Monodelphis_domestica Locus Mono:15:SNORD89
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:15:SNORD89
Monodelphis_domestica
Mono:15:SNORD89
7
SNORD89
1001..1116
2116
GGGATATCTGTATCCTTAATTGTACTCTTTCATGCAAAGAAGAAATTTGATAACTAAAG
TCTAAATGCTACCTGAAAATTCTTGCCATAACTTGAAATGAGCAAATTACTAGGACAGGA
AAGTAGATGAACATTATGTCAAAAATTAAACTCGGTTCCAATCCCTCTGCTTCTTATCAA
TTATCATCATGAAAGTCATGAATAGCAGAGATATTAATACGTAACAATATTAATGCTTAT
GGCTTATAACCTTATAAGTTCCTACATGTCTGTTATACTTAATAATCTGAATCGTTTTCC
TCTGTTCCCTTGTCTAGATTATCTGGAATTGTTACAGCTGGAAAATCAGAAGAAATAATT
GAAAAGACAAACTGAAAAATTTGACAGGTAACAACAACTTTTACCTAAGTCCTGCCACTT
CAGGGGTTGTCAAGATTGGAAAAGTTTCCTTAGTTTTTAATATAAATGTAGAGAAATGTA
ACTCATTAGCAATAACTACATTTACATTAATATTGTACTTCAGAGTATTTGACAAATGAA
ATTTTAAATTTGGTCACTGAGCAAATTCAATGCTAACATTTTCAGGCTGAGATATGTCTA
AAAATCATGTTTATTAAATTCATATTGAATCTTATTAGTGTGTAATTAATTTCTGTACCC
TTGAACTACGATTTCCAGCACCCCACTTTCCTGCTCACATTGTGTGCTGACATGGGGAGG
ATATAAGTTTGGTGTATCCCCACCTCTCGCTCTCCTTTTCCTGATGGGCTTTGGTGGAGC
AGACCTTTTCAACAGGCAAGGAGAGCTTGGAAAGTTAGCATTTGTGCAAATGTGTAATTG
ATTTTTTTCTTTTTGAAAAAAATGTGAATCTTTATAAAGACAAAGCAATAATATGAAACT
ATCCCCACATTTTTTTAATAGTAGCCATCTGAAACTGATTACAAATTAGTAGAATCCTCT
TAAGAAATAAAAAATATTTACCCAAAAGACAAATTTCTGTAACTGAGGAATGATGACATT
AAAAGGCCGAATTGCAGTGCCTTCCATAAGCAGTTTGCTCTCTGTATGGAGCACAATGAC
AAAGTCTCCAGAAGCGTACAACTAGTCTGACCTCAGTAACCAATTGCAGGATGTTTATCT
GGGTGAAATATTTTCCTAAACTATGATGTTTGCAGAACTGGTGATTTTTAAAGCTTATTG
ATGTCTGGTTTTTAACTGAACTATGCAATTGGTTTTGCTTACCCTTTATAATAAAATCTA
GTGTTGATAATACTTGCTTAATTTGCAAATAAATAGCTATAATGTCCTAAACCAATCAAA
TTGATAGCTAGTAGGAATAGATCCCAGATTTAGCACTAGCATGTATGAAATAACCATATT
ATTTATATTTAGTCTAATATCCACTCATCCCTCATTTTACAGCTAAGGAATCTGAAGCAC
AAGGTCATGCTGAATTTGAACCCAGCACATTTAACTGTAGATCTCAAATTTTTCCACTGC
CTCACAGGGGAGTAGAAAATAAGCTAATCTAGTGAAATGAGCAGTATTAGGCAACAATTT
GCATCATTACAAGAATATTGTGAAGAAAAATAGCTTCAAAAGACTTATCTTTAATTAGTT
TAGTGATCAATTTTGATTTCATCTGTGAAAGGAGAAAGTTGAACTCAACTGACTTTTTTG
TAAACCTCTTAGAAACAATACTGAATGTAGGCAGGCAATGAGGGATGAATAACTTTCCCA
GGGTCACACGGCTAGGAAGTATCTGAGTTAAAATTTGAAGCCAGGACCTCCCACCTCTAA
GCCTGGCTCTGTATCCATTGAGCCCAGTTGTCCACCTCAGATGAAAGTGACTTGACATAT
TTTATTCATTTTGTATGACTTTTTTTCTTGTCATCAGGGCTGGCTTCTTTGTGTCAATTA
GTGGGTAATTAGAGTAATTGGCATTAATAAAAGATTTTCTTTAAATATACAGAAAAAAAT
CAGAAGAATCTTAAGTTTAATACTTTATTCATTTAAAAAGAATTCTTTTTGACCATTCTT
TTCTTTTTATATTTTGAATTCCAAATTTCCTCCCTCCTACCCACTCCCACACCCACTGAA
AAGGCAAGTAATACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved