Monodelphis_domestica Locus Poly:8:SNORD12
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:8:SNORD12
Monodelphis_domestica
Poly:8:SNORD12
1
SNORD12, SNORD12, SNORD12
1001..1091, 2796..2887, 3210..3304
4304
CTGGGCCCTGGGGGCCAAGGGCTGGCCGGCCCTGGGACTGCCCCCCTGGCCCCGAGGGC
AGCGCTCGGCCCAGCCCCCGATAATGTGCCCCGGAGCGGGGAAGGGCGGGAAGGAGGGAA
GGAACACCCACTGGCCGGGGCCGTAAGTCGCTTCGGAGTTTGAGAAAGAAAGGCGAGAGC
AACATGGCGGAGACTCGACTCCGGCCGGGCCTAGTGGAGGGGTCAGGCCGGGGCGGGATC
AGGCCTTAGCAACCGACATCAGTCCTTAGCAACCTGCTGCAGGACCTTTTATACCACCCT
GCAGCTTCCTTCAGCCCGAAGACTACACATCCCAGAGAGCCATGCGGGTCCAGGATGTAT
GCAACGCGCAGGCGCCGGGGCATTTTTGTCTTATATAAGGGCGGTCCGCGGCCTTTCTTC
CTTTTTCCTCTCGATTTGCTCCTTAGTTGTAAGGAATCGTCTTCCATCCGGAGTCATCGT
GGCCCCGGAATGCCTTTTGGTGGTGAGTTCAATCTTCCCCTTACTTGTATCTTCCAGGGT
TCGATTACTATATGTCTCGCGCCCCCACCGGCTTGAAGCCCACGTGCCCTTCGCCCAACC
TCCACATTAACACGCCTGGCTCCCCATACCTTCCCAGCCAGGCTTGGGCCCGGCCGCCTC
GTGCTTTGCCCCCCACGCGGCGGTTCTAGGTAGGTTTATGTGGTCCAGCGAGGCGCCAAG
GAAGGCGGGGGTCTTTAGTGGTGACTTGTAAAGATCATAGTTCTTAAGTCCCCGAGTTCT
GAGCTCATTTTGCCCGGCCTCCACTGAGCTTCAGATTTTCTCCCCCCTGAAGACTGAAAA
GGCTTGGATTTCTATCCAGAGCCTCAGTCCTTTTGGGTCATTTTCTCAACCCTTCCTATC
AGTTGTCCCCCAGACTAGATCCCCAGGTAATCAGAAAAGGGCTACAAGCTTTGTAATTTT
TCTTGATTTGGGGGCAAAAGAATAAATTGTTTAAAATAGAGACTGGTGCAAATGATGACT
TGACTTTTTTCCCCATCAGATCGACCTTGCTGATCTCTTTGAATTTTTGCCAGTTTGATT
CTGATGCACCGTACCAGAAAAGTCAGGCCATAACTGAATCGTAACTAAATCAACCCTTCG
ACAGGTGGTTACATTTTGGTTTTTATTTCACAGGACTGCTTCTGGAAGGAGGAGGAAGAC
ACATGGGAATTTTGGAGATGTTGGTGTTTGGGCACCATGACCCCATGCCCATGCTGACTT
CTCTTTTGGTGAGCAATTACTTGTTGCATTTGGAAATTTGTAGATGTAACTATTGAATCA
AAGCCAAGATTACTCTTAAAGTACATGGGTAGTGTCAGTTGACACTTAGTTAGAGTTTAT
GTCCATAATAGTGGTAGTTGGTCAGTGTATACAAGTGCTGGGTCTGCCTTGGGAAGATCT
GGGTTTAAATCCAGCTTCAGATATGTAACTGGGCTTTGCTCACTTTTTCATCTGTAAAAA
TGAGGATAACAGCACCTAGCACCTTCTCTTGAGTTAACTGGTATCAAATGAGATAATTGT
AAAGCACTTGGGACAGAATAAGCATCTTTATAAATCCTTATTCAAATTCTCCCCACCCCC
ATCTTTACTTGTAGTAAAAGACATTTTACACTTGAGGAACTTACAATCTAATAGTGGAGA
CAATATGAGCAAAGAACTATCTGAAGCCAGCTACATAGGAAATAATCAATGTCTACACTG
GGATTAAGAAAGGTGGGGAAAAGCTTCCTATAAAAAGTGGGATTTTACCTGGAACTTCTA
AGGAAGGTATTAGGGAAGCTTGGTGGAGATGAATGGGAGGCAGCCAGTGAAGTGGGCAGT
AAAAAGTAGATGAATTTAATTAAAACTCCTTTAAATGTTTCTCCAAGTGTTCTAGTTATC
CCTGGTAATCAGAAATTAGGAAATTGGGGCTCTGAGAGCTTTGCTAGTTATCTTGAATTC
TCATGAGGGTGTTTGGAAAGTTGTATGTTTTTATTTATTAAACCCTTACCTTCTGTCCTA
GAATCAATACTGTGTTGATTCCAAAGCAGAAGAGTAACAAAGGCTAGGCCGTGCAGGTTA
ATTGACTTGCCCAGAATCATATGGCTACGAAGTTTCTAAGGCCAGATTTGAACTTAGGAT
CTCCCATCTCTATGCCTGGCTCAACCTGAGTGCCCCCAGTTATGATTTTAATTTATTTCT
AGGGTGCCAGAAATAAATCATAATCATGAAGCTTAAGGGATTTACCTAGAACTGCATGCC
CACTAATATCAGCAGACATTCTATAAATGATGTCTTCCCCTAAAGGAAGGTAGTTTTAGA
GGCTGTTTGCAGTACCCCCTTTTTTCATAGCTGTTGGACCTTTCTGTTGCTGGTATATAT
GATGACTAAACTTTTTTCCCCATCTGATCGACTATGTTGATCTGTACTACTACTATGCCA
GTTTTTTCTGATATACCAGCTTTAAAAAAATGCTCTAAGTTGATTGGGTGTCCTGTGTTG
GATTAACTTGCATCTGGATTTATAATTTCTCAGACTTGATAGCCATTCTGGTTATTTGAA
TTGGATCTGAACTGTTGGATTTCCTTGACAGTCCCTCCCAGGATTGGTAAGTAACACCCA
TTCATCTAAAGTGCTACAGTACTTGTGATTACATGACTTGGTATTGCCTCTTGTTATTTA
ATGTTGGGTTTTCAAGGAATGTCAGATACATCTGATTTCTCCTAAGATATCAATTAACAA
GTATTTAAATATGTAATATATGCTAAAGGTTTTAATGCTGGTATGTATGATGACTAAACT
TTTTTCCCCATCAGATCGACCATGTTGATCCTAATTAATCTTTGCCAGTTTTTTTCTGAC
ATACCAGCTTCAAGATAGTTTATTAATAGTTTACTATTTAGTTTTTAAAAATAGCATTCT
CACTCATGGGGACTTATATTTTACAGGCTAGCTCTTAAAATGAGCAGAAGTTAGATTCAA
GTCAAGCCTTACCATACAGACCAGGAGAATGGTATTAAAGGATCCAGCATTCATTAAAAG
GTGAATTTCCTGAAACTCATGTTAATTGCTACAGATGAAACTTGTTACTCCTTGGAATGT
ATAAAGAAAAGTTTTATGTCTAGGAGATGAACTTTTGTGGGCATAAGTGATCACATTTCA
AGATTCCTTTAAAATAAAGTGCCTTCAGGTCTGTGGTTACATGATGACTAAAACTTTTTT
CCCCAACTGATCGACAATGCTGATCAGGAATACATTTAAGCCAAAACTTGTCTGATTTCC
ATCAGATCCTGGAGTAGTTGTATGAATGACTCCACCCCCATATGGTTCTGTGGGGACTGA
CCAATAATACAAGAACCTATTAAATTCTTTACATAAATTAAACTTGTAGCATAATAAAGT
TGGAGCACATAACAGAAAGTTGTATGATTAAGCACTTAAAGGGTTGCTATTAAATGTTTT
TTTCTTTTATAGGATGAATGACTTAAGTGAATTGAAGGAAGTGAAATTTTGAGACTTGAA
AAATCCAAGTGTGGTCTTGAAATGAAGAGACAAACCTGCTTTTGAATATTAAATATGTAC
CTGTCCCAGCTATTTAAAAAAAACAAGTCTTGTTTTACATTTTGCAAATAAATATTTTGG
ACATCTGTCTTTGTTTCAAGATGTTTGTAGGAGAAATTTTAATTTGAGTTTGGGTTTTAA
TCTGGGTTTAAGGGAGATCTGTCTTCAGGAGTTTAGCTAGTTCTTTAGTTTTTTTTAAAA
TATGTGGTCCCCGTAGTATAAGTGCTTCCTCTAATTTCTGTCCCAGTGTGATTTCTTCCT
CCAGAGGTTGCTACTATCTCAGACATTGAACCTTTTCTCCAGTAGACTGCTAGAATAATT
TGGCTCTTTCAAAAAATACCAAGAAGCTTAATTTTTCCGTTCCATCTCCAAATGTGTCAT
CTTTATGGTCTAGTAACCCAGGTTTTGAAGTCAATACTATTTCCTTTCTTCCCTTTATTA
CTTACATTTCTTTTGCAATTCTATTCCTTCCAGAGCTGCTTCAACTGTGCTATTAGAATA
ACCATACTTGGTCAGTAAATTACTTCCAATTAATTGCTGCCAGTGCTTTAATTTGTGTAC
TGAATGTGAACCTCTTCCCAAGAATATAATCAGCACTGCTGTCTTTGTATCCTTAGAATC
TGACATAGTGGCTTGCCTATAATAGCCATTCCTTATTATCCCTTAGGCCCTTTTTCTCTA
AGTAGCTTGGTGGTGCAATACAGGCCTGGGGTCAGGAAGACTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved