Monodelphis_domestica Locus Mono:16:SNORA31
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:16:SNORA31
Monodelphis_domestica
Mono:16:SNORA31
7
SNORA31
1001..1127
2127
TGATTTTTTTCTTTTTGTTCAAAGTTTTTCCTAATTTTGTAGCAAAGCTTAGTTTGTAG
ATGCTGAGATTATATTCCCTATGTTCATAGATTTCAAATCATGGTAAAAATTTATCTGAC
AAAAAAATGTTAGATGAACTATGAAATATCTAGTTTTTTAAAAACCTTCTAAGTTCCGTG
TTGGAATCAGTACCAAGTAATGATTCCTAGACAGAAGACTTAAGAACTAAGCACTGGAGT
CCCTTGACCAGGTCACAGCAATAGGAAGTATCTTGAGGTCTGATTTGAACCCAGGATCTC
CTACATTTAGGCCTGGCTCTTTCTTTAAAGTAATTTCCATGTACATGTCTTTTGGGCATG
TACCTTTGTTTAAATTTGCACGGCATAATCAGCTTTAGCTGCGAAAATGTTCTTTTGCAA
AATTAGGTCAATACGTTCTTTGAAGTGTCTTATGTGCAGGGCACCGGCAAGTTTGGGGAG
GAGGATGCAAGGAATTCAGAATCCATCTTTATATTGTAGTTTTGAGAGGGTTACTCTCAT
TAACCTTAGTTTACAGATGAGAAAACTAAGAAATGGAACTTTTTGACATGAACATAGTCT
GGGTATGGCTGATATGTGGCATAGACATGAGAAGTTAATGTAGTAGAGACCTATATTGGT
AATAAGTTTGGAAGAGGTAAAGAGGACTGTGTTGGAGTGGTTGGGAAAGTATCTTAATGT
GACAGGAGATGAAATGTTGGACTTTGATTTAGTTTTATTTTTCAATTAATGTGCATTGTT
TTCCCTCCCTACACTGGGGAGAAAATTCTTGGAACTAGAAATGCAGGGCTCTTAGTTGGT
AGACTTGGGTGAGGGATCAGAAAAGGCCAGTAAACAGTCTAGAGGCTAAAAGTTTGAAAA
CCTTGACTGAAAATGGTAGCAATTGGAAGCCACAGGGGGTAACGCTGATATGTTTTAACA
ATTTGTTCATCAGGAATTAGGTGAGCTTTTGAATCACTTGCATGCATCCACTGATAGACC
TTGAACAAGTTACTGTTGTTCACTGGTTTGCACTAGGGTGCCAAAGAGAAGTCCTCCAGC
TTTCTGTCTGTCTCTGTGGCAGCCCAGATTGAATAGAGGAATACATTTACATGAGAGAAG
TAGGATCTGTAGTGTGTTTAATATTGGGGGAAAGCTTATTAACCCCTCTTCTTTATTGCA
GTAACAAATTCAGCTGATTACTTTGGATCACCTGTCATCATAACTGGCTGCTGCTTTTTG
TCATCTACACAACACCAGGACTTGGACAAATTTGGACTGATATCATCTTGAGCTTTATTC
ATTTATTTTTGACCTGATTTATTTGGAGTGGAGGCATTGTTTTTAAAAACATGTCATGTA
GGTTGTCTAAAATAAAACGCATTTAAACCCACTTGAGAGAATTCCTCTTGGTCTAATGTT
TTTTAAACTCAAATTACAGTAACTTGTACCTCAAGGATCATTGTAGAGATCATTACTGGT
CTTAGGTTACTTTTCAGCATATGACTCTTCAGATAGACTTTTCTACAGTTGACTGCTTTG
TGAAACTGGAATCTAAATTCTGTGTGCTAGTTAAACCTGAGTTGAATAAGGGAAGAGATG
CCCACAAATGTGCCAACAATGCGAAGTGGACCTTTCTACATTTTCATTTCATCTACAAGC
TGAAGTAGAGTTAACTCTGGAAGAGATTACATCCAAACTGAATAAAGTGAAACCATGTAA
AACCATTGGAAGCTGGGTATTGACTGAGCTTATTTATCAACCACCTAAATCCAGGCTGTT
TTACCTTCACGCAGCAGGGAGATCAAATACCCCTGGTATTTAGGAAATAGTAGAAAAGGA
AGATGTCTAGTTTCAGATCATGTAACAGGCAATTGCTGAGAGATTGTAAATATTGAATGT
ATACATATTTTATGCTTAATTTCTCTTAGAAATGAAATCATGAGGGATGATAATATATGG
GGAAAATAGGTTGAATGAAAAGGGGGGTGGAAATGAGCATAATCTCTAGCTGTGTAGGCT
GTTAAACCAGAATTTTTAATAGTGAAAAGTGGAAGTGAAGGGTATTTTTTTTAATGCATG
TTAACTTGAATAGGGAAAAGATCAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved