Monodelphis_domestica Locus Mono:5:SNORA71
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:5:SNORA71
Monodelphis_domestica
Mono:5:SNORA71
1
SNORA71
1001..1134
2134
ATATTGGAGCGGTTTGCAATTTCCTTGTCCAGCTTATTTGACAGAGATGGAAACTGAGG
CAAACAAGGTTAAGCGACTTGCCCACAGTCACCCACCTAGTAAATCTCTGAGGCCATTAG
ATGAGTCTTCCTGGTTCCCTTTCCACAAGGTTAGGAGAAAGGAACCTTGCTTCTCCCGGT
TCCGTGCAGCAGAGGGCGCAGTTGCCCACCCACCAGGCCTGCGCCTGCCCAGACTAGGCG
GAAGTGACGCAAAAGGTTTTGCTTTATAAATCCTCTCCCTGGCTTCCTTTCTTCCTTTCG
CAGTTCCGTCATGGAGTCAGCTGCTGCTTTCCACGTTTTGCATGTTCGCCATCCCCTGCC
ATGTGCCCTTCCATGGCGCCCTGGCTCCTGGAGACTTGATTCTACCTGAGTTTCCGCGGC
AGAGGAACAGTGAGAGCTGAGCCAGGCCTGTCTCCCGTGAAATCTGGGTTCCCATAGACC
CCCTCTGCGGGGAGGCGGCCCCTGGACTTCGGGAATCACATACGCGTGGATCGCAGGGTG
CGCTTATGGAACGCGGGTTTTGTGTGATCCTGCGGGAGGGGGGCGGGGTGGAGGCGGACC
GGGTTCTGCGGGCTTCTGAGGGGGAATTGGAGAGATCGGGATAACATCACCGGCCCGAGG
CTTGGGGAAGAGGGATTAGACTAGCCCGTGGCACTGGAGTGCAGTGCGGAGCGTAGTGGA
TGGAAGGAGATGGACCGATCAAGGAAGGACTTTTTAATGTGGGTTCGGCTCCGGGGATGC
AAGTTGTCCAGAGTAAGACGTAAGCCTCAAGAAAACGGCTTGGATAGGAATTGGGAGAGG
ATACCTGGGTTAGAGCGTGGGCTCCCCGCTACTAAGAATGGACATCATGTATGTGTGGGG
TGGCAAAGGTGGGAGCTGTGCTCTTATTAAACCTGTTCTGTGCCGGGAATGGGTCCATCT
GCGTGGGCGAATTCCCTCACTCCGCGCCAGGGACTCCCTGGCCCTGCATTCGAAAGTGAT
CATGGTCTAACTGTGACCTGGTCATTGATAGTGCAGGGAAAGAAACTCCTGAAAGGGTTT
TCCCGTGTTTGAAGGGTCAGCATCCGGCCCTTGCAAACCCTGTACCTTTCACACACTTCT
CCTTCAAAGGCAAAGGCTTGTGAGAGCTCGGAGGGAGGGGATGGAGGAACTGGCTGGGGG
CCATATCTGGTCGCATATTGTTAGGAAAATCAGACTTTTTTGTTTTTCCCTTTATTTTAG
GTGGCCTTTTCAGTCGATTAAGCCCATATTCCCAGAGGCATGGCCTCAGGATGGTACCTT
CACAGGTAAGGTAGTTTCTGCTCATCCTAAAAGTTTGGGTGCTGGAGGAATAAATTGAGT
ATTCTTGAGCCCAAACTTAGGGGCTGGGCATATAGCTGAAATGCATTATGCTATTATAGT
GGAACAAGAGAGTTCAAATGCTGATCTTTGGAGATCCAAGACTGCATTTCTTGATTTGTC
ACTCATTCTGGGAAGGACCATTTATTGAGCACCTACTATATGCCATCTCTAATGGGATAC
TCACAGATTGGTCTTTAGGTGTCTTAAGATTGTTTTTAGTTTTTTCACTCTTTGAAGGAG
CATTTATTAAGAAACTATTACCTTCCAGACCCTGCTAGGTGCTTTAAGGTGTGGCATTTG
CCTTTCACAAGAGCCTTAGTAGCTAGGTGCTATTATGGCCCCCATTAAGTTTAGAATTGA
GGGTCCCAATTTCAAAACCATGGCTTTGTCCCTTGATGTTCCTATGGAATTGTACACTTG
ATTCAAAAGACTTGGGTTTTAGGGGGGTGTTGTTTGCTTTTTATACCTTTACCTTCCGTC
TTAGAATCAATACTGTGTATTGGTTCCAAGGCAGAAGAGTGGTGAGGGCTAGGCAATGTG
TCCTAGGCCAGTTTTGAACCCAGGACCTCCTGTCTCTGGGCCTGGCTCTTCACTACACTG
AGCCACCCAGGTGCTTAATTCTTAAGTTCAGTGCCCAGACAGTGATTTCAGTGAACCTCA
GTTTCCTTTTGTATAAACTGTTAGTGGCATTAGTTCTGTGTTTTCATTGGAAATGCCATC
TACCAATGCAGAATGGCATCTTTTCTGCAACTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved