Monodelphis_domestica Locus Mono:7:SNORD58
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:7:SNORD58
Monodelphis_domestica
Mono:7:SNORD58
3
SNORD58
1001..1067
2067
GAAGTGAAGGTCGCCGTGTAGGGTAAACTCAAGGCTTCCCTTTGGGCTCCCCATTTGTC
TTCGGATAGCTTTGGTTCCTGTGCTGGGAGTGAGGAAGCCTTGGCCTCCCGTTTACAGCC
GGAGCCTAGACCTAGATGGCGGCTAGCAGGGGGGAGGGTGGGGGGGGCGCGCCCTCCGTC
ATCCTTCCTCTCCCGTCGCCTGTCTTTGCCCCCGCCATCGGCATACTTGTGTGCGCTGGA
GTCTCAGCCGGCACCACGTAGGTCGCTGGGTCCGTGCCGGTTGGAGGAAGGCAAGACTTC
ATTCCTGGACCTCGTGTGTGTTGCGGAGGAAAATTAGGGAGGGCAGGAAAAGACGGCCAG
GTTACTGTAACTTCCCTACGTTGTGGTAAGGAGGACCTGAAGCGGGGAGTTTTAAAGAGT
GTTTCCCTGGGCCCTTTTTTTCCTTTTAAAAAGAGGACTTGGGTTGGATTCCAGCCCTTA
GTACCGGGGCTGGCGCACACCACAAGAGCCAAAGAAGTGTTTATGGACATTTTATGGATA
GTCTTTTCTTCTTTATACAGTAAATCTTTATAGTTCTAAATCTGGTGTGAAATAGCCTTC
TTGTGCTAGGGAAGACAGCCCTCCTGGGTTGAAAGTATCAGCGTCCTAACAAGCTTTATG
AGTTTGGATGAAAATTGTTCGTATCCCATTCTGGAGTTTTTTGGGGCATTTCTTTCCAAG
CTCATTAGCAGATGAGGAAGCTGAGGCCAACGGAGTTAACGTGACTTGCCCAGGGTCACA
CAACTAATAAGTGAGGTGGGATTTGGACATTTTTCTTACTCCAGGCCCTTGCTAACAATT
GCAACCTGCTGAGATGCCCCCAAATTTACCCCAGCCCTAAATCAGTCATTCGGGTATTTG
TTGGGTGTGTGCCCAACAGTATGAGGTATTAAGGAAATTTTAGGACTTGAAGAAGAAAGG
TATTAGGTGAGTAGAAGTAGAATTGCTTTTGGAATAAGTGGCTGCAGTGATGACGATTCT
TAGGACACCTTTGGATTAACCATGAAAACAATGATAATTCTGAGCAGCTACATCATTTAA
CTTGATGGGATTTTTAGTATGTGGTTCAAAATGAATTTATAAAAGTTCCCTCCCTATCCC
CCAACATGTAACCTTGTGAAAAGATTGTCTAAGAAAGAATACTGAATTATTTCCTTTTTT
CTCTAGGTAATCATTCAAGATGGTGAGGTATTCTCTTGATCCAGAGAATCCTACAAAATG
TAAGTGAACATAAGATGTTAAAAGTGTTTTTATTGATGCCTTTTTACTTTCATCCTTTAA
AACATTCATTAAAAATCAGTAATGCATCCTTCAGATGCCAATTCTCTACAACTAAAAATA
TAGATACTTTTAAGGTTTCTAAGCCACAATAAAGTGCCCCTCTACTAATTTACGCTCTTC
TTTTCAGCATGCAAGTCAAGGGGCTCAAATCTCCGGGTCCACTTCAAGGTATGTGAAAAT
AACATGATTAGCTTCCAAAGTGTTTTCTTGGACTACATATTTAAAGCTGCAGTGATGACT
TTTCTTAGGACACCTTTGGATTAACAATGAAAATAAAAACAATACTGAGCAGCAACTTTT
GTTTTTACTTAGTTCACTAAGTGCTACACTGATTTTAACCAAAATGTTGAAATGGGACAA
AAATAAGGGGAAAGTATAGAGTGGAAACTTTGGGATAGGTCTGATTACTCTATTTCATAT
TCCCAGTTTTCACTAACTAGAATCTGTGACCTTGAACATAATTTGTAAACTGAGCTTAAA
TTCTACCAAATTCTACATGCAAACATTTGGACAGCATAATGAGGAAGCGAAATATACAAA
CATGCATATATCAAAACATTCAGTAGGCCACTGTCACTGGATCAAAAGCTCTTACGGGGA
GTAATCTTTGCTTTTCAAAACTGCTTCTTTCAATTCACTAATTATAATATCACCTTTTCC
AGAACACCCGTGAAACAGCCCAAGCTATCAAGGGCATGCATATCCGAAAAGCTACCAAAT
ATTTGAAAGATGTCACATTGAAGAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved