Monodelphis_domestica Locus Poly:5:SNORD48
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:5:SNORD48
Monodelphis_domestica
Poly:5:SNORD48
2
SNORD48, SNORD52
1001..1062, 2001..2069
3069
AAAGATGGGGTGAGATGAGCGCATGCGTATAAGGGTTATTAACTGCTCCCAATGGTGGT
TTCGCGCCCTTATCTTTTCTTTTTTTAAAAAACCCTCCCACTGCGCATGCTAAGAGGCCT
TGGGGCAGATCTTGGAAAAGGAAGTACAAACCCGTTGCTGTCCCCTCCTCTTCCTCCTAG
AGCACGCTTTCCTCGAACCGTGGGGACTTTTTTCTCGGGTTTGGCTCACCAATATGCCTG
TATTGTATGTGGTTTTGTTTGTTTTAATCAGCAAAAACCTCTCCACAGTTACTCTCCAAA
TAAAAAAATAGGGTTGAAAGGAAAGCCATTATAGCTTTCCTTCTATTTCCCTTTTTATAT
TGAAAGAAGAGTTAGAAAAGAGGCTGGGGCGCGGATCAGGCATGGATAGGACAGCCTCAC
TTTTCAAGGCCCCCACTCGCCCGAGACTTTAAGTAATCGCCTTTTGGCGCGCGCTCAGTC
TCTTTGGGGTCATCTGCTTTCGTACTGATGCAGAACAAAGGGACCTGGCTGCGGAAGCCA
TGTCCACGGCTGATTCTCCGTGAGTTGTCTCTGAAGGGAGGGCGTGAGTAGTCCGAGGGA
CCTCTCGTTGCCATCGGCCTCTGGAACATGGGTTGAACTGGCGAAGATGTAATTTCCCCC
ATTATTGGCGGGCACACGTATGCCACCCACAGCAGCAAGGCACTCGATTGCTGGTAAGGC
CGGCAGCGATATGCCGGGTATTGCAGGGTGGGGGAATAAGCCTCGACTGGACAGGATGAT
CCTACTTTTACAGACTAGAGTTTCTGATATCTGTGACGTCACCATTTGGAACTGATCCAG
CCTCCGGAGGGATAAAGAGGGATAGATTCCGTTTCCTTTTTGCTTCTGACTTATTTTTTG
CTTTTTTAACAGGCTTTCAGATCTATGAAGCCGAAGGCACGTGTAGGTAAGTGACCGGGT
GTAATGTGGGTTGCAGGGTGGGAGGGGTTTGAGGCCTTGATAGGCATGATGACCTCAGTG
GATCTGAGTATCTCGTTGATGCTACCACCGCAGCGCGCTGACTTTTCCTGGTTGGGAATT
TGTGGGGTTGGGGATAGGACCCTCAATTTCTTAACAATTTTCTGAATCCTCTGCTTTTTT
TTTCTTTATTCTTTTCCAACCTCATCCATGCATAGGGAGTATAAGAAACAGATTCTACTT
AAACACAGGAAAGGTAAGTGCTATGTAGAGACTTAGTTGTAGTTATTCCGTGTATTTTTG
CTTTTTAAACCCTCAACTTCTGTCTTGAAGAAATCGATATAGGTTTCAAGACAGAATTGG
GTTTAAGTGACTTCCCTGGAGTCAGCTAGGAAGTGTCTGAAAGACCTCCCAACTCTTGGC
CTATCAGCTAAGCTACTTAGCCCCTCCCCCCTTTTAAATAAAAAATTGCCTTGCCTTTTA
GTCTGACATTTTTTCCATTTCCCTTAAAATTAAATTCCTTAGCTCTGATGACTGTGGGTC
ATGTGGATCTTTCCATAGTTTGGCTTTTTCTTTTATTTTTTCCCACAAATCTTTATCTTC
TGCCTTAGATTCTAATTAAGTATTAAGAACTAAGGTGGAAGAGTAGCTAAGAGCTAAGCA
ATTGGGGTTAAACCCAGAATCAAAGAACTAGGCAGTGTCTGAGGCCAGATTTGAACAAAC
CTAGATCCTCCTATCTCTTTGGCCTCTTTCTCTATCCATGGAGCCACCTACCTGCCCCAT
TCTCTTTGTGTAGTATGCTACATTCTGTAGCTCATTAATTCCTGGCTCTCTTGTGCATCC
TTTCACGATACATCTTTTTGGAAGGAGTGCACATTTCCTTTCTCCTTAATCAAGCTCTAC
AAATGGAATCTTTTTGACTGCTTTCTCCATTCATTCTCCATTTGACTGCTTTTCTCCATT
TTCAAATGACATAACATTCATGCAGTTTAAGCATATCCAGAATATCTTCCACTCTAGACT
TACCTCTAACTCCTCAGAGGTGGGAATGATGAGTTTTTCAGACTAGAGTCTCTGACATCT
GCCTTGGAGACAAGAAAACCACTCTGACCCATCCTGGGAATCACTTGGGTTGTTTTAGGA
TGGTCAGGGGAACCATATCACTGGGTCCTTTGCCCTATTATCTATTCCTGTGTGTGTCCT
TGGAGAGGAATAACTAAAACTCTTGTTTGTGAGACTTTTGTTAGTTTCCCCAGTTATTTC
TTAAGGTGTGATTATTAACAGAAGATTTGAACTCTTCCACTGTTCCAAGAACTGCATCTC
TGAAATTTTTTTAAAGTGGAGATGAAGATAGCATTATCTATTTCCATCTCATTTATTTGT
CAAAATAATCCTTTGTAGCTCTTCCTCTTGGTTGGTAGCATGAGTGGGGTTAGTACTAAT
AGTCACAGAGTACTTAAGGACTTAAAACTAGGAGTGATCTGATTGGACTATATCTTCTCC
CCAAGTCAATTTCCAATTGTACCTCCTTTGCCAGTTTTATCTAGTTACCATCTCTATGGA
ATTGTTCTGATGGAGAAAGGGAAGGAAGAAAAGGTTGGAAGTAATCACCTGATTCTATTA
TGGATTTTCAGGGTCCTAACTTGCTTTGTGGTACAATGTTGAAGCTGTTCCAGACCCTGG
AAATGAAGGATTATGCGGACCGTGATCAAATCAGGTGGCAAGCACTTGGAAGTTTCTTTT
TTCCATCCTCGGATCCCTGTTTATATACATATTTTCTTAAAATTAATAAAAAGGTTTTTT
TTGTAATAAGACCTGCCAGTTTGCTGTTTTTTCTTTTTGATACTTGTTTTTGGTTATACC
AGCTGTTTTTTCCAAACAACTTCCTTCACACAAAACCCAAGTCTGAATTATTAGTATAGT
CCAAGGAAATATATCAAGATGAGCTATCTATTATATATTGTAACACTGGGTCAAAAGTTA
TGAATGATTTAAGTGACAGATGGTTTAACAATCATTTACAGCTTCAATAATATCTTCCAA
AATCCATCCAACTTGGGGGTTTTTATTTATAATTGTAATGCTGGCCTAATTAGATCATTT
GAAGCACTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved