTCCAGGTCAGTGATGTGATGGCATGTATTACCTGAATCCAAAGTTGATGG
ATATCACACTTTAGCTCTAGAATTACACTGAGACCTTGGAAGTAAACTGATCCCTAACAC
AAGTTCCTTAACACTGTCCCCAGTTGGTAGAGTGGAGAGGGGGCGGAGTAGGGGCTAGAC
TGGTTCTTGGGTGACTGGGTGAATGGGCCACTTGATGGACGTGTGGCCAACCTGCCCTGG
GGTCCTGGGGATATGATGCCCAAAGATTACTGACAACAATCCCCTTTTCCTTAGTAACTA
AAAACAAGGAAGTCTGTCCTACCCTGTGTAATTTAGTGGAAGAGGAAGGGCTTTTCCAGA
CTTGATTCTTCTAGAAGAAGGGGGCATTTTTGGTGAGGTTTAGGCATCCTGTTTTGGACA
CCTGATGTCCAGAATGATCTCTGGAAAGTAGAAACTGCACCTTCCTCTAGTAGCATGTTG
GCTCCCTAGTAGTACGGACTCCTGAGGTGACTTTGTATTCCCAGGGTTTCCAATAAGCAG
TCGTTAAAATTGCCTAAAAGAATTAATTGGAAATTTGACTCTTGGCCCATAATTCTTTGA
AAAAGATACTATCATTTAGATATATTTGAATCAGGCCTAATTAGATTTCAGCAAATTATT
TGACAATTTATAAGGAATATTGCAAAGGCTATTACCGTAAGATTTAGTAATTACTGCATT
TCTTATTTTGCAGATTCTTACTCTTTATGATAGTCTTAATGTTATTGATGTAAATAAAGT
TGTTGAATATGTACAAAGTCTACAGAAAGAAGATGGGTCCTTTGCTGGAGACATCTGGGG
TAATAATGCCTTTTATGTCAGTTTAGCCATAATGACCAGAACCACATTATCAAAATGGGC
CCAAAGGGCAAGAAAAGAATTGTTTGGAAACAAGTCCTTTTTTAGTTCTTAAATGCAGGT
ATAAAGGGGAAATTAGGGCTCCATTCTGGGCTACTTTTTCACTCATTTTTAGGAGCTAAC
TTGGCAAGTGGTATGTGTCCATGTATTTGTGGGACTTTAAAAAGAAATTAAACCTTTGAA
GTTTGCCATCTTTTCAGGTCCCACTAAGCAGCTGGTCTGTTTGGAGATATGTCTATCTGC
TGGAAGTTCCAGCATGCACTGTAGTAATTATATTTCAGCATACAGGAGCACTGGATCAGA
GGGGGCAAGTCTAGGATGATAAGGTAGGTAAATTTCCCCCTGATATTTGGTGGCTTTGTA
AAGTTTTTTAGTGTTTTCTCCTTTAAAAGACTGCACTGGAAAGGGGGGGAAGTAGAAATC
AAAGAGAAAACTTTACAAACTTGCTGAATATTTGAATGAAGAGAAAGGGAGCGGACAGCA
TTTTACCTTAAAAATGTCATTGATCCCTATTTTGGGATTCGGCTTAAGGAGTACTACTTC
ACTGACACAGTGCAGGCTGTCCTGTCCAGTAAAAGGATTGACTGGCTACCAGCTGCTTGA
TGGGATGTGAAAATCCCCTTTTTTTAAAGGAGGGGAAAGTCCTCCCTTCCTGTGCTCCCA
AGACATTTTTCCAGCGGGTTGAATGAGATAATAAATACAGAGAAGATCTTAATACAGTGG
TCAGCACGAGGGACCCTGGCGTTGCCGGGATCTTTTCAGCTTTGCTAATTGGAGGAATGG
TATGGCTATGGAGAACTAGATCTGATGGTATCCTTTGGGAAGTGCTGGGCTGTTCATAGT
GTGGTTCCTCTTTTCATCAGGGGAGATCGACACGAGGTTTTCCTTCTGCGCAGTGGCAAC
CTTAGCACTTTTGGTAAGCTTTCCATGTTGTACAGGAGGGGAGGGGAGGCACTGGAATGG
GTGGCTTTGGACCACCCTTCCAAGCGGCCTTCCCTGTCTTGTAGGGGAAGCTCGATGCCA
TCAATATTGAAAAGGCAATCGAATTTGTCTTGTCCTGCATGAACTTTGACGGCGGCTTTG
GGTGCAGACCTGGCTCCGAGTCCCATGCTGGGCAGGTAGGTGGTCCTTAGTGAGTGTCTG
CTCTTCCTTCCCCATCCCATTCCTCCCTGGGTTAGCCTATGGCCATGAGCACGGGGACTA
AGCAGGGGCATATCATAGGTGTGCTGGTTACCCAGACCGCCATGGCCTTGGTTTTCTAGG
GTGCTGCTTCAACCAGCCCCCGCGATAAGCTTCTACATGAACTTTATGTCTGTAATTTTA
GATCTATTGTTGCACAGGATTTCTGGCCATTACTAGCCAGTTACATCAAGTCAACTCGGA
TTTGCTGGGCTGGTGGCTCTGCGAGCGCCAGTTACCCTCTGGTGGTCTCAACGGGCGCCC
CGAGAAGGTAAAGGGTGGTGAGGAGCGGCGGGAGGGGCGGGCCCCGCACCCACTCTCTTC
TTAGCTGCCTGTGCTCTATCCTCCCCCAGTTGCCTGACGTCTGCTACTCCTGGTGGGTCT
TGGCCTCCTTGAAAATCATTGGGAGGCTCCACTGGATCGACCGCGAGAAGTTGCGCTGCT
TTATCCTGGCGTGTCAGGATGAGGAGACCGGGGGCTTTGCTGACAGGCCGGGGGACATGG
TACGTGGGGGGGGGGCTGCCCCACCTAGTGCCCACAGTGTAGTGGACTTGGGTCTCAGTG
CCAGGCAGAGAAGCAGGAAGGGCTAGGAAGAAGCTGAGGGCAGATTCTTCTGAGCCAGGA
TCGGTGTCTGCTCTCAGGCCTGGCTCTGTGGGCCCCCCCACCCCACCCCATAGTATGGGA
GGGGGGCTGGTGGGAAGGTTCAGTTAGGCCCCCAAGCTTCTGTGCCTTAGACCATGTGGC
CTGAACCTCCCATGAACTGCTTTTGGCCCTCTCCTGCTCTGCTCCTGACTTGGTCTTGTC
CCTTCCCCCTCCAGGTGGACCCTTTCCACACCCTGTTTGGCATCGCTGGGCTGTCCCTGT
TGGGGGATGAGCAGATCAAACCTGTCAACCCGGTGTTCTGCATGCCCGAGGAAGCCCTGC
GGCGCATCAACGTGCAGCCTGAGCTTGTGAACTAGCCGCCTTCCTCCCATCTGAATAATG
TTTGGAAATGACCGAATAAAATAGTGTTTAAAAAAAAAAAGGTTGTTAGTGACTAGACCT
GGATGTGGACCCCCCCCCACTTCCTGTTCCGGTGGCCTCGGCGCCCTCCGTGACTGTCGG
CCTCGATCTGCCCTTCCTAATCCTTTCAACCCGGAAATGAGCGTGCACACCCAAGCTCAT
CTCTTCTGTCAATCATCTCCGTTAATCGCTTGTCCCTCCCCTTCCGGGGCTACTTCCACT
CCTAACTGGTTGGAATCTCGCGGACTCAAGGAAGTCCCTCTAGTCCCGAAGCTTGCTGGG
AGAGGCTGGAGGCGGGGCCCCCTCACTAGACACTGTCACGTGGTGCGGTTCGCTACGCTA
TTCCTATGAGCGGGATGCCGAGGTCCAAGGTTCCCACTCCGTCGTGCTCGCGACCATGGG
ACTTTATCTCACCCGCGGGCAGGATCCCGCCGCTCGACCCCCGCAGCAGATCCGGTCCCC
CGGACACCTCGGCCCGAGGCTCGGCTGAGCGCGGCTTGCCTTTCCCTGCCGATGGCGGCT
CCTCTTCCGGGCCAAGCGGCGGTGCCGGCCCAACGTGGTGGAGCAGTAGCGGCCCCAGCC
CTGTGGGTGGGGCTTCCGGGGTTGACCGAGGTGGGGGCGGGGCCTCGAGTTGGAAGGGGG
GGCCGGGGCATTTGGTGGGGGAGGGTAAGAAGCGGGTTTTGGGGGGGGGGGCCCCCGGGG
GAACGGGTCTGCCCCCTTCCTATTTGAAGGGGGGGGGGTTGGCCCAAAAAACTCACCTGG
GTGGGCCGGCGGCTTTTTCTGGGTGTTGTAGCCCTGAAACCCCAGTTCCCCCCTTTGGGA
AAAGGGGGGGAACCCGGCCCCCTCTAGGAGGGAAGCCTCCAAAAAGGGGACCTGGGGCAC
CCTTTTGCCCAAGGGGGATTTTTGGGCCTGGGGAGGCAGGGAGGCCCGGAGGCCCGTGTG
GCCTTACTGCGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1372..1479, 2392..2589, 3433..3538, 4460..4512, 4604..4714, 4921..5046, 5129..5278, 5594..5734
1001..1039, 1372..1479, 2392..2589, 3433..3538, 4460..4512, 4604..4714, 4921..5046, 5129..5278, 5594..5731
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved