Monodelphis_domestica Locus Poly:13:SNORD22
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:13:SNORD22
Monodelphis_domestica
Poly:13:SNORD22
5
SNORD26, SNORD28, SNORD22, SNORD29, SNORD30, SNORD31, SNORD22
1001..1075, 1686..1763, 2189..2315, 2485..2553, 2733..2803, 2988..3054, 3518..3640
4640
GATCCATAGAGGTAGTTTAAGTTAGGAAATCTCACTCCTACGTGCCCGCCAGGCCCCAC
GGCGACCTTCTGCGCATGTCAGGCGGGCCGGCCGGCGGGTGATGCGCGCGTGCGCATGCA
CCGCGCAGGTAACGGACGGGCCGCGCGCTCCCCTCCCCACCTCGGCCCCGACTGCGCAGG
TGTATACGGCGCGAGCCTTGCTCGCTCATTTCTTCGTTCGTCCTTTCTATCCCGGCGCCC
GAGCGGCCCCGCCGAAAGAGACCGGTGCGCATGCGCCCCTCTATCCCCGCCACCATCCCA
TGAGCCCTTGCGAGCCTGTATTTAAGCTCCTCGCCGCGACTCGTTCGTCCTCTTTTGTCG
GCGGCGGTGAGTAAGCTTCTGTCCGTATTGGGTTGGGCGGGCGAAGAGGGAGGACCGGGA
CAGGTCTTTAATTTGGTTTCTCCTGGGATTCCACTAGGGCTTTCCATTTCTTCCCAACTT
CGTCGCCTATGCTAGCGGCCCTGCTCGGGCCTTCCTGGCCCCGCGGCAGCCCCTCGGTCC
GGGCTCCTGGGGCACATGCGCGTTGCCTAGCCGCCGTTGGGGGAGGGAAGCGGTCGGCGC
GAGCGGAAGCGTCAGTCGGGCAGAGGCGCGCTGGCTCCATTTGTTCCTGGAAGCTTCTAC
CCGAATAGGGAGCGGTCCTGGATTTGCTTTCCTGGCACCCAACCCTCTGCCCGCCCAGCG
CTTCTACTCGAGGGACGGGAGACAAGTGCTGGGGTCCCTCGGTGATGAGACCTATCACAG
ACCTGTACTGATACTCTGTGAGGACAAGAGAAACTCCTGAGGGGGAGCCTGCGCCCCCAG
CGCCCCGCTTCCTTTCCTTCTCAGCACCTCTAACGTCTGTTTTCTCCCGCAGGAGGCCCC
GGAGCTGCCCTCCTGTCCTGGCATTGGTGAGTGATTGGGAGCTGGCTAGCCGGCTAGTCA
GCCACACGTGGGCAAGAGCAGCAGGCCCTGGGGGGGGTGTGCTACGAGGATGATTTGGAC
ATGGAATTCTCTCTTGCTGATGGGTCAGTGGAGAAAGCTATGACGTCCTGAGTAGCCTGC
CTAGGGAGTGAGCACTGCTGGTGGGGGAGGGCTGATCCTGAGACTTGAACCCAGCCACAG
ACTCCATGCTCCTAGGGTGGAGAAGGCCTGCGATAGAAGGGTTTGCTTCCTCGAGGAAAA
CCATCCTTTTACTGTGTTTTGTAGGTTAGGGTTCGTCCAGGAGACCTTCCAGACCAGGTG
ATGGAGGCTTGCTTGGATTATTCTCCAGCTGTCTGGGTAAGTGTCCTTGATTGATCCCTA
ATTCTGTTTATTCCAGTGGAAGATCAGGGCTAGGATTTTAGGCTTGCTGTTGCCCACATT
GTGATGAGTGTTAAACGACAAGCATATGGCTGAATATTTTTGATGCCATCTTTTCTTCTG
AGAAGTGGGCAGGCCTCTTTGTTAGAGGGCAAATCGGGACACTTAGCAAGTACATGTAAT
GTCTTATTTCTGTCTCTAGGCTTCCTTTTCTTTGGATGAGACCTGAAAGTGTTGCAGGTA
ATTATGAAAGAAAATGGGTTTGGAGTGGGGGTGTCTGGCTTCTCAGAAACTGGAAGGAGA
GGCGGCCCTTGCTGTGCTGCTGCTTGGGGTCTCTGAGAAACCATGGGATACTCTTTTAGT
CTCACTGTCAGATGATTTGAATCTTGGCTTACTGATGCTCTATGAGGGTCCACATTCTTA
TAGCATGTTAGAGTTCTGATGGCAGCTCCTGTTGTTAAACAGTGTCTGCATCTGTCTCTA
TCCCTCTGACCCCTCCATTTCCCTCCCTCTCTCCCAGATCTCCTTCCGAGCCGTGCTATC
TTCACCCTTCTCCTTAGTAAGTAAGTTTTCTCTCATAGTCACTGCCCTTTGCTTGCCTCT
CTGAGCCCTTGGTTTGAGTTGATGATGTGGGCATGAGCCCATTACCTGATGGACGACATG
AGTCTTATGGCATTCTTTGAGTCACCAAAGCCCTGATCAACCAGAGGGGGCAGCAGTCGC
CATGACCAGCTGCCTTCAAGCTATTTCCTAACCTGCTAATATATATCATCCATTAGGGGG
ACATGCTGGCTACTGGAACAGCTCCAGGCTGAGAAGAGGAGGGTGTAAGTAATCTTCCTT
TGTGCTTCATTTGCTTTAGTGTTCCCTGGTACCCATGAGGAAAGCAAACAAATGTCTTAA
CCCCAGTCCTGGCCCCAGAGCCAGTAATGGTGAACCCACTGGGGCTGGCTGGGGGAAAAG
AGGAAGCCCTGTTCCTGAAGGAACTGTCTGAGGTACACAGGAGTAGTCGGTCCTGTGGAG
AAGGGTCTGGGAGGAGGCAGGCAGCACTGTTAACTGCCAACATTTCTGTTTCAGGCTTCA
CAGCTTGTTTGCTTGCTGTTGACTGGCAGCTTCTTGAGAAAAGGTTAGTCTGTTAATTAG
CCAAGTGCTGGCCTTTGGGGTGTGGTTTCAATGATGAGTCTAACTAGCTCACTATGATTT
ACATAAAATGAAAAGGCTTGAACATCTGAGAAACTGTACCAAGGGGAAAGGGGGGCCCCC
ATGCCCTGTCAGGAATCTCATTGACCTTTTCTTTCAATAGGTCCTTTTAAGAGCTGCCTG
GAGGACTAGCTGTGAGACCCAGCCATTGCTATGTGAGTAAGTACTTAGCCCTTTAGATTG
GGGGAAGAAGGGGTCCTGGGTAATTTTGGGTCCTGAAATGATGCATTCATTGAAGAATCT
CGTTCGTCTGAACCCCCCTGTTGAGACGTGCACATCTGACCAGGAAAGGGATACAAGGGG
CAGGACTGGTGGCCTTAGAGAAAGAGTACAAACTACTCTTTTTTTTTTTCTCAAAGTTGC
AGATTCCGACTCCTGACCTGGGGTAGCAGCAAGCAGGGCTGCACTGTCTATAGGTAAGTC
TCCTGAGACAGCTGAGCTCCCACCCCATCACCAAGCCAGGGGCCTGCTCCCACCAGTGAT
GAGACGATTACCGCCCCAGGCTGATTCCTGTGACTGATAGGTTGTTCTGAGTGGGTGAGG
AGGCCACCCCTGGGACCTGGCTTGGTCTTCAGACACATATGGGACAAGGACACATAAGTC
CTTGTTCATTTAATTAATGTACCTTGTTCTCCCACAGGTGAGGCCCGTGTGGCAAAGAAG
CTGGAATTAGGTGAGCTTTCCAAGGTGGTTTAAAGATGATGGGATTTTAAAAGTATGGGA
TCACCCCAGTACTTGTGAACTGGGAACCCTTGTGCCCCACCTTAACCCCAAGTGAGAGGA
AGCTAGAGCAGAGCTCCCATGGGCTGCTGGGCACAGGGGCGGGTGGGTCAGTGAGGTGTC
CTCCACCAGGCCATGCCTTAGGTTTGCCAACAGATCTAGGGCATAGAGGATGACTAGCAT
TCTATACAGGAAGGTTAATCTGGATCTGCTTGAGAAATAAGATGATTCACTGGGGGGAGG
GGGCTCTAGAGGGTGGAACAGCCCTTTTGAGCAGAGGTACCCAATGAAGAAGACATCACC
TGTCTTACTCCCTGACCTGCCCCAGAACCTGCAAAGGTTGAACCCACTGGGGCTGGCTGG
GAGGCAGGAGGAAACATGTTCCAGAGAACTGTCTGAGGGACCTTCTGATTTCTGGCTTTC
TTAACCTGTCCAGTTTGGGAGAGGTCCATCCAAAACTTTTTTTCCCTTGAAGGAACTGGC
CCTGGATCAGACTGAAGACACTACAAGGATGTGGCAATGAATATTTCTCCAAAACCTTGT
TTTTTGCAAATAAAGCTTTGTTTCTCTTGAGTCTGTTCACATTTCTTTTGGTCACATGGG
GGTGGGACAGATGGATGGAGGATTCCTTTAACTGTCCCCTGCTGTTAGCCATTCTTGGGG
GCCTCGAGATGCCCCCAAGCTCATTATATAAGTGCCCACTTGCCCTGGGAATGCCTAGGC
TGCAGTTTGAGGGGGTTCGCTCTGCTCAGAAATCTGGAAGCCAGGCTAGTGCTTGCTAGC
TTACTTAGCTGGGAGCTGGCAGGCTTGGGGCCAGGGGAGGAGCCTTGGGGCGTGGTGACT
GGAGGTCCACTGAGGTCTTGTGGAAGGACGCTTGGCTGGGCACTGACTGCTTAAGCTCTG
GAGATGAAGGCACCTCTTCCCCCTGCTGGCCCCAGCATTCCACTAGCAATGGCCTCACGG
GTTTCTAGGATCAGTTGAGCCGTCTCCTCCCATGCTCCCAAGCCCTGGCCCTCCCCAGGC
AGCCTGTGCACTTGGCCATGGCCAGAGATTGCCTGTGGCTGCTCTTGGTGCTGGTGCTGC
CCGCTGGGAGCCAAGGGATGCCATGTTGGCAGGCCAGCAGTCCCTTCTTGCCCCCAGAGG
AGGGAAAGGCGCAGCCCCCCCTGCCCGAGGTCAGCCCCTGCATGGTGCATTGTGCTAAGC
AAGTCCTGCCCAGATTGGGAGCGGGAGTCGTCTCAGTCCTCTTTAACCAGGCGCGGGAAG
GTAAGGCGGGGCCGGTGGGCTGGCACTGCCCAGGGAGGCCAAGAGGCTGGGGGGCAGTGT
GCCAAGCCACTCATCCTCTGCCTCTGGGGAGCTGGTGGAAGGGCCCTTGCGTGGGACTTG
GGGAGGTAGCTGGAGACAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved