Monodelphis_domestica Locus Mono:14:SNORA26
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:14:SNORA26
Monodelphis_domestica
Mono:14:SNORA26
5
SNORA26
1001..1121
2121
CCATTTTTCACTCCTCACCGTGAGTACCCCAGAATCCCGTCCCCAGACCCTCGACCCAT
GTCCAGGCCAAAGCCTGATTTTAAGTAGCCGGAGGGTGGACTGGATGCCCTGGGCACGCC
TCTCGGGTTGGTCGCTCTCCCACTGGGACCAGTGAAGGGGGTGGATGGAGGAAGAGAGGC
ACGGACTTTCAGGTCGGGGTCAGGCCTCCCCATTGAACAAGGGCCGCTTCTTGCGCCGCT
TCTCTCTCCGCGGTGCTCCGACTCGCCGCATCCCCTCGAGCTTTGCCCACCTTGAGCTAA
TTGTGCTTCACGTGGCCAGAACAGAGGGGTAAAGCAGTCATCTCTCTAAAACCCGGGGCA
GATAAACTACCCTCTGTTCCGGATCCTGTCGTGAGAGACATTCCCAGCTATTTAGTTACA
CCTCGAGGCCCCCCAAGGGTTCAGCCTCCCGCCTCCCCTGCCTTACTTTGTTCTGCTTTA
ACATGTAACTCTGGAATTTGTCTTTCTAGGTGTTTCGTGGAAGAGCCACCCTGGCTACAT
TGTTGCTGCTTAGAAGATGTGAACTGTTAAAACCCCTTTCCTATAGGAAAAGGCAGGCAC
TGAGAGCTCCTGAGGCTGAGGAAGCCTTTTGAAAATTGAAAGTTAATGTATTATTTTGTA
AAATATCAGGTAGAGTAAGATTTGTCTCCCTACATACTATTAAACTCATGTTGCTATTAT
ATGTATATATTTCCTACAGGGATACATTTGCTGTACTCTCAAAATAAGCTGTTTGTTTTT
TTGCCCTTAGTATGGCAAATGGGTTTTAAAACAGACCCATCTTGGTTTTGATTTAACTTC
CTCTTGTATGTACTAAAACTGTTTTCAGGAATTTTGTGTATAAACCTAAAATATGCCACC
CCTCCCCCAAATCAGAATGGCTAGAGTTGGCTTATTTCCCATTGAAAATTAGGAAATTAA
ATAAAGAGTGAGGGAGTAGTAAATAATAGAGCCCTTTTATGTAGCCTGTTAAAGCTGCAG
TGCTTTAAGAGGCTAACCCAGAATGAAGGGTATAATAATTCTCCATTAAACCCAAATCAG
AGATTTAAAACTCTTTTTTGGATCCTGTCTGGAGTTACAGTTGAACATTGGTGGACTTGA
GGGTTTCTTAATTTTACATACCTTCCAAATTCTTGGAATGCTTTCTTACTCTAAAGCCCA
AATTAAGATGAAAGTTATACAAAGTTTTAGTTATTTAGAAGCTTTAGGCTATTTCTGAAA
AGTATTCCAGTTATATGAAACATTTTCAGTAGGTGAGGACAAATCTAATCAAATGTAGAC
ATATTTTGTAATTGACAATGCACCAACAAGAAGTTGCTTCTACTTTTATGGAAATTAAGC
AAAAGAAAATGCGCTTAAAAATAGAATATTGCACAACTTCTTACCTCAGCATCAACATTA
CTGAATACTCGTTTCTTTTTTTTTTTTGTAGGTAGGAAAAATACAAGCTGGGATGACGTG
ATTCTGAAACACCTCCAAAAACCTTTAATCCACTGCTGTATAATTCACAAGGTGTGACCA
TTAAATAAGACTAGTTTTTATTGTTTGACTTGTGGAACAGAGAAGTGATCCTAGTGGAAT
ATGCTTCACTTTGCAGGAAAAAAAATGATTTCAAGGTCCCTGTATTAGCATTCTTACTTG
TAGAGTATAGAAAAGCATGCTTCCTGTTGGTGTAAAAATGAGTGACCGTTACTTAGAACA
AAGAATTCATATCAAACTTTGTGTAAAGCTAAACAAATCTGCCAGTGAGACACTTGAAAT
GTTAAAAGAAATTTATGGAGATGAAGTAATGTCAAGAGCAAGAGTTTTTGATTGGCACAA
AAGGTTTAAGGAAGGTAGGGATGATGTCCATGATGATGCCCGGAGTGGGCGCCCAATCAC
TCACAGGACCAATGAAAATGTTGAAAAGGTTCGAGATTTGGTTCGTTCAAATAGTCAATT
GACTGTGAGAATGATGGCTGAAAAATTGTCTTTAGATAAAGAGACAGTTAGACTTATTTT
GAAAGAGAATTTGAATATGAGGAAAGTTTCTGGTAAGATTGTGCCTCGAACAGTTTCAGT
AGATGATACTGGTGAGGTCGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved