Monodelphis_domestica Locus Poly:11:SNORA73
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:11:SNORA73
Monodelphis_domestica
Poly:11:SNORA73
4
SNORA73, SNORA73, SNORA73
1001..1200, 1673..1870, 2055..2254
3254
CTCAAATCCCGGTTTGGGCCCCAACTCCATTCCCAAGGAAAGCCTTTGGTTTTCAATCC
GCCAGCATTTCTTTTTCTTCTGCCTTAGAATCAATACCGTATTGATACCAGGGCAGAACA
ACGGTAAAGGCTAGGTAATGGGGATTAGGTGATTACTGACTTGTCCAGGGTTGCCCACCT
AGGAAGTGCCACCAGCATTTGTTAATCTTTGCTAATACTACTGTGTGTACGGTGTGCAGT
AGTTTCTATATTTGTTTAATGGGAAGAATTGTGAGGGTCAATTGAAATATGATCTAAATT
TTCTTTGGAAGTCCTGTGGAACTATTAGTTATTGCAGAAGAAAATTGAGAAAACTCTTAG
CTTTGAGGAGTTTAGTCTATTAAGGAGGAGAGGGACGCGCAACATGTGCTTAAAATAATA
ATGCAGAGTTTGCAAGAAATCTCCTTTTCTAATAGGATTTAGGAAAGGCTTCTTAACGGT
TAGTGGCAGAGGAACTAAACCTTGAAGGGAATGGTAATTAGGCTGGGTAAATCATAGACA
CGTGGGGATGTGATGCCCCGTATAGGAAACGACTAAGGTTGAGTGATAGAACATGTTGAG
AGTAAAGTTGGATACAATTGAAAAGAATTCAAAGCTAGTTCTACAAAGGCTTTAAAATTT
CCAGGATGTGGTTAGTTAGGGAGCCGCTGAAGTTTATTGAACAAGGGAGTGGTGTGATTA
ATTCTGAAATCAATATAATATCCCTAGGGCCATTTATTGTGAGGTAACAGCTTACAGTAT
ATGGCCTTAGTACATCTTAGCTTCTAGTAGTAGTTTTCTTGGCACTTGAATAAGCGGTTT
TTAGTAAGCGGTTTTTAGTCCCGATTCTAGTATGTCTTGGGGCATACCTGAATATGCTTA
AGAGAATGTCCTGTTTCTGTAGGAAATACTCCATTGATAAGACCTCATTAATAAGTGCTC
TTTGGATTAAGTGTTTGGTCAATTAAACATCCCTTGAACATCCAATGTGGATATCCTGGC
TAAATGTTTCCAGGCTCTGTCCTAGTGGCGAAAGGGAGCTTAGGGCCTTGCCCTGTGATG
TACAGTCCCATTCCACAACATTGGATATCAAGCTGGGCTTTGTGTCTGCACCTGCATATT
CCTAAACCTTCTCAGAGTCTTTGGACTGTGACTGAGGAGACAAACCATGCAGGAAACAAG
ACTCTTATTGCTTTGGTAACTTGAGTATTGAGCTTAGGAACTTGGGAAACAATTTTTTTA
AAATCTTACTTTGAAAAATCTTTCTTCTTGCCTTTTTAGGGGTTTTTTATATGCAGAGAC
AAGTCTGGGAGATACCTGGGGTGAGTTGACAAGCAATTTTCTTAAAAGACTTGGAACTGT
TAATTCCTGTACTGAACTGTTAATAATTCCTGTACTCTCTGTCCTTTGTAGTCCTTTGGA
AAGTATTAATACATTAATTGTAAAGGCTGATGTTTTTCCTTCAGCCTTTTGAAAAGATAG
TGGTGTTAGCATGGCATAGTAATCATGCTATTTATAAATTCTGTTAGGTGGTAACAGGTA
ACAAGTTATTTTGGAATCTTAAGTTGATTCCCGTTGTATCTCCTATATCAGATCTGCATG
TCACTCTTTCATTTGTTTTCCCCTCTTTTTTAATGTCTTAAAATATCTGTAATCCAACGA
GGATATCCTGAGGTCACTCCTTAGGCTCTGTCCAGGTGGCGAAAGGGAGCTTAGGGCTTT
TGCCCAGTGATGTACAGTCCCATTCCACAACGTTGGATATCAAGCTGGGCTTTGTCTGCA
CCTGCATATTCCTAAACCTTCTCAGAGTCTTTGGACTGTGACTGAGGAGACAAACCATGC
AGGAAACAGTACTATTCCACTGTCCCACTGTAATGTTTCACAGTTTGAGAATGAGAAAAA
CTAAAATTTGCCTTCTTGTTTTTCAGGACCCCCTCCTCCAAGATTTCTCCTAGATAGGAG
GTGAGCAATTTATCTTTTTTTGTTTTGCCAGGGGTTGTGGCTTGTTTTGAAGTTGATTCT
ATTAGGCCATACCTTCCAACGAGGATATCCTGAGGTCACTCCTCCGGCTCTGTCCAGGTG
GCAAAAGGGAGCTTAGGGCTTTTGCCCTGTGATGTACAGTCCCATTCCACAACGTTGGAT
ATCAAGCTGGGCTTTGTGTCTGCACCTGCATATTCCTAAACCTTCTCAGAGTCTTTGGAC
TATGACTGAGGAGACAAACCATGCAGGAAACAATTTTCAAATTTAAGTTTTTTGATATGT
ATTATTGAAGTGGTAAAATATACTGATAGATATGTTTTTTACTTTCTAGGTTAAGAAGAG
GACTTTAGAGCATGTCTATTAAAACGTGTGGTATTTGGGAGTTGTACATAGGATTTTTTT
TTTTAACTCAAGGCTGCTGATACCTTTTTTTAAACAAGTTTCTTTTTAATGGGTATTTCT
CCAGCTCTTAAAGAGCATGACTGTTACAGATCTTGGTATGGGTAAGTCAAGTGTTTCACA
AGGATTATTCAAGTGCACAGTGAAAGGGGATCATGATATCTCCCCAAACTGCAAAGGTCA
GTGGTAGAAAAAGGAAAATGCCCAAGTACTGATAGTCTTTTGTTGTAGCCTAATTCTCAT
AAAAGTAGCCACCTTCAGAGGTGAGGTATATAGGCAACAACTATTGATAAATATGTTGAT
ACACTGAAAAGCACAATTCCAGAATTGCAGAAAATCTCAAGTGGAGTGCTGCAGTATTTT
CTTGTACCATGCCACATTTCCCAAAATAGTAAATTTGTCCAAGAGATGGAGATAAATGTG
CCTCAATGGCATGAGAGCTCACCCGATTTAACCCCATTGAAAACTTGTGGCATAAGAATC
GAAGCTAGACTTGAAGAAATGGACTGCTTCTCAAAGGCACATTTGATAGCCAATGTTTTT
TAAAAGTGGTTTCATGATGAATTACAGAATGTGTCAATTCTATGGCAAATTGTGTAAAAC
AAGTGAAGCAAAAGGACATGTTGCTTTCTAAAAGTTGAATATTAGAGATGTGGAAAGTTG
TATGGTTTGTGTGTACATTCAATAAATTTTATTTTATTTACCCTCATTGATCTGTTGGTA
TGCTTCCTAATCCGGATTTTATTTTTTAGGGTGATAGAACTATTAAATTATTACTAGGAC
TAAGATAATCAGTTTGAATAATGTTTAATAAAACAACTTTTTAAAATATCACTGAACCTA
TTAATCTATTAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved