Monodelphis_domestica Locus Mono:23:SNORD88
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:23:SNORD88
Monodelphis_domestica
Mono:23:SNORD88
Un
SNORD88
1001..1091
2091
TGGCCCGCGTCTGGATTCAGCCGCGAGTGTGTCCTAGCTGTGTGACCCTGGGCAAGTCA
CTTCTCCTCTCCGCCTCGGTTACAGCGAGAACCAGGCCTCAGGCTCTTCCTGGTTGGCCA
AGTCACAGTCTCAGTTTCCTCATCTGTCAAATGGGCGGGAGAGGACCGCCGCCCGGGCTA
GGGCCGCAGCACTTCCGGGCTGAGGGTCCAAGGGGTGGGGCCGAGAGGGAGGAGCCCGGG
AGGAGCCCTCCGCCCCCAGCCGCAGGGCTCCGTGGGGCTCGGACTGAAGCCGGGGCCAGC
AGGGGGCGAAGGGCCTGGCCCAGGGGCGCCAGTAGGAAGGGGAGGAGGCCTCCCGCGTCC
CTCAGTGTGGGGGTGGGGGCGGAGGCGCCTCCCGCCGTCCCGGCCGCCTTTTAGGGGCGG
CCCCTGCTCCAAGCCGAGTCCCGCTTTTCGGAAGGACAGCGCAGCGGCGGGCCGGAGCGT
CCCTCCAGGCGCAGTCCGCACCCGCTCCGGGCGGACCGGGGAAGTCAGGGGCTGGACTCT
GGGCACCCGCCCACCAGCTGCAGGCTCCGCCTCCCCCTGTCAATCACCCCGCCCCGCCCC
TTCCGCGCCAGCCCGGAAGCTGAGGCACACCGTCAGTTCGCGCCGTGCGCTGGCTCGGGA
CGGCACGGCTTGGTTCGGCTCCGCAAGGGCGCGGACTGATGGCTTCCACGTGGACTCGGC
TCGTGGGTCCCGCGCGCCCCACGGAGGGGAGCGGGTGGGCTACGCAGCCACGGGGAGTCG
AGGACACGTGAGTGGCTCGTGGGGGCTCCGCGGCGGCAGCACGTAAGTGCGGGGTGCCGG
GAGGGCAGAGCACGTGGCGGGACCTTGCCTCATCCTCCCCCCCCATTTGATTTGTACAAT
GGGCGCAGTGACTCTTTCTTTCTCCCGGCAAGAGCAACGGGCAGGCTGCCCGCGTGAACC
AAAGGCCCGGAGGTGGGGACTTGGGATGGGGCAGCCGGGTAGGGCTCCCATGATGCCAGC
ACTGGGCTCTGAGCCTCTGAGGACAAACACGGTGCCCCCCAGGCCTTTGACTCCTGGGGG
TCTGAGGAGCCCTGGCCCCGGGGGAGGTTCTCCCAGAACCCCCTGGCAGGGTGTGGGGCT
CTCAGCTCTGACCTGCTTCCCTCCCCGGCAGAGGATGACTGGCCAGAGAGCACGGAAGAG
CAGCTGCAGGAGCTGAGCTGAGCGAGCCGAGGCTGGGCCTCCGTTTCCCTCTCGGTACAA
TGGGAAGCCTGGCCCTGAGGGGCCTCCTGTGACAGGTATGGGGGGGGCACAGCCCATGAT
GCCAGCACCGGCTCTGAACCCCACCCCCCCCCCGACCACGTGCCCCCTGGCTCCTCTCCC
AACGCTGTCCTTCTCCTTACAGGTGCTGCCGCTCCCCCGGGCTTGGGTGCGAGGACTTCC
CGGCCGGGCCAGGTACTTAGCAGTCGTGCATTTCTGCCCGCCCTCCCCAGCCCCGATGAT
GGCAGCACTGGGCTCTGAGCGCTGTGAAGACGTCGGTGCCCCCTGGGCCTTTGACTCCCA
GGGGTCTGAGGGGCTGCCCGGCGGGGGGCTGGGGGGCGCCTTCCCCCCGGGCCTTCTTCA
GCCTTTTTTGTCCTCCGCAGGCCCGGAAGCTCGGAGAGGAAGATGGGAAGTCCCCGGCGC
TGGAGAAGACCTTCAGAGCCCCCCCCCCCCCCATGGGAGACCCCAAGGGTCCGCCCTGCT
GAAATAAACCGTTTGAGAAAGCTCTGGCCTGCCTTGGCGTCACTCGCACTCGCGCCTGGG
AGGGAAGGGCCGGGGTGGGAGCCGGAGGCTGCTTTCGGCTGCCTCCTGGTGGCCGGGTCG
GGTCCCTGCCTTTCGGGGGGGCTTCCCGGCGGGCGGGGGGCCGGGAGGGCGCCGCAGCTC
GGGCCTCCGTGGGGCCGCCTTTCCCCGGGCCTGGTCGGCAGAGGGCGGCATGATTCCACT
GTTGCTAGGGGAGCCGGCCGGGGCCGAGAGGCCAGGCCCCGCCATCGGCTTCGGGAAGGA
GAAGCCGGCGGCGGCCATTGTGGGCTTGGAGTCATGAGTCAATTGGGCTCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved