Monodelphis_domestica Locus Poly:12:SNORD99
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:12:SNORD99
Monodelphis_domestica
Poly:12:SNORD99
4
SNORA16, SNORA44, SNORD99
1001..1137, 1917..2046, 2537..2617
3617
TTTCGACTTACGAGGGGTGAGTGAACTAACCTCTGCTCGAGCCACCATTCCCAGTGCCC
GAGTTGGAGCCCTGCACATGGGCGGCAGGGTACGGGCGTGCATCGAGGTAGAGTGGGAAA
AGCCCTGGATGAGAGTCGAGATCACATTTAAATCCTGCCCCACTGCTTGCCCGCGTGCCA
CCTCGGGCAAGGGACTAAGCCCCCGGGGACCTTAGTTTCCATATCTGTAAAATGAAACAG
TTGGAATGGATAGTTTCACCCATTCTAACAGTCATCTGAAGAAAGAGTAGGGAGGGTTGT
TTATTTTAAGGGATTCATGTAGCTTAGAACAGGTCGCTTAACTTGCGGTTCCGCCCTCCC
AAGTGCCTTTATTTCATTCAGTAAGCATTTATAAAGCGCCTACTGTGTGCCAGCCTCTGC
TAATTCATACAATGAATAAGGTGGGAGCAAGAAAGGGGGTCTCGGTTTGGGGCCTGGATG
AATCCCCTTAGCACAACTCTTTTCGGGGCCTCTTTCCCCTGTTTAGTAGTCCTTCTAGCG
AAGGAGTCATCTGCCCCCAGGCCACTCCCTTTCAGGCTCCTGTGTTTGGGCCTGGAAGCT
TCCTTCTAATCCTAGCGGAGTGGGGGGGAAGGGCTCCCCCAAGCGAGATGAGGCCTAGAT
AGACTTAGCTCGGCATTCCCACAGCCATGTGGTTCCTCCTTGAAAATGAGGGTTAATATT
GATTGCTCAGGACTCGGCATTTTAACATCTTGATTGGAGAAGGGAGCAGACTGAGGGGGC
TGCCTTTGAGCCCGGGCCCTTTGCTTGGGACTGATAGTGGTGGATGGAAAGCCAGGCAGT
TCCCCAGTGACTTGGTACCCATTGTCAGGCCCTTGAAGGTCTCCAGGAATAATGGGGCCT
TGAGGGAGGAGGCCAGCTGGGGGAGCTGTTGATTACTAGAGGAGTCAGCCTCGGCCTTGC
CATGCGGCCTGTGTGAAGTCAGCCCTCCCCTCTTAGCTCTCCCAGGCCCTTATCGAAGCT
GCACCAGCTCTTCTATAGCTGTTGCAGTCAAAAAGGAGCCCAGAGTGACAGTTTTCTCGA
CGGTCGCTGTTCTATTTAATTCTGTAATAGAACCGCAACATTGTGGGAAAAGACAAGCTG
CCAATTAGGGGAACTTCTTCTCTATTAGCCTGAGGGTTGGGGCAGAGGAGTAATGACTGA
GGCATTACCCATCCTGACCAAACAGCAGCTTCAGCCCAGGTAAACTGAGGCAAAGTTTGG
AGTTGGAGGGTATGAAGCATTTTGTGCATATTATCTCTTGAAGGTCCTAGCAATGAACTA
TGAGGTACCTACTATAGGCACATTAGCCCATTTTCCAGATGGAAACTGAGGCTCCCAGAA
TGAGGTCAAATGACCTCCTTGGAAACACCGCCTTGTTGTCAGCCCATCCCTTTTGCTCCA
GCCTCATAGTATAGGGACTGGCAGTGTTGGACTTGTTTTCACACTTGGAAATTTATGTTT
TCTCTTCCCCCACCAGGAATACTTAGTGGCTGAAATGAGCTGAAGAGGTGATGAAGTGAG
TGACCTGTGTGTAGTAGGTGAGTAGCTTGGGTGCAAGCCTAGTGCCCTGAGCAGTTCTAA
GAGCCAGCTAGTTCCACACCCACCATCTAATTTCCTATTTGTGAGTGGGGTTTCCAGTAC
TTCATCACCCACAAGCATTTGGAGGGGAGGCACTGGATACCTGGAGGATATCCCTAATAA
GCTCCTTGCCTCCACCTCCCCTCTCTGTTGGGGAAATTCTTTGGTCCATTTACAGTCCCC
CGCTTGTTTGCTTTGGTGGGAGGGCCCACTCACAGCCTAGCAAATGTGCCAGACACTACT
GCAGTTCAGATTAGAGATGCTGCCCCCCCCCCCCCCCACTCCAGAGAGTGAAAGGACCAG
CATGGCTTCAAGGGCTGTGGCTTGAAGTAGCTACAGGGTCTCCAACTACATGCGAGAACA
TGCTGGAAAGACTTTGACAGCTCTGGTCACCTCGTATCTGAAGCTGCCACTCAACTTTCC
TATATTCATAAACAGCTCCACTTAAGGGGGTGGCCATTTTGTGTAGGGGAACAACTCGGT
CAGATGGCCATTCTGCCTCCTAGAGGATGGAGGCATTTGCTTCCTGGGCCAGTTCACTGC
TCATTGCAGTGGCTTTGGCTCTGCCCAGCCACACATTTGCTGTCTGGTCTTAACCAGAAC
TGGTGCCCATTCAGATTTGGGTTTTGATAGACTGTTAACTCATTTCTTTTTGCCTTAGTG
CCAGGAGGCTGTCTCTAGCAGTGCCGTCAGCCAAGGAGATCTGCCCTTTGGATGGATCTG
CTGGGTTTGATCAGGTGAGTCCCAGGTCATGGGAGAGCCAGCTGTGCCCCATTGTGGTCC
TAATATGATCCCATAGTTTGGGCCTCAAACTTGGTTCCATGTTGTGCCTAACCCCAGGGC
ACTGCTGAACTTGGGGAAAGGGGAAGGACAGCTTGGGTTCTGCCCAAGTTAGGGTGGGTG
ATTGGATTTGCAAACTGACTGGTCAGTGATGAATCTCTTATCTGGTGGACATGCTTTGGA
TGACACTTGCGGATATGGGGCTGAGACCAGTCACAAGCAGTTAAGTACGAGCCCAGGCCT
TGCTTAAGACCTTGCTGATTTTGTGCTTTTTTTCCCCCTCCACAGAATCTACCTTGCTTG
GACCTTTACAGGAGCTGATCCACAAGGACCTTCTGTATTGTACAATAAGGTTCCAAGGCA
GAAAGCCTACTCAGTGGGGCTGAGTGATTTAACCTCCCCCTCAGTACAATGAACTCCCCA
CTTTTTGATAAAAATTTGAGGCTGGGCTTGCCTGCCCTACTTGACTTGTGTAAATTCATA
CTGTTTGTTCCTGGAAGGTTCAATAAACTACAAGTTAAATATCTCTTAAGTGTTTTTTCC
TTCTTAAAACTGGTTTCAGTGAAGCCAACTTTCAGTCTGCTGTCATCACAACTTTGCCAG
CCCCTCCCAAATGGGGGGTGTGCTCCTTGAACAAGGAACACTGTCAGGTATTCCAAAATG
CAGGCCTTGAGTTCCAACTCTCACATGGAGGATATTTGAGCAAATATTTTAATTTTTAAT
TATTAAAATTTTATAAATTACATTTCAAAAATGTTAAAAGTTCCCAATGTCCCATAGTCC
ATGCAGAGGTGCTGTGTGCCCAGCCAAGTTACATGACAGGGGGGATCTCTGAGGAGACAG
TGTCCAAGGGCTGCCAGTGACAATTCATCAAGGCATCATATAGCTCCTCACTCTGTTCCA
TGAACTCCTTGTTGGCTTCATTCACATCCAACTGGGGCGTAGGGTCTGAACAGGGAGAAA
GGAAAGGGAAAAAAGGGCCACCAGCATACTGAGCACCCCCAAGGGAGGAAACCACACCTT
TACAGCTGTGTAGGCAGGAAGAATATTTTGGCACTGGTAGTGGTATTTAGAGTAGGTGGC
ACAGTAGATAGAGGCTGCCTAGAGTTCAAGTTTGGCCTTAAGAGGCTAGCTGAGTGGCTC
TGGGCAAGTTCCTTAACCCTGTTTGCCTCAATTTCCCCTTTGGTAAAATGAGCTGAGAAG
GAAAAGCACTCCAACATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved