Monodelphis_domestica Locus Mono:19:SNORD60
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:19:SNORD60
Monodelphis_domestica
Mono:19:SNORD60
6
SNORD60
1001..1083
2083
GTTTTGTAGAGTCAGCCTCGCTGCCAGGCCTCTTGGGAAATTTGGAGAAAGACCGAAAC
TTACCAGTCTTCCCTCTCCCGAACCCAAAAAGTATTTTCACTTTCTTTAGAATTTTTTGT
CTACTCTGCGGGAGGCCTGGTTCGGCGACTTGGGAGATTTAAGATCGTGTACTGATTGAT
TGGGGACCCTGCTCTGATTGGAGATGAGAATTCCTTTCCACCTCCCCTTAAACTTAAGAT
TTGTGGGAACCAACACGTTTTCGTTGCTCGTGAGCAGTTCATGGGGCCTACTTTAAGAAC
CCCTTGTTCCAGACTCGAGAAACTAGGTACAGAGCAGGGACTGGCTTTGGCCTTTGTAAT
CCTAGTGCCTTCGCACAGTACCTGGACCATAGTAGGCTCTTTAGTAAATGTGTATTGACT
GCTAGGACCAGATATCCCTGGGTGCCCAGGTGGGGCAGCTCACTATCTACCTAGTTAGGG
AAATAATTAGTGTGGGCTAGTAATCTTGAGTATGACTTCTTTCTTAGAGAGCTGTTAATA
CTCCGTTTATTTGCTGCCATCTAGTGGGAGAGCTCTGAAGGAAATTTTTGATTAGCTCTA
GGGATATCATTTTTTCTGTTATAAGTTAACAGCTTACCTGATCTCAGCAGGCCTTGGAAG
TTCACAATTACTATTGAAAGTTTTCTCTAAAATAAGCATCTAGCCCTTAGTGAACCCCAC
TTAATTACCTTGGGCCATTTGCCACATCTCTGTAGCCAGTGATGAAATCCACATTTCTGA
CACCTCGTATGAGTATTGCCACTACCAATACTTGATTATGCTTGAGATCTGAGGCTGCAG
TTTTTGTCAATTACTCTGAAATTGCAATTTATTTAGTTTTATTCAGGTGAATTGTAGGTA
ATAACTGCACTGTTTATACTTTCAGGTGTACCCTGTGCTGTGGATGAACTTAGCAACAAA
CAGGTTAGGCTTTTCAATATTTTTATTTTTAAGGAAATCTGAGCCAGTGATGAGACATTT
CCATTTCTGACACCTCGTATGAAATCTGCATGTGCAGTTTGATTATATAGCAACCCTGAG
GCTCAATAAATATTATAATTCATTGGGCATGAATTGAGAACTGGGGGGACAGAAAGTTAT
CAACCTATCAAGTATTGTTCCTTATAAATATGTGGGGTATCTTTTTCATTTTTAGATTCC
ATGAAGATAGCAAGCTACAACAAATTTCTATGCATTTCTATTCTGTGTTGGTAAGTTAAA
GATTTAAGAGCTGGGAAAAGCCTATACTCTTAACACATTTTGGCAGAATGCATATAGGTG
AACTTGTGAAAAGAAGCAATTCCATAGCAGCTGTAAAGGGGCGCCTGCCATAAAAGAGGC
ACTTGTCAGTGATTTGACTCTGAGAAGAGCTAAAATTGGTCAGAAAGAATTAATTTCTGT
CTGGCATCCAACCTGAACCTGTCTTACAACATAAGGAAAAGAGGAGCCAAAGGATGAAGT
TGCAGCCTTTACAGGAATAGCCTCACAAATTGGAATCTGTTCAAATATACTGCCATGGGT
AAATTCCAGGGCTGTTATTAGTTAGCATAAGCAAGGGTGGTGGTCCTTTGGTCTGTTTCT
CTATCCTTTTCCCCATCAATCTATTGCCCTGCATCTTAGTGCAAATTTGTCCAAACTAAT
TACATAGCCCACAATAAGGCAAAGCCTTTTTTGCTAAATTCTCTGTGACTATATGCTTTA
CCACAGGAATGCAGCCTAGAACCAAGAACTTGGCTACCAAATATCTCAAAGCATGTAAAG
GAAAAGCCAGTAATGACAAACCTAGGTTTTCAGCCTATTTTGAAATACTGTCTTTGACTT
GGTTTCCTCAGCTGTAAACTGGAGATAATAGCACCTACCTCTCAGTATTACATGAGATAG
TATTTGTTAAATGTTTAGTATAGTTTCTGGCACAGAATAAGTGCTTAATAAATATATCAT
TTCTATTATATATAGCTAGTTATATACTTACAATGCTTGTTTCCCTATCAATGTTAGGGA
AATTCAGAAAAGTATGAGGGCATCACTCACCTATATACCACCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved