Monodelphis_domestica Locus Mono:21:SNORA42
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:21:SNORA42
Monodelphis_domestica
Mono:21:SNORA42
X
SNORA42
1001..1138
2138
GCCCCGGCCGCCAGCCGCCGGACCCTGCTTCTGCTGCTGCTTTTTCTTGGCATCTCGGG
TTGCTCAGGTAGCGGGCTGGGCAGGGAAGAAAGAGGTGCGACCTCCCTTTTCCTCGGGAT
CGGCAGGGGGGGGGGGGAAGGGAGCGTGCCTGAAGGGTCAGAAACGGCGGGGGGAGCGAG
CAATCGGGCCTGCAAGGCTCCAATGTTTCATAGATATGCCTCCCCTCAGTAAGGACTGTA
CAACCTCTTAGTGCCACGTGACCGCAATTACTACCTCCCATGTTAGCGACGGATGTGGAC
TGGAGGGAGGCGGTGGACCGTAGTCTCGAGAACTTTTAGACCCCTCTCCTCACGAATTGT
TCCCACGTGTGTTGTGCCTGAGTACCCGGCCTCCACCCATACATTGCTTTTCTGGGCCTC
AGATTTCCCTATAAAATGAGAACGTTAGCCTAAATGGCCTCTGAGGTGCCTCTCCGATCA
AATCGGCTCAGGGGTCCTCTATTTAACTTTTATACCTCCCCACTCTGAGCATAGTACCTG
ACTCTTCTCCCTCCTGAAGATCCTCCCTGGGCCCAGGTGTTTTCCCCTCCTCCCCTTAAA
ATGAGAGCTTCCGAGGTCACCTAGGCTTCTTCAGGGGGGCAGCTGGGTAGTTCAGTGGAT
TGAGAGCCAGGCCTAGAGATGGGAGGTCCTAGGTTCAAATCTGGCCTCAGACACTTCCCA
GCTGTGTGAACCCTGGGCAAGTCCCTTGACCCCTATTGCCTAGCCCTTACCACTCTTCTG
CCTTGGAGTCAATACATATTGACTCCAAGCCTGAAGGTAAGGGTTTAAAAAAAAAACAGT
TATCATTCATTCTCCCCCAAATCCACCCTCCAGACCTGATTGCCCAGAAAGCTTCACTAG
ATACTAGTTGTTCCCAGAGTGTATTATGAGCCAGGACTCAGCCTAGCCCCCAAGGCCCAA
TAATCTGGTCTTGACTTGTTTGTTTCATGTTCTGGTAAAGTGCATGGCTTTGGATTTATG
GAAAATCCATTCAAAACTGGGTTTCTCATAGTGTATTCCATGCCAAAGAAATTGACTACC
CCCAACCATTGCCGGGCCTGAATCTGTAGGCTTTAGGCACTGAAGTGGGTAGGACAGGAT
GTTCAAGACCTGGTTGCTAATCAAGGCCTAACCTAAGTGATTCAGGAAACACTTCCCCAT
TTGGACTTTTGTGGGCTTCCCACAGGGTTGTGAATAGAATAGAAAATGGGGCTTCAGCGT
GCATTCAATAATGACAATAACTTTTCTCTATTCCCCTCAAACAGCGGAGCCCTGCACTGA
ACCCATGATTACACCTTCCTACTATACCACATCTGATGCAGTCATTTCCACCGAGACTGT
TTTCATCGTGGAAATCTCTTTGATGTGCAAGAATGGGGCACAGGTGAGAAAGGAACTTCT
AGCAAACTTTTCTGGAATGTGGCAGCAGGAGCCCTTGATCCCTTAACTTTGACAAGAAGC
TTTCTTTCACATGTACCTTTTTTTGTTACCCTTACCTTCTATCTAGATCTAAGGCAGAAG
AATAGTGAAAGCTAGGCAATGAAGTAACTTAGCCAGGGTCACACAGCTAAGAAGTGTCTG
AGGCCCACTCCTGAAGGATTTACAGGGATAGAAATGCAAAAGCAAAACATAGGGCATCAC
ATGTATATATGGGTATGTGCTTGGAGATTTAGGATTTTTAAAAATCTGCTCTATAGTAAA
AATGAGTAATATGGAAAATAGGTATCAAGTGACAACATTTGTACAACCCAGCGCTTGTTG
GCTCTGGGAACAGGGAGGGAAAGAAAATGAGTCATGTAAACCTAGAAACCATATTCTTAA
AAAAATAAAATGAAACAAGGGAAAAAAGGGTCTAAGGCCATATGAACACAGAACCTCCTA
TCTTTACCTAACTGTTGTTCTCTTCTTCCCTCTCCCCCTCCCCCCCACCTTTTTTTTTTT
AATGGCTCAGACTCTAGTGTCGGGCAGTCTTCTGACAACTGTTGGATTTCTTCTTCAAAT
GTTTTTAAATACATAAAACCCCCCTGAGTTACCAAAAAAAATCTTTTTTTTTTCCCCATG
GATCCCTGAACCCTTGCTGGACTCAAGGCAGATAGATCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved