Monodelphis_domestica Locus Mono:9:SNORD19
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:9:SNORD19
Monodelphis_domestica
Mono:9:SNORD19
3
SNORD19
1001..1066
2066
ATCTTCTAACTCACTCAATGGCTATGGATTTTTAGATTTCTTGACATTAGGTAGTTTCA
ATGGAGCTCATGGATAGTCTAGTGGTTATCACTCTGCCTTGCCAGAAAAGTGATCAGTCT
CCTTTTCTGATCCTATATTTCTCTATGAATATGCCTTACTCTTGTTTCTCTCACAAAATT
CTTTATTGCTAACATATCATATGATATTCACACAATCACATGCCAACAAATGTATTATTT
GTACTTGAAATCAATTATGTGATTTTTAATAATTATCTATGCTATAGAGTATCATCTTAA
AAAGCTAACTTTTACCTTTTCATACCTTTATCAAGGCTGTCCTATATAAATGTATAGAAT
ACTCTCATAAAATTGTGCAGACATGAGGGAATAAAAAAGATGAAAACAAGTGTACATATA
TACATATGAATTCCTAATAATGAAATTATATATTTTACTCATCACTCACATACAAAAGAA
AATTCTTTCTAGGTAGCATAGTAGAAAGTGGACTAGGCTTAGATGAAAAAAGACTTGCAT
TCAAATCCTGCTCAGATAACTTACTTATCTAGGTAACACTGGGCAAGTTAGCTGCCTCAT
TTGATAAATGAGGGGGTTTGAATGGATAGCCTTAAAGATCCTTTCAAGTTCTAAATCTAT
GATTTTAAGAAGTGATATTTTGATTGCTGGAGGGATTTTTACAGGATTGGAGGTTTAAAA
TAGAACATAATTTGTGATTATGTTAGATTTTCACTATCTAAAATTTATCTTCCTATTTCA
TCATAGGTATTTTATTTGTACTGGAAACTCCTTCATTAGACCTACTGTAACTAGTTACCA
AGAATATCATAACCTTTGAGAGTCCTGGTGTGCCTATACAAATAGTAAGAAAATGTTGTG
AATAATGAATGAGAATTTCCTTAAATTCGCATGCTACTTTGGTAGCTCACTGCCTGATGG
ATTATAAGTATAGCAAATAAACCAAAGTATACCACAGAAATTAGGTATAAAGTAGTAAAT
TCTGATTACCACTGAAGAACTGGAAATTCCAAGCCAGAAAGAATTGAATTGCCTCATTTG
CTTCATCAATGACCTTTCTAATCCAGTTCATGGTCTCTACTAATGCTAAAAGCTAATTGG
ATGATTGCTTGATCAAGTTAAAGAACTTCAGCTGCTTTTTTCACATTGATAAAGAGATCA
CTCCAAATGGGTAAAGTGGCTGCAACAGTGCAATGCTAGTGTAATGAAAAAGAGGGGGAA
AACTGGTTATATCATGTTAACTGTATTTTTAATTCATTTACTTTCATTTTAATTCAAGCC
AAATTTCCTTAATATCCTATCTTCTCCACACATGCTAAATTCTAACTTTTTTCTTGTATC
ACTTTGTAAAGAAATGATACTTACCAGTAATACATTTTTAACAGCTATATCTCATATGAA
AATTTCAGATTTATGGCTGTTTCCTCATCTGTAAAATTATGAGCTTAGTCTATATGATCA
TTAAAGTCTCTTCTATCTCTTAAAATTCTATGGTTCTATGAGCATTCCCAGAATCAAAAA
CTATTAAAAAAATAAAATATCCACAACAATAAAATTGTGATACATCAAAATAAATTTTTT
CAATGTTTTATGTTAAAACACAATTCTTTAACATTGATTCTTTGCTCTAAATGGATATTT
TGATATAGCTATGACAGATATACAAAGAATATTATATTATTCAAAATTTTGATTTAAACA
TGATTTTATAAAAGTTATCATTTTTGTGTAGAAAAGCATATGTTATCAATGCAGATATAA
CTGAACTGTTTTACACAGTACAGGTGAAGGAGGTGGAAATAACTAAATAATGGTATACTC
TTATAATAAAAACTGAAACATAAGAATAAAACCAACATCAATAGATTTAAATTGAATCCA
TTTTTATGGAATCCTTTAACTGAATTGAGATTTCTCTCTCATCTTGTACATCTCTAATAT
TTTATAGTTATACATAGATTGTTTTTATTGCCTATATTGGTAAAATAGGCTAGAGTACCA
ATTTTAGGAATTGATTAAAATATTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved