Monodelphis_domestica Locus Mono:20:SNORA56
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:20:SNORA56
Monodelphis_domestica
Mono:20:SNORA56
X
SNORA56
1001..1135
2135
GGCAGCTGGTAGGCTGGCCTGGGTTTGATGCCCGCTGAGTAGAACAAAGGAGCTGTGAG
GAACTTGACAATAAGGGAAAGAGGAACAGTGACAACATTGCCAACATTTGACTGCTTAGA
ATCCAGTGGCACAAGGGGGGAGGAACACCCTTAGTTGTGTGGGTTTTGTGTATATAAATG
GAGCCCGGTGTCCACGGGACATTGGCAACTGATGGGTTTCCTGATTTGGCTTTGAAGCAC
CTCCATTGTCTTGGTAGCTTGGGATGGATGGGAACATGTGGGCTCAGTCTGATTGGGCGG
CGCCAAGTCTGCTGGCAATCATTCAAGATGCTGGAGAAAAATGACTGCATCTTCAGGCTC
CCAGGCTCCTTTGCTGCTCACTCACTCAATCCCTCTTTCCTGCCCCGCCAACTCTTGGTT
TGGCCGCTTCAGCTCCTTCTAGCCAAATTCCTTGAAGGTGCCTCCTCTCTGTCCTCTTCT
TTAGCCTCTTATGTGCCAGCTTCCACCCAAACAACTGGCAAGTTGCCAGATCCATGGCTT
TTTCTCAGTCCTCTTCCTCCTCCTCCTTGCCCTTGGGCTAGAAACAGAAAGTGCCTTTTG
GTGTTCCAAGGCCCTACCAGCCCATGTTCTCTCTTGCTGTCCCGCAAGACACCATGAATT
CAACAGGCCAAACCCTTCCCTTCTGTCTTCTCTTAGAGGAGCAGAAAGGCCTAGGCAGTT
TGGGGTTAAGTGACTTGGCCACAGTCACACTGGAAGTGTCCGAGGTCAGATCTGAACCTA
GGACCTCCCAGCTCCAGGCCTGCCACTAAACCAGCTCTCATTAATGATGTGATGGTGAAG
CTTGACTTTTTCTTTCTTCATGAGGCAAGTCAAAAGAAGATGATGATCAAGCAGGGTCTT
CTGGACAAGCATGGAAAGCCCAACGACAGCACGCCTACAGCCTGGAAGGACGACTATATT
GACTACAGGTGATTGGTGGCCTGTGGAGGGCAGCGACTGGGAAGCAGACAGTTATCCCTT
TCTGGTCTTCCTCTCGTGACCTTAGAGGGAGTCAGTCTGCAACATGAAGTGATGGCAAGC
TGTTTCTGGCCAGCATCACAGTGTGTTGATGGTGGTTTCAGCCTTGCCAGACACCCCCAG
GTGCTCCTAGAGCGGCCACTCCTGAAGGGGGGTGGCAGGGATTTGACTGCCTCCTTTCTT
TCAGTGTCACCGTGAAGACGGAGCCTGTCTCGGTCCCAGTGGTGCCCATGAAGACCGAAA
AGACCAGGAAGGTGACTGCTTGGTGGGGCGGGGCTTGGCAGGGAGCCTGGGAATGGTGCT
GGCTTGGATTCCCTTCCACTGGGGGGAGTTTAACCGGGGCTTTGTTTGGGGAACAGAGGA
AACTCGAAGAGGAAGACGAAGGCCAGGGCAGCGATTACAGCGATTACGGGGATTATGGTG
GCGAGAATGGTGATGAGGAGGAGGAAAGCAGCCAGGAGGAAGAGGAGGAGCAAGATGACA
GTGAGGAGGAGGTGGAAGAAAAAATGGAGAGTGAGGAGGAAGAGGGGGAAATTGCGCCAG
GTGGCCAGGAGGAGGAGGAGGAGGAAGACAGTAAAGCATTTATTGTTCCTCAACTGGAAG
TCAGCAAAAAAGGCAAGAAGAAGAAGAACAAGAAAGAGAAGAAGATCAAGGTCAAGGTTG
AGAGTCCGAGCGGCAGATCCGTGGATTCGGTATGTATTCCCTCTGGAGGCTTGTCTGTGG
GCCCTTGGCACACTGTGCGGTGCCAGTGCTAGCTGGCCCAGTGTTCACACTGACTGTGTG
TCTCCCTTCAGGGCACTGACAGCTCCAAGAAGAAGAAGAAGAAGAAGAAAGCCAGACTAA
TGGCCGAGGACTCGGAGTAGTGAGAGGAGCTGGGCTGGCCGGGGGAGACCAAGAGGAAAA
AAGGCGACTGCAGTGGTTTGGGAAAGGACAGTGCGCCTGAGGGAGGGGCCCTTGGCTCGC
CATTGACCCTGCTATTCTGGGGGGTGGGGGGGCCATCCTATCTTGTCCTGTTTTAAGGAT
ATTTGCGGGGGCGTGGGTCAGGAACAGATGCCCGCCCGCCCGCCGCCGGAGTAGCAGAAT
GTGGATGTACCATAGCTTGCTTACTACGGCAGAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved