Monodelphis_domestica Locus Mono:4:SNORD18
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:4:SNORD18
Monodelphis_domestica
Mono:4:SNORD18
1
SNORD18
1001..1073
2073
GTCAGATTTGAACCCAGGACCTCCCATCTCTAGGCCTGGCTCTTAATCCACTGAGCTAC
CCAGTTACCCTCCTTTACACATCTTTTGCTTTACAAATTCTACATTTTGCTATAAACATT
TAGTTCTCCGAGTTGTTCTTGTCACTAAACAGAGAATGAATGAGTCAGAATGATATGGAT
ACATGCAACTGGGGTTCCCTCACTCCATACCCTTCTCCCTACTTTAGTTCAAATTTTCAT
GACCTATTGCCTGGAATTGCACAATGGCCTCCTAGCTGGTCTTCTTCTTTTGAGTCTCTT
TGTGCTCCAAATCATCCTCTAAACATCTGCCAAAATGATATTTCTAAAGCATAGGTCTGA
TCATACCACTCTCCTATTTAATAAGTTCCAAGTAGTTCTCAATAAATTCTAAGATCAAAT
ATAAATTCCTCTTTGGGGCATCTAAAGTCTCTCAGAACATAGCTATCATTTATCTTTTTC
AGGCTCATTCATTACTCCCTTTTACATACTGTTTGGTCTGGTTAAACTGGTAAAACTCTG
AGAGGTAAGTGTTATTATTATCCCTATTTTACAGATGAAAAAAATGAAGCTTAGAGAGGT
TAAATGACTTGCCCAGGCTCACAAAGATAGGTAGTATCTGAAGTAGGATTTAAACTCAGT
CTTCCTTGACTTGATGTTTCTCACAAACAACATTCCATCTCCTTTCTTTATGCCTTTGAC
TCATCCTCCCTTCCTAGGAGGCACTGCCTCCTCTGTAGTACCTCTTGGAATCCTTAATTT
TCTTCAAAGCTTAGTTCAACATCACCTGCTTCTGCCTTTCCTTCTCCTTTAACTGCAAGT
GTCCTCCACTCATCCTTGCAAAATTACCTTGTATTTATTTTTGCATGCATTTATAGTTAT
ATATGCTGTCTCTGCCAATAAAATGCAGACTTTTTGAAGGCAGAGACTTTCTCATTTTTG
TCTTTGCATCCTCAGTTCCTAAGAATAGTACCTGATACATAAATAAATGCTTGATGACTA
TTTATTGGTCCGTGTTTCAGTAGAACTTACACTAAAATTGGAATGATAGAGATTAGCATG
TGCAAGAATAATATGCAAACTCATGAAATGCTCCATAGAATGAAATTAAAAGTTTAAAGA
ACTGCTCCCAAAGTTAGACAATCCTGGGAAAAAATTATTAATCAATGATGAAGAGAGTCA
TTTTCACTTTTTACCTTTCTAGGGTCAGGGAGAAGCAACAGGAGAATCTCTCTCATCTGG
GGATTTACTCAGCTTGCTTTGTATAGGTTGTCCTGCTCAAAGATGTTGGTATTCTTTTGG
AGTCATACATTGAATCACTTGAATGAGTCTGGTGCTATCTTGTGAGACACTGTTTATCTG
GGTAGCTTATTCAGTAAAAGAAGAGGAAGGCCATATGTTGAAATCATTCCTCTAATCAGT
TCCTTGGGAGTCAGAGAGAGAGACTGAACTCAGCCTAAAGAAAAATTAAACCACCACCTG
GAAGATCATGCCATTACTCTTCCTTTCTGTCCCATGTCTCCTGGGCCCCTTTATGCCATG
TAAAGCCCAATTTGTTCAGATTATGATGACTGGAACCATCAAAAGTTATTCCAGGGAACT
GAAGGAGAGCTCTGCCCAATCTATAATTGTTCCCTGGCAGTCTGAGGCCAGGGGCTGCTT
TGCTTCAATCTACTTTGCTTTCTTCAGCTCTCCAATACTGTGTGCTACAAAGCAGTGGCC
TTGGTGCCTATTCCGTCCTGTGAAGACAAATACGCAGCTCATACAAGACAGATAATATTC
TCCATCCCATCTGGGAACATGGAAGAATTAAATCTTTTTTGCCTGCTTTGGGAGTCAACC
AGTCAGTAGGTCAACAAATATTTATTGAGGACCCAGATACCCTACAGCCTTTGGGTATGT
TTGGATTGTATCTGGAATTTGTTCTGCTGCATCAGAAAAAGCTCTTAAAATCCACTTTTT
TTCTGAGGCTTTTCTGGGCCAGTTAGTTCAGTTGGTCTCATTAGATCAAGGTCCCAGGAT
ACACAGAAAAATCAGATTTTATAACTAAAGACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved