Monodelphis_domestica Locus Poly:0:SNORD47
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:0:SNORD47
Monodelphis_domestica
Poly:0:SNORD47
2
SNORD74, SNORD75, SNORD24, SNORD77, SNORD78, SNORD47
1001..1078, 1785..1845, 2067..2149, 2307..2374, 3421..3485, 5002..5080
6080
GGGCCCCGGGCGGGGGGGGGCGTATCCGCTCGCTCACGGGGCGGAGAGGAGGGGGTGGG
GTGGGGCGAGAAAGGTCGCCCCGAGCTCAGGGGTTGAATCCCCCCAGGGCCGGGCTGCGG
GGTGGGGGTGGGGAACGGGGCGGGGCGGTCCCGGGGCGGGAGCGGGAGGACCAAGAGAGG
GACAGGGGAGGCCGGGGCGGAGAGTGGGGGCCAGGACCCCGCCGAGGAGCAGTACCTACC
TCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAACACCGTCCCGGAAGTGAAACCCCCCG
CCCCCTCCCCCCGAGCGGGCGACGTGCCGGAAGGAAATCACTCACCCTTACACCGCCCCC
CATCCTCCTCCTCCTCCTCCTCACATGCCCCCTCCCCCATTCCACTCCTCCCCCCTCCCC
CTCTTCGGCTCTCCTCTGCTCCGCTTCCCCGGCCGCAGCCCAATGTCACGTGCTCCCCGT
GAGTCCAACCCCCTCCCCCCCGCCGCAGGCGGTAGGAGGGGCCACGAACTAGGGGACGAA
TAGAGGCTGGGGGAGGGAGGGGCAGGTGGAGAATACCGGAGGGTAGGCGAGGAAGACTCA
GGGCCTCCAGTTCCCGCTCTTTGGCAGGGGCGGGGCGGGGCAGACGCTGGCGGGCGTCAT
GACGTCACGCCGCCTTATATAAAGGGCTTTGCTGCAGTTCCTTCGCTCTCTTTGAGGAAG
ATACGGCCTTGTTATAGGTAAGTTCTGTTGTGGCTGGTCTGGCCTCTGCTCTGCGGGTCT
GAGTCGCTTGTCGGGATGCGTGGCGGTAGGCCTGCCATTCTCTCCGGAAGGAGAGCTCTT
TCTCACCCGCACCTTGAGCAGACGTCGGATGGCTTTGGATTCTGTTTGGGACTTCCCTGG
GGAGTGAGGCCACAGGTCCGAGAGGCCTCCGACTTAAGCTGGTGCCCTGGGCCCGCCGCG
GGGTGGAAGGGCGGGATGGCGATGGGAGTCTGGTTTTCAGGCCTTGCTGTGTGTGATGAA
AGTAACGTTGGTAGGGACATCTGAGATTGCTGATGAATGCCAACGTCTCTGATGCGGGGC
CTGGGCTGAGCAAGCGGAGAGGGGCTGCAGTGGGCCTGAGAAGTCCAGAAGTGAACGTGG
CTTCCTATAGCTCCAGGGAGGGCGGCCATTACCTACATGTGCCCACTGGGTCTTAACAGC
CCAAAAGAAAAAAAATGACCCAAGGGCGCCTGGGGAGGGGACCGAGCAATCCACGTGCTA
TCTGCACGTGTCCGGGCCCCAAAACACCCGGCCTTTGATTTGGAGGCCCGGCAGCTTGGC
CCCCTATGCTTAATTATAATCTCTTTACCTATCTGCAACATTTGGAGGTTAGATTGCAAG
GACGAATAAGGGCTGGACACGAAACTAGGTATTGATTTAATGCATTTGTGGGGAGGCAAA
TAGAGCAAGGAGTTACTAGCTTTTCATTGTGTGCTAATATCAAATGGCAACCAGTAAAGT
CTTTCATTGGAGCATGAGGTTTAGACTGTAGTTTCTTAAAGTCAAATGTTTGCATCGATT
GGTTTCCACAAAACTTGGCTTTTGTTTTTTGTTAGATATGGAGCTCAAGAAAGGAGCACG
TCCTTGGCTGACCTTAAAGGTAAACTATATTTGAAAGACGGGGCTTAAAGGGGTAGAGTT
GGGACTCATTACAGTAAACAACTCAAGCTAATACATGATTTGATCTAGCTGCTCTTAAAG
CAATAGTGTTAAATAATGGCTCTTGGAGTATTTTCATAGCTATTCAGCCTATGATGTCCT
AAGAGTAGTGGACAGAAATGATTTCTGACAATAATATACTGAGGCTTTAATAGTGGGAGA
TAAGTCTCTTTCAACTTTGCTTTTTAGACTATTGACTCTGCTTTCTGTACTTTGCAGTTA
TACATCATGGGTGAAGTTGCTGTTTCTGAGGTGAGTGTTAAATATATTTGAAAATGCAGC
TTTGGAAGGTAAGCAGTGCCTTTCCACTTTAGCATGCTTAGGATCTGGTCCAACCTCAAA
GCTGTATTTAAAAGAATTGATCAACTGTGCTTTAATGATGAACTTTTATTTGCTACTCTT
GATCATGAGTATGATGAGAAATACTACCACCTTTCTCTTATACTGAAGCACTCCACTGGT
ACTAACTTTTACATATGTAAGATTTACATATGAGAAGATAAGTTACTTAGTACTGTGTAT
TTTCTCTCCTTAGGCTCCAAGGAATTACAGTCACAGGCAAACAGGTAATTAAGCTGGTTA
CTGTCCCACATAATAACAGTAAAGCAGATACTATGATGGTTGCATAGTTCAGCAGATATT
AGTGAAGAATACTTATCTTATTATCTGATGTATCTGACTTGTAAGAAAACAGTTTGCTTA
AATTTCTGCAGTCAAAGGGAATAACTTGGTTTTTTTTTCCTTCCCCCTTTTACCTCCAGG
GACTTGACAACTAGAAGTAGAAATGGTAAGTGAGGCTTAAAGTGATTCAAAACAGAACAT
GGAGAAACTGGGCAACCAAAAATATCTTTATGAATCTGTCAAGAGATGAGTTATTTGTAG
TAGGTGCCTTGAAAAAGTAAAAACTTAAGACTTGTTAGATATAAAACCAGATTAACACAG
GAAGCACCAAGAGTACCTAGTTGACTCAGCTTATTTAAAACTTTGACTTACAAGATTAAA
TAAGGATGTGATAAGTATGAGATTGGTTGTACCCTTTTTATCAGATTTTGTATTGTTTGT
AAAAGTAACTCCTGTAAGAAACAATGGTTTTGCTGTTTGGGAAATTTTTATTGTGTTAAA
AGGTAGTTCAGTAGTCTAGGGAACAACCATTTTGCTGATATTACTCAGTAGGGACTCTCT
CTGCTTGATAATTATAATGAAAAAGTGTCTTTGCACTTTGGTTTGGAATGATGCTAATTT
TGTAGTTGGATTCTCATAGGGGAGTTGTCCAATAATCTCAGCCTGTATGATGAAAAGCCA
ATAGACTGACTTAATCATGGAGGTCTAATTAGCTCTACCTGATTTCAGGCATTGAAAATT
ATTACTTTTGATAATTATTACTAGTAGATAGACTTATTTAACCTAAGATGTCTCTTTTAG
GCTTTAGCTGAGATCTTGGAAGTTGTTGCAGTTGGATTATTTTGTAAGTGAATTATTTGA
ATTGCTACCAAGTGCTAGTTCAGGGAGAATAGGTTTTGAATTCAACTTGATAAAGCTGTG
AGTTGCTAAATCACAACACCACTCAGATTTATTTGTAAAACAGGAATTATAGCTACTATT
ACTGGGGATCAGTTGCCATATGAAGAGTGGTTTTTCAGACTAAAGAATATATGTTCACTT
TGGATTTGGCAGTGATCTTTAGAAAAATATTTGTCCATTTTCTAAAGCTACTTAACAGGG
TTTATAATGATGTCCTCAAATGTCTGACCTGAAATCAGCATGTAGATAAATCACAGCACT
GAAGTGCCCTGTAACAAATTGAGCACAACCTTCATTTCTCTGTGACAAAGTTACATTTAA
TGTAAACTGTATCTGTATAGGTTTCCCAAGTCCAGATGCTGTGGTGATCACTTAAATTTG
GGTAAGGAGACTAAATGTTTGTATTGGGAAATGTATCCTGGCAGCTTTTGTTTCTCAATG
GGGGTGGGGCAATCTAGACAGGGTTAACCTATTTGTAAAACAAGTACCTAGTATTTGACA
GGGAGGAAATATTTTTTGCATATGTAAAATTCTTGGTAACTTTCAAGAGGAAGTCCAAGT
GTAACAAGGACCAAAGGCTTAAGATGTATATATGTGTAAGCCAATATGTAAATATTAAAG
GGTTGTATTAAAGGATTGGCTCATGTACTGTTGGTGATGATTTCTATATTAAAACAATGG
GAATCTCTCTGAAAGAGAATGAGGATTTTCTTTTTCTGAAACAGTACAATTTTTTGAAAG
CAGAAAAATGGCCAATCCAGCAAGAAAAGTTAACTCCCCTTTCTTTTTTTTTTTAACCAG
ATTGAAATGCATTGATCTATGAGTTACTGTTGAGTAATGTCATCTATGCTGAGCCAAAGA
CTGAACTGATAAGGTGACTGAACTGATAAGGTGACTATAATTATGTTTGAGAAGTTTGCA
AGCAAAGGGAGTGTCTCAAAGCTGATACAATGATGATAACATAGTTCAGCAGATGTATGG
TGGTGAACAACACTATTCTGTCTTTCGCTCCTATCTGATGTATCTGCTATTGGAGACTCC
AGCACTATTTTTAATATGTAACTGCCAAGTATCTTTTTAAACCCATTTCATCTTAAAAAC
AATATTGTGTACTGTATAAGGGCTGGGCAACAGGTTATACACACCTAGGAAGTATCTGAG
GCCAGATTACAACTTGGGACCTTCCCCTCTCTAGGTCTGTCTCAATCCACTGAGCTACCT
AGCTTCCCCATATTTTAAATTTGAAAGTTTAAAGAGGTTTTTAATTTTGGCAATTGTTTC
TTTGCAGCCTCTGCTAAATATTAGGTTAAAGGTTCTTTTGCTGTTTGTTTTTTTTTTGCT
AACCTTGGCTTTCCCTGATGGTAATATTCTTTCTTTTTTCAGCATAAAATGTCAAAGGGA
TTGGAGAAAAGACCAGTAAGTGAAAGAATTCATTTTAGTTAACCCCTTTTGAACCATTTG
AGTATTTAATTGTAACCAGTGATGTAAAAGATTCTGCCAAATGAGAGGACATGATTTTAC
TCCTAAACCGTTCCATATTTTATACTGAGGTTACATTTGAAAACATGAATACAGTTAAAT
TGCTTGGGATTATAGATAATCCCGTGGGGGCATTACACATAAGGAAAAGAAATGACAAAA
TTTGGGGGTGTTTTGTATGGTCAGGCCATATATCTTAAGTTTTGCTATCCTTTTATAGAT
TGAACAAAAAAAATCTGAGGAACCTGAATACCATGGAAGGTAAGAGACCCAGAATTTGCT
GATATTTTGAGTGGGAATTTCTAACCAGTGATGTTAATGATTCTGCCAAATGAAATGGCA
ATGATTTCACCCATATACCGTTCCACTTTTATTCTGAGGTTATCCTTAAAATGAATGTTG
TTGCAAGCATTCAAAATACTTTGCTAATTTTAGTATTTGCTTCTTCTAGGAATGCTTTTG
ATGAATTGTCAGAAATGAAAGTGCTGGTTTAACATTCCCAGTAAGGTAAGGGGGGAGAAA
CAAAATAAATCCATACCCTGCCCTTAAGAAAATGATGACAATCATCCTTTACTTGAACTC
TCTCACTGATAAAGTGATGAGAAACTTAAGGTCTGATTTTGACAGAATGGGAGGGGGGTT
TCATTGATTTTTTTTTTCCTTTGTAACTAAGGGTAATATTTTGCATTGCAGGTTAGGAAC
TTTGCTGGAATCTGAGAAGCTTGAAACAAATGACCAATATGCTGTTAAGGTGTTCCCAAC
AGAATTTTAATAAAGTGATGTATATTAATCATTGTGATGAGCTATCTTTCAACAAAACTG
AATTTCAGATAGGCCTTATGTTTCCATTATATAAAGCTTACTTAGCTCACTTAGCACCAT
TAAAGGGAATGATGATATGGCATCCCTTCAAAAGATTATGAGGTATATTTTGAAAGAAAG
AATATTTAAATGACATTAGATAACTGAAAATTCATCCTCACTAAACTTAAGTCAATTTGA
GTAACTGGAAAAATTTAACCACAAAACTTTAAATAGGGAAAAGGAGAGTTTTATAGAGGA
TTTTTAAGTTTGCAAACCATTGTATATAAACTCATTTGACAAAAAAATAGTTTGAAAGAA
ATGGCAGGTACATACAGATTCACAAGCTGTAAGCCAATGGCAGTTGAGATCGGTGCCCAG
GTTTTCTTCACTATAGTGTCCATTAGATTAGAAGTTTGCCAATTTTTCCAAGGAAGTTCT
TTGCCATCTGTAACTCAAATATTTTCCACAAAGTGACTAATCTGGGCCTTTAAACTCACC
CTCCCCGTTTCCCATGAATACCATTTTACTAGGTGTCCTTACATTTGGAAGATGAGCTAA
TTCATATGGAACTGGACAACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved