Monodelphis_domestica Locus Mono:1:SNORA19
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Mono:1:SNORA19
Monodelphis_domestica
Mono:1:SNORA19
2
SNORA19
1001..1128
2128
CCCAGCATGAGAGAGAGTTGAGCATATTGGTAGGTAGTGGAGAATGTTAATAAATAGAG
AGAGGCTGAAGATTTGAGAAAGACTGGGGGTCAATCAATTAGAAGAGATTCTACCTGCTA
TGTACCTGAGGGTACATTCCCTAGCTGTTGCTGAAAAATGTACAGACTTGGTCATCCCTA
CATAAAATCAAATACTCTCCCACCCTCTCTCATCTGCCCAGTATTTCTGAATTTAACAGT
TTTTCTCCTTCTTTTCCATAGCTAAAATTCTTTTTATAAGAAAGAAAAGTAATAAGCTGT
CCACCTTTCAGCTAAGTTAATTTCAAAGCAATCTGTTTTCCAGGAAGAGTGCCAAAAACT
GATTTCCTAGCATTTAATGTTGGATTTAAAGAACATATGCACATGCCTGTGCACATATGA
ACACATGCACACACATGTGCATGAGACAGAACAATATCATTTAAAAGCCAAGTGACCAAA
ATAAGTCACTCCTTATGTTCTCTTTCTAGTCATTTCCAAAAGGCAGAAAAAAAAGAATGT
GAAAAATTTAGGCACTAAACTCTATATGCAACTCTATGTACCTTCTATGTGCAACTATGT
TGTATCATGTGTTCTCCTACTTCAGAAGATGATGACAAGCCTCTTTGAAAGGATGAATTC
TAGGCTTTTCAGTGAATCTTTACTTTCTGTCCAAAACTGCACAATGGGGATATTTGTTAG
GTGTCTGAACAGAGCCATAAATACAGTGATATGTGAGTCATTTGGGACCTGAATAATTTT
GATCCTCTCATTTTGTTACACATGTTATGGTCATACATGTGTGCTTCTATTAATTTAAGG
CCAACTCAGAATATCTAATCTTAACCAGATGAAAACAGTTTTCCCCACCTTTTAGTTAAT
TCAAAGTTGGTTGTGTTGGAGTGATGCTATACACTTGCGATAAAGTTGTTGCTGTCTTTT
ATTGTTTTTAATTCTGTGGTTTTTAAGAATGAATTGTACTTGTGCACATTTCATTGACCT
GCTTTCATTGTTCAAGGGATGAGTGTTAATTTTTGATGTGCTATATAATTTATACATGGT
TAATTAGCAGCAGAACTTGATATAATGCTGCTAGTTCTTTCAAACAAACGCAGTACCTAG
AAGTAGGGGAAAAAAACAAAAAAAACATTTCTTATCCCAGTTTTTTCTAAAACCGGTGAA
AATGCAACTATAAAAGTTTCTTCTGTTAAGGTTTTGTGGAAGCAAAATGAAAAAAAAAAG
AATGAATTTTACTCAAGAAAGGAAATGTTCAAAATCTATATCTCTAGGACATTTAAAGAT
ATTGCAGTAATTATTGGTCTGTGGAAGTTAAACATTTCAAGGATCATTCAAACTGAAAAC
AGTATTAGTTTCACTAACACACAAACTAAGATAAAAAATGAAAAAGAACACTAAGAACTT
ATATACCTTTGCTTTGAAATAGCCTAATTAATCCTCAGAACTACAACAACAAAAGACCTT
CAGAGGGTCCTGACATCTAGAGGGGTTAATAATACTCCTCTTAAGCTAAAAGAACAGCAA
AAACATCAGCATAGTTCCAGAGTATCTGAAAATTTATAAGCTCTTGCTAATTCCAGTAGA
CCATGCAGAAGATTGGAGGGAGTCCTAGTCACGTGTGACATAGAAGCTTGCAATGGAAGC
TCAAATTGGTAATTGAAGCAGTATAAGAGATGGACATGGACCTTTTAGTTTGATTTTATT
CTTTGAGTGCTGCCAGCATGCTGTGGGGAGGAGCCCAAAGAAGGACCCCTCTCCCTGTGT
TTCTATGTGGGTCGGTGAGGACGAGGAAGGGAGGGATTGATGACCTGACCAGCCTCCCAC
TCCCACCCCAGACCTCTGCAACTCTTCTTCCTTCCTAAACTCTTTCTCTGTCCCCTCCCA
AAATGGTGTGGAGAGGGTGGTAGCTAATTTGGGTCATCTTGGGCATATTTTTTGGGTAGC
CAGATAGGATTCAAGTAATGGCAGCAGAAAGAGAAATTCTTTCCCTCTCCCAATATCATG
ATGATTCCTCCCACCAGCTGCTAAAATCAGGTAATTATTCAGGAAATTTTGTGACAGGGA
CCCCTTTACCTCACTTTAGGTTCTTTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved