Monodelphis_domestica Locus Mono:12:SNORD93
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:12:SNORD93
Monodelphis_domestica
Mono:12:SNORD93
8
SNORD93
1001..1077
2077
CACAGAGCAGGTACTGAATAAATGGTCATTTACTGATGTAGCCTCTCCTTTTGAACCTG
ACTCTAAATTTATGCTTCCCCTCCCCATCTTGTGAGAATTGGGGAACAGGAAAGGCCATG
GATGGATGGATGGATTGAAAAGCAATCTGGAGATACTGATAAAATGGGCTTTTTTAAAAA
TTCATTTTATTTTGAATTGAAGAAACACCAAATTAAATGGGCAGTTTCGTCTGTGTGATA
GAGCAGAGAAGATTGCCCTGGAAGCCACACAGGTTTGTTCCATACAGCTGGCCTTTCCCA
GAAGTTCAGCCGTCTTCAGTCAGGAAGACTCATCTTCCTAAGTTCAAAACTGGCCTCAGA
CATGTCCTAGCCATGTGACCCTGGGCAAGTCACTTAACCTTGTTTGCCTCAGTTTCCTCT
TCTGTAAAATGAACTAGAGAAAGAAATGGCAAACCACTCCAGCATCTTTGCCAAGAAAAG
CTCAAACAGAATCAGAAAGTGGACACGACTGAACGGCAGTTTCAAAGTTGAAGGGACTTA
GAGGTTCACGTGTAGCAGAGTGGTGGCCAGGCACAGAGAGGGACATTGAGGTCCAGGTCT
GGAGTCACAGGGCATTTGGTGGAAAGGGTGGGTTTGGCTAGGTGCTGGATAGAGTGAGTC
TACCACAGGAGAGCAGAGTGGTTAAGGCTGGGAGCTCAAGAGGCCCCCGTGGGAGAGTTG
GCAGTAGGGCTTGGGCCACCCCTGTTAGGACCACAAACCACCAGCAGCTGGTCCTCCCAG
TATGGGCAGCCTAGGAAAAGCTAGACTAATTCTGGCCATTGAATCTCTCCCGCCTGACTT
CCTTCATTCTCACCTGAACAAAAGCCTAACTCAGTTCATTTTCTTCTTTTTGTCCCAGGC
TCCAGGAGGAAAACAAGGCAGGCTTATGGTGGATTCCCCCTTGTTTCAGGTACGGTCAGC
GGGGTGTAATTCAAGCTGGCTTAGGAGGGGAATCGAATACTTGGCCAAGGATGAAAACCA
CAGTCTGATTGGGCATGCTTTCCATGCTCTGATGGGTTAAAGGATTTACCTGAGGCCAAC
TGGACATTCCTCTAGACATTTAAGATGTTGGGAAAATGAGACAATCTGCTTGCCGGGGAG
GTCCATTTAGTCCAACAATGCCGAGAACTGAACAGCAATGACTCATTAAAAATAAGTTAA
TAAAAACTCAGTGGGACACCTTTCTCCCCTTCAGGCTTGTTCTGCAAAAACGAGTTTCCC
AGGTAAAGCGCTCGGCGTCTTTAATGTCAGTCGTGGGTGGCTTTGTTTTTGTAACCATTT
GGCGCTTTCAGAAATGGCTTGATGAGCAGCCTGGATGGGGAGCGGCTCCTTTTTCTTGAA
GATTGATTCTTCTGAGGCGCCACCGGGCCGTGGCACACTGATCGGACTTTCTCAGGGCCT
GACAGGTGTCCAGTGTGTACCTCTTCCTTAAGTGCCCCTCTGGCCTGCCTGCTCGTTCTT
GTTTTACAAAAGGCCTGTATGTGATGAGACCTGTTTGTCCCCAGCCAGGGCTTCTTTTTC
CTGCTCACTGCCACTTTTCGGAGGGCTGAGTCTGGAAAACACCCCACGCCATCTCCTAGC
CTTTGGGCTCTGCTGTTGACTTCCCAACTCCTTGCTTATAAGAAAGAGGGCAGCCGAGTC
ACCGGGGAACCAGGTAGTGACTCAAATTAAGCTGGGACCCGAGAAAGGGCAGAGTAGAAT
CCTGGGCCAGGGTTTGATGACTGAAACTCCTGCTATAATTGGCCGTGGCTCCCGTGGCCT
TTCCAGAAAGTGAGACAAAGCCCACCTCAGGCTGAACTTCTTGGGGTGCTTTTATGTTGG
CCATTGACTCAGTGGATGAGGTGAGCAGTTTAGGAATGCCCAGAAGTCATTGAATGGCAT
CCAATCGCTCCATCTGAACCACCTGACAAAAGAGCTCTGGATGGACCCACTGGGGGAGCC
TGGCTGCTCTTTGTTAAGTGTCATAGACTCACTGGATAATTAAATGATGTTTTTCCTTTG
CCAGTTCTGGTCCTTGAATGAGAGAGAAAGCTGGTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved