Monodelphis_domestica Locus Mono:18:SNORA23
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:18:SNORA23
Monodelphis_domestica
Mono:18:SNORA23
6
SNORA23
1001..1183
2183
AACTGCCCCCAAAGTAGTAACGTATAATAGCAATGAGAGTTGAATTATATGGAAAGCTG
AATGCCCATAATGGACATTTTCTAATTTGGTGCTGAAGAAAACTTTTGAGAATTCTTCAG
ATAGTAAGGAGATTAAATCTGTCAATATTTAAAGAAATTAACTGTCTATTGGAAGGACAA
ATACTGAAGCTGAAGGTTAAATACTTCGGTTACATAATGAGAGCAGAGCTCATTGTAAAA
GACTGATGCTGGGAAAGAAAAAAGGTTATGGCAAAGGATAAGATGGATAGATGGTGTCAT
GAAAACAATGAACATGAGCTTAGATAATATAGAAGATAGAAGAATAGATAAAAGAAAGAT
AGAAGGACTTGGCCTACTATGGTTCATGGAATCACAGGGTCTTGGACATGACTGAATGAC
TGAACAACAACAAATACTGACAGAAATAGATTTTGGTATGCTATTTTTCACTTGAACTAT
TGAACTCAGTGGGAATTAGAGAGGGACAGATTGTGAATTTTAGATGGTTTGTATTTGGTT
TCATATCTCAGTATACATATACAAAATCTTTTTATAATTTCATCTAAGGAAAGCCTTAGG
TATATTGATTCTGTTAACAGTAGATAGCAATTTTAAAAGAATACTGATTGATTTATTCAT
CATAAGAAATCTTAACTTCCATGCCCAATAAGTATCTGTGTCCCATTTCCTCAGTATTCA
TGGGACTACACTAAATCAAGTTAGAACTAAGAGATAGAGATGGAGAGAGGAAAAACAAGG
AGTAATGGTGGGGTCTGATTGGTTGGAGAAAATGAACTTTCTGTCCTTGACCCCTAATTG
TCCTTTGATCTCTTTGGGGAAAGATCCTATCACTGATCATCAACATTTATTTAGAAATAG
TTGGGGGGTTCATTCAGTCTAGGGATAGTATGCAAAACTGTTGGGAGTTGTGTAGGTTCT
ACAGTGGAGATAATGACCTATAAGAAAATCTGCCATGGCCGCAGCCTTTGTGTGCATAGC
TTCCATCTGTGTCTGGTAGCATTGTCTGTTTGTGTTTTGCATTCAGATGCTGCTGCCCAC
ATATAATCCTGCAGCCAGAAAGAAAAATGGGATCATAGTACTGGCCTAGTGATGTCTTTT
TGGACAAACCTACCACTGGTCAGCCTCCAAACTCCCAGACATTTAAAAAAAAAAAGAAAG
AAAGAAAATCTTCCATTCACATATAGAAACTATCTTACATTGAATATTCATAAATCAAGC
AGGACTACCAATGTTAATGGGAAAAATCCCATATAGTTTGCCTAATTTATTAGATATTGC
TGTAGAATGAAGAAATTGGATTAATGGATTTAATGTTTTCTTCTAAGAAGATTCTGTAGT
GAAATATGTTAAATTAAACCAGTATTGCAGATAATAATCTAGAAGAGGCTATAATTTAAA
GTAACTAAATCATAATTTCTTATTTCTGGTACACTGGCAAGTAACTAAAGTTTAAAAGTT
TTTCTTTATTCAAGTAGACCATAAACTCCTTCAAGGTGAGAATTATTTTTCAGTTTGTCT
TTATATCTCTGATGTAGAACCCAAGTTTCTTTTTTTGTTGTTTTTATAAACCTTTAGTCT
TGGAATCAATGTTGTGTGTTGGTTCTAAGGCAGAAGAATGGTAAGGGCTAGGCAATGGGG
ATTAAGTGACTTGCCCAGAGTCACACAGCTGTCAAGTGTCTGAGGCCAGATTTGAATGTA
GGACCTCCCATCTCTAGGCCTGGCTCTCAATCCACTGGGCTACCCAGATGCCCCCAGAAC
CCAAGTCTCTTGAAAGAAGTAGGTGCTTGATAAATGCTTGTCAAATGAATTATCAGATTT
AGTATTGTGTATGATATATACATGTATATATATGTAAAAACCCAGCATATTTTATCTCTT
TGACAAATAGTGGTAACACATTCTTAAATACACTTTTACCTGTTTTTTGACTGTCATGAT
TGAATTATGACTCAGTAGCATCAACCAGCAGGTTCAAGCATTGAATATGAAAGTATGGGA
ATAAATAGGCATTGTTATTTAAGTGAGCAAAGAGAAGATCATTTCAGTTTAATTTTTTTT
TTATGTACTGATGGGACTTAGCTAGTGATCACTTATAAGAGTTCTAATTTCTAATGCTAC
CTCATTCTGCAGGTATTTCACTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved