Monodelphis_domestica Locus Poly:7:SNORA43
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:7:SNORA43
Monodelphis_domestica
Poly:7:SNORA43
1
SNORA43, SNORA43, SNORA43
1001..1134, 1483..1617, 3054..3187
4187
GCTTTTAATATTTTTAGCTCTAGGTGGCAGCAGCTTGCTTAGGATAACAGCACGGGATA
CAATATAATCTGAGTAAAAAGAAATTAAAATATTTCTTTATAAAAACCAGCCCCCTACCT
TAGAATCAAAATTTGTTGGAAAAAAATAGTAATAACGCATTTATAGAGTGCTTTGAAATT
TGCAATATCTCAATTGATCCCCAACTCAAGTGTTATCTATTTTACAAATGAGGAGACTGA
GGCAGCCTGATTTAAGAGACTGGTTCATCCGTGTTCTGTGTTTAGGTGAAATGCATGTAG
GATTTAAATCCATTTTTGATGCTCTTATATATTAATAAGAACTTAGATTAGATTAGGGTG
AAATGCTTTGTCATGCTGACATACAGTTCTTTGTTGTTTCTCTTATTGAGACTGACTGGA
GGATTACTTGATTTTCTCCTTCTAGCAGGATCTAGCAGAATGGGAAAGCCGTGGACCCTG
GAATGGTGCCCTCTGGGAGTGAGGCAGGTAAGTTTGGGGATTATAATAAATCCATCATAG
TTAACAGGTTCAAACAATTGATTTCTTTGTGCCTTTTCTTAGACTTGTGATGGAATATTT
TGTTAACTAATTTTAATGTTTATATCAGTAAGTCAGATTATTGATGAAGCTAAAATGAGA
TTTCAGTTATACCTCATAGTGGTGGTATTTTGGAGACCAGATTGGAATGTTGAGTGAGTT
TACATATTGGTGCTTGAGTTTCTGCTGAGACCAACAAATGAATCCATACATAGTGCTCAT
TCTGGTAACCACTAGGAAATAGGTGCAACTTGTTTGCATTGAGTGATCCCTCATGGGGCT
CATTCTGAATGGATCTGAAACTTCAAGATTTTTATTTCTGAATTTGATTCTTTTCATAAG
TAGTTCTAGGTCCTATTTAAGCTGAATTAACTTGTGCCTATATTGTAGGGCAGTTAAAAC
TAGACTCCTAGAGGGGAGAGAAAATTTAATAGTAACCATAAATTGCCCCTAGAGGCGTTA
CAAATTTGGCTGCTGTGCCTCATTTGTGTCAGTAGGTGGCAAAGAGAAAGAGACTATGTC
TACGCTCAGTGCTCTGACCCAGTGAGCACTCAGAATGATTAATAGCCTGACACTTGTAAA
TGTCTGCTTTTTCTTATGTTTTCATGCATTTTATTGACAACTTGAACTCTCATGAAACTT
GGCTGTGTTCATGGATCTTTTTTTTGACAGGAGGAAGTGAAACAGGCCAAAATGAAAAAG
TGCTTAAATGGTGAGTGAACTGAATGGGGATTCCATCAGTGTTGTGGGTCAAATTATGAG
GGTATATCTTGGAAATTCAAGACTCACAAGAAGATAAAGAAATGATAGTAATGCTATTGT
ATTTGGTAGTCACAGTGTTGGAAAAGTTCTGGAGTGGCAAGTATTGGTGATATTCTAAAT
AAGAAATCCTTGATTGTTGCTAATAATGAAAAATGCTGCCATTACTGTTAACACATACAG
CTGCTGCTGCAGTGCTGGGCTGTACCTGTGTCTTTAGGTAGCAAAGAGGAAGTGGCTTTT
TCTACGCTCAGTGTTCAGAAATCTGTGAGCACTAAGAATGGTTGATTGCCTGACATTTTT
CTGGATTTCCCAACATTTGTGGATCCCTGATCTTATGGGCCCTGGCTATATTTTCAAAAT
GATATAAGCAGATAAGTTCAATTGATGAGAACAAGGTGTTGACTTTGGATCACTGGGCAA
ATCAGTATCATAAGAAGTATAATCTTGATGACTCTTGCCACTGCTAGAGTGGTCTTTCTC
CTGAACTATTGTTAAATAAGCTTGCTGTGCCAGATAGTGGTTATATGCTGTGTGTGTGTG
TGGGGGGGTGATCAGAAAGAACTAGCACTTCCAGTATAGGGCTTGCCACACCCAGTTCAT
TCACCTTTGGTGTCTGCCTTTCACCCAACTCTTGCCCATGGCTCCTAAAAAGCTGTAGCA
TGTATAGTGGGTCACATCCTGGCAGAGTGACTAAGCCAGATTAAGGATAACTGACTTTAG
TAAGAGGGTATCTACCCAAAACAAGACTTGCCCTGGCAGAATGGGCAGATGAGAACTTTT
TTTTCCAGTAGCCATAAAAGTGGCAGAAGATCTAGAGCAATTAGTTGGGTCAGATATTGA
ACATGCCGGGGTCATCCACTGTATCAGCAGTCAATCCTGACTTTTGTATTCCCACTGGAT
TTTTTTTTAAAAAACCTTTACCTTCTGTCTTGGAGTCAATACTGTGTATTGGTTCCAAGG
CAGACAAGCGGTAAGGGCTAGGCAATGGGGGTGACTTGCCCAGGGTCACATAGCTAGGAA
GTATCTGAGGCCAAATTTGAACCCAGGACCTCCCATCTCAAGGCCAGGCTCCCAATCCAC
TGAGCTACCCAGCCCACTGGATTTTGATGACTTCAAGAGAATAAGACTAAAGACTACAAC
TGCCATTCTTAAATCCAATTTATGTACTAGTGAAGACATGATCCTGTAATGTTAGTGTCA
TTGATCCTCTTTGAAAACAAAGAAACAGCAGTAATATATGCTGGGATTCAAAGACAAATG
AGGTAGCTCCCTTACCCTTAACATTCTTTAGGACTTACCTGTTTAGCCCTTTGGGTATTG
ATTTGGGATAAAGCTCCTGTTTTAAACTTGTTTAAATCTTGTGATCTTCTGTAACTCTTT
GTCCCCAATTAGATTAATTCAATGGCCAGACTCCCTAGGGAGAAAGAACTTAGGTCAAGA
TCATCTGGATCCCTATCCATCCCAGATGTGTTAGACTAAATTGTCACTTCCTTGAGAGTA
GGGATCTGGGCTGTCAACAAATATTTGTTTATTTGATTGGACAGTGAGTTGTCTGACAAC
AAGGAGGACTTCCAGGTGCATCATCTGTTGATTGAGGAAGAGGCGGAACATCCCTTCAGT
ATAACTGTAGGACTGCTGGACAGTATATCATCTATGGGATCAATGCTCCAGATTGGTGTA
CTGATGGCCTCTTACACAGGTGAGTACCACAGGAAGGCAAAGTATGTTGATTGATCTGCC
CCCTAGAGGCATTACCAAAGTGACTGCTATGTCATATTTGGAATTAGGTGGCAAAGAGAA
AAAGGCTATGTCTACGCTCAGTGTTCTTAAACTTGTGAGCACTTAGAATGATTAATAGCC
ACACAATGTTTGTGTATTTTATGTAAGTTTTCCCAGTTAATCTAAAGAGATGTCAGTGGC
AATAAGAGGACCACTGTCTCTTTGTATTTTCTTATGGATCCTGTAAGCAAAAATAACTCA
GGGTAAAAAATTATTCTAGTTCTGATTCTGAATTTTCTTGCCTGAATGTTAACTCATTTA
TATAATAAAGTTGTCTACAAAGTTTTGTTTCAGAAACTAGATAAATTAAAGAATCTGATT
CCAGAATACAGTTTGCCAGTATGGGGATATGGTCAAGCATCTCTACTATTGCCTAGAGAC
AGGAGGTCCTAGGTTCAAATCTGACCTCAGACACTTCTCAGCTGTGTGACCCTGGGCAAG
TCACTTAACCCCCATTGCCTAGCCCTTACCACTCTTCTGCCTTGGAGCTAATACACAGTA
TTGACTCCAAGACGGAAGGTAAGGTTTTTTTTTTTTTTTAAAGGGGGGGCAACTGGGTAG
CTCAGTGGATTGAGGAACCAGGCCTAGGTTAACATAGATAGCTTCTGGATGCAAGTCTTA
AGTCAATTTGGCCTGAGCTGCTAGCATTAACCCAAGCTTTTCTAGACTCAAATGTCAGAT
TCCAGCACCCTAAATCATTAGGGTGATGGCACTGAAGTTTATACTTGATATAGGATTCAA
AGAAATAGTATACAATTGGCCAGCATGGAGGCAGTTTCCAGATAGGTTGCTTAAGATGTA
TGATGGAGAAAATCGCCTCAGATTTCTTGCGTTAAAATTAAGTCCTGGGTTAAGCATTAA
ATAAATGTGGTTTCTAGGCAACAGGTTTGTTTTCTCAGCTATGCAGGTCTAGGTTCAAGT
CCCACCATGCTTAGCCAAATGATTTGGGGTTTGATTTATTCTTTCCTTTATGCATCAGGA
TATTGTATTTGCAGAAACATCAATTTGTTAAAGCATACCTGATAGCTACCCTGTGTGAAT
GCTTTTTGTTCCAAGAAAAGTTCTTCCCTAATATAAGGACAGTAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved