Monodelphis_domestica Locus Mono:11:SNORD43
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:11:SNORD43
Monodelphis_domestica
Mono:11:SNORD43
8
SNORD43
1001..1066
2066
GCACTTCGTATATATATTAGATGCTTCTGTAATAAGCGTTTGCAGCATTGAAAATAAAG
AGTTTGATACACACAGTTTCGCCCCAAAACGCGCAAAGCCAAATTTGGCCAGCACGGGTT
TCCGTAGACTATTCTCCTTTGGGTCACGCTTTTCTTCCGCAGCCTCAACCCTTCCGTCTT
TCTGGCGTGCCTTCGTACGTGACGTCACGCTTCAAACTAGAGAGAGCATGCGCAAGGGTA
TACGTGTCTCGCGGGAGCGCGCGCTCGCACGCCGGAAGGGGTGGAGCCTCGAGAGGCTTT
TTATACAGCGGGCCCCGGTTTGACCCCTCTCTTCCTGCTCGCCTCGGAGGCGGTAGCATT
ATGGTGAGTACTGTCTTGGCAGTTTTTCTAAGGAAGGGAAGGGAAAGTATTTCATCTACC
TCTATCGCAGACATCCCGACTCACTAGGTCTCGGAGGTCCCGAAGCTCCCTTCACGAGCG
TTTTTTCTAGGCTTGCTCACCAACTATACAATGGCAGCTTTCCCCGCGCTTCTGTCGGCC
TAGGCCGCTGGACTGCCCCAGACCTGAGGCGCCTCCGCAGCCGGTTGGCCCCCGTGTGCA
CCAACGGGCCCATTTTATATGTTGAAGGGAGGGTTTTCAGAGGGCCGACCAGAAGTGAGA
CCTCGTGGCGGGGGGGATGGTGTGGAGAGCACGTGTAGGCCTATGGTGCCTCAGTGGAAG
CAGAATTGGGAGGCGCACCCGAGGCTTCAGGAAGTAGAACTCCTGCTTAATATTTTTGCC
TGTGCTTTCTTACATTTTCGGCCTGTTTTTCCTTCCTTTAAGGGGAAAAAGCCAACCCTC
TTAAGACAATCGGGTGGCCTGAAGTACAGCTTGAGGGCCCATTTGTCTTGTGGGGGGGTG
GAATTCGTAATAATTAGACTTAAGCGAAAAGGAACGCCACTGAGAGCCCCTAGTTGCCAG
GTTTCTGCCTTGGCCCCTGTTTGTTTACTAAGAAGGCTGGCTACACGTGATGAAATCTAT
GACGGGCGGACAGAGAAAACACGTGCTGAACGTCATATTCTGATGGTAGCCCTGTTGGAC
TTGATGGCAGCCTGTAGAGGAATGGGTAAAAAGCAGTCTAAAAGGCTCTCCCGAAGTATC
TTAACTTGTTCCCTTCTACCTATGGATTGTATCACCCATAACGCCTTGGAAAGCTTTGGT
CTGCCTTTAGTAAGTCCATGGCTACATGTCACCTGGACCCTCTGGAACATGGCTGCAGAG
GGTTGTAATGGTTAAGCAACTATTTGCTGTATGCTACAGGAACCCTCTTAAGAAGATCAC
TGTTTGATCTTTGACCAAAACGAAAAGGCTTTGGATGAAAGACTAAGGAAAGTTTGCTTC
ATGACTTAATTCCCTAAAATCTTGGTGTAATCCAGTATGCATATTCACAGGCCAGGAGAC
TTTTGGGGAGAGTATTGCCATTTTCTTGGGTACAATGTTTAAATTGAGATACCAGAATTC
CTAGTAATATACTTTAATGACTAATTTTTAATTGAGCCAAGCCTTTTTTTTTAACTTAAA
ACTAAAGTGACAGGAGGGGTTAACTTAGAGCATTAATGAGCAGGTGATAGGTTCTTTTTT
CCAGAATGTGCTCCCTATTTCTGCTCTGTACAAGTTGTCTTTTCTCCCTTTAAGAAAAGG
AGTTTTCCTTTGTTCTTTAAAAGCCAACCCAGATGTACTCCCCGGGTAATATCGTTACCA
TCCATCAGCAGTATTTGCTAGACTAAATAATCTGTTCCATACAGTAGTGCTTGTCAAGTC
TATTAGCTAAGGCCAAATCTTTGTTAACTGTTTCCCTCCCCATGGTGTTCTGCTGAAGGA
TGGGTCACATGTTCTTACCTTGATGCCACTTTTCTTCTAGTCTCACCGGAAGTTCTCCGC
TCCCAGGCATGGGTCTCTGGGCTTCTTGCCTCGAAAGCGAAGCAGCAGGCACCGTGGAAA
GGTGAAGAGCTTCCCTAAAGATGATCCCAGCAAGCCTATCCACCTGACAGCCTTTCTGGG
CTATAAGGCAGGCATGACCCACATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved