Monodelphis_domestica Locus Poly:9:SNORA40
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:9:SNORA40
Monodelphis_domestica
Poly:9:SNORA40
4
SNORA40, SNORA8, SNORA32, SNORA25
1001..1129, 2726..2862, 4536..4657, 4925..5058
6058
GACTGATTGGATCATGTGCTCTTGGGGTCCAAGTTTTTTACTGATACTGTTCACAAAAA
CATGTTTAACTACTTGGAAGAAATAGCCTAATTTTGCTTATTGCCTAACTTTTTTTTTGT
GAAGGACAATAGTTGTTTCATAATAAGTACTGAATTGCCCGAGAAGACAAAGTCAAAGAT
GAAAAAGACTGCTAAAGACTAGACATAACACTCATAACTACAAGAGAGATGAAACATTTG
CCTAGGATAAAGAAAAATTCCATGGACAAAGGGAAGAGAAATGGTAAGAAATGATAGTTT
TATTTTTATTATGCTAGGTAAAAATATATTATAGAACATGCCATCAAATGTCTACATTTC
TGGGGTTGTGGATAAAATTTCTTAATGGTATGCCAGAAGTCGTTAAGTTTGTCTCTTGTA
AGTAGTACAAGATGACTAGAGAACTACAAATAGTGTCAGCATAAAAATGTGGTGGCAGAA
AGAGTAGGAACAACTTATTTAAACTGGATTTTGCACAGCAGCATGAAAGATAGTATCTGG
GGATGGCAGCTGCTTCTTAGAAAACATTTCCTACTAGATTCCAATACCATGGGCATTATA
CCCAATTCCCACTTTTTGATATGGAGACATAAGAAAAGAACAAGGTACTAAGTGGTAGCT
TGGTATAGGAAATAGAGCTGACCTGAGAGTCAGGTTTTGAGTTCTGCCATATCCTAACTT
TCACTTTAGGCAAGTTACCTTAATTTGTTACTATCCATAGTCCTCTAAAACTACAAATCT
TATATTCAGGCAAGGGAAGAGCTTTATGCACACCCCCACCCGCCCCTAATCACAGGTCCA
GTATAAAATTCCATGTGCAATATTTCACTATTTTTTACTAGTACAAATTGAAGAGCAAGA
ACAATGTATTAGAATGGATTAAAGAGGTTAAAAAAATAACCAGTGATTATTTTAAATTTT
AATCTCTAGTTCCAAGTGGTAAATGCCATGTTATATATCACTGCACTTCATTTAGCTTTG
TTTTTGAATTGTAGACAAAGACTTAAAGACAAGTGCAAAGAACAAACCCTCTTTTGCAAC
CCACAACCCATGGTTTTGTATGAGTTGTGATACATACAAGAAGGGACAATTCATAACTGC
TAATAGTGTAAAATGAGTCCTGAAATGGAATGTAAGTTGAACCCTTCCATTTAGAGTGCT
TTGGTTTTGGATTAAAAGAAAAAGTGAAATTAAAAATCAAAAAAGTTGTAAAACTGGCTA
CAAATGCTTTACCATTCCTAAATACCTTGAAAGTTGAAATCTTTTACCTTCCCTCCCATC
TTTTTTCCCCCCTTAGGAATTTGCATCGAGGAAATTAATGATTAGTGCTATAGGAGAATT
TTTTGGATATTAAATTTCTCATCTTGTACAGTAAGTAAAATGTGGTAAAAGTTCTCATGA
TAGATCAAATTTTTCAGATTTTCATGTTTAATTCTGATCTGTCAGAAAGATCCTGATATC
TGGGTTTGTTTTTTGTTTTGTTTTAGGTTTTTTGGTTATCTGATTTTGAGGTCTATCCTG
ATGGGTCCTTTTCAGTAGGTCCTTATCCTTGGAAACGCCTCAGAAAGCAAATGTGTAGTT
ACGCTTTACCCATTGATCTCCATACCAGGTCTATGGGGATAAAACTACAAAACAATTTTA
GTTTGAAGCAATGTGTTCTTTAAATATGTTGTGTTAGCTTACTAACATAAATTCTATTTT
TAGGTGAAGCCTATTTGCTGGTTTAGTTAACTCTTCGTTGGATATTTTTAGAATGGTAAG
CTTAATCATTAGTCTCAGCATTAATCTGCTTATATACATAGTTCAAATGATGAATTCTTT
TGTTCAACTGCTAAGTGATAGAAACATGAACTGAAATGAATTCTGATAGAACCGACTTAA
GCTATATGACCCCAAAATGTTCTTACTGAATCTTCAGACCATATGGGATTTTGGCTCTAA
CAAATTTTAATTTGCTCTCTTTTAGTTTGTTTACCAAGGAGAATTCACAGGATGTGCCCT
CTGAACAACATGAAATTGGTTTTGAACTAGACATTGAATATTTAAGGATTATTTCTGACT
TTAAGACCTTTTCAATAGAGCCTGTTAAAAATTCAGGTCTGTAATCTCATACCTGTCCTA
AAGTTTTCCTTTCTCTCCCCTTCCCCCAGTCTTTTTATTGTATTCTATTTGGCTCACTAT
TCTAGGCTTTTAATGTTGACTTCTAGTATATTGTCTTGTTTTTTTTGTTTGGGCAAGATG
GCGGTCTACATTTTATTACACCATCGATTAAAAAACTCAATCAGCTAGCATGTGACCAAT
CCTTAGATATCTGAGGTGATTTCTGGAAAATTTCCTGGTTTTATGTATGGGGAAATAATA
GAAGTTTTTTGTTCTGTTTTTTTGAACCCTTAATTTCTGTCTTAGAATCAATACTATGTA
TTGGCTCTGAGGCAAAATAGCATTTAAAGGCTAGGCAGTGGAGGGTTAGTGACTTGCCCA
GGGTCACCCAGCTCAGTGTCTTGCTTGATTTGAACCCAGAACCTCCTGTCTATAAGCCTA
TATCCACTGAACCACTCATCTGCCCCAAAGATGGAGCTCTTGAAGAGATTCCAATAGGCA
TGGTACATTTAGGGGAGGTGTGGTTGGCATGGGGTTTGTATTAAAACTAAGTATGTAGCT
TTAATATCTGTCCATGTTTTCAAGACTGCACTGTATGGTATCTGCATCCAGCAATATTAT
TGTTGGGGTGTTCAAAAGACAGTGCTATAGAAATTCAGTATCTGGCATCGTTGGTTTCAT
GCTTGTCATGCATGTTCAGCCTGGTATTTCTATTGATACAGGCCATTTTAAAAGGTACCT
TTGGCTTATTTGTTAACATTATACTATTGAATTGATCCATAAGTATAGATGTTTTCTTTA
GGAAAGGGACCTGAAAGCCCGTTTGAATGGGAGATTCGAAATTACATCATTTATGGTAAG
TAGATTTTCCTGTGGTTACGATTTTTCAAAATTGATAGAATTCCTTATCTGATGTTCCTA
ATGGAATGCCATATTTCTAATGATCATGAGCACACTTGGAAGTTTGTGTTCAGAATATAA
TGTGGCTATAATAAAAGACAGGTTTTGCTTCCATCACTAAAGTTTTGTTAGTGGTGACAA
TGAGACCTGTAACAATCTGCAGTCTAAAGTTCCACTTAAGTATAGTTTAACTTTGTTTCA
TTATGAAAAACTGTTACCTTAATATTATATTTCTGCTAAATGTCACTATTAAATATTCCA
GGGGGGATGTTAACTGCCCATAATAGGCTTGTTATCTGTCTTGGGGTGCAGCTGAAAAAA
CTTATCCACATGTACTATATTTGTGCTGTGTGTATACATAAACACATGCCTCTTAAGAGA
TGAGTGACTTCTGAACTTAAAATTTTTAGGAAAATCAAAATTGGATAACACAGCGGGCCA
GCATTATAAGTAAGTATTTTTTCGGTTCAAAGCATTGACCGATCACATCCCCTCAATACT
TTTTGTAAACTTAGTGTCTTCTCTAGATTATGGATTTTGTGAATATTTACAGGTTGTTTG
ATCTTTGTCCCAGTGTGTGCTAACAAAATGCTAGTTGCATAACTATCTTGATGAAGGCCC
TCTGTGTGGTCTACATCTGTAAGATTATAAAAGTCACTCAATTTCATTTAATAACAATTT
AGGGTTGTCTGGGAGAGGCAAATGAAATGTTATTGGTTGGATTTATTTAAGTTTGCAATT
CTAAAATTATCTAATTGAATTTGGTTTGGGATTGTAGGAGCTGTGGGAAAGGGATTATAT
ATTCAGTAGTTTGCATGAGCTGAGTGAAAACCTGTTGAAATGGATATCATCTAAAGAAGT
TATTTTTACAAGCCTATCATTTTGATCCTTCTGAAACTTCGGATTGTATTCAATCCGGAA
CATTAAAGATGTAGTGATGATTGGCAAAATGTTCAACTGCTCTGAAAAGGTGAATGAAAA
CTGCCTTTCTGAACATCCTAGTTTCTTTGTGGTGAATATCCCAATCAAAAGAAAATTAAA
CAAAGGTTAAAATTGAGCTAGCTCATAAGTAATGCATGATCTGTTTAGTGATTAGACTGA
ATTCAGGGCAGTTTATACATAAAATTGAGTAAATAGGTCCCCCTTATCTGACTAGTGGAG
GTTGCCTACAAAGTACTGGAAGTCTCCCTATAGTTTGCCCCCATATTGCTTCTACTTAAA
CTTTTCTTGAGGTTTCTTTTTATTTTGGTGGGGTGGTCATGAGCAAGGAGAGAGAACTGT
ATACTGAGGGTCATCAAATGTTTGCCATTATATCCCAGGTCTGTGTGGATCTTAGAACAT
ATTCCCCATGGTATATTTCAGATTTTCTTGCTTTATTTTCCTATAGGTATTCATCAATCA
CAAAGTGGGAGCAAAATGGCCTAACCAACAGGTGAAATAATCAGGTAACCTTACTGATAG
CATATTACTTTCCTATTGATGGAAGCTGTTGCTGTCTGGTCATTACCAAGGCTTTTAGAA
TGCAGTTTCTGATTGCTGTGGACATGACCATAAAAAAAATTATATCCAACAGGTTTATAT
TTGCTATCTTACTAGCATCTAACCTGTTGGGAACAGTTTAGAGACCTGGGCCCTACTTGT
GTTGAATAGCAAATCAAGATTTACTAAATACCCACTTCATACCAAGCAAAGGCAAGTGCC
TTTTAGCTAAATAGAGATAGGAGCAAGCAATATATAGGATTGTAGTTATGATGCTCTAAT
GGTCTTATTTTCTGACAATTTTAGATCAGTCTGACAGATATGCCGAGCTGTGTCATAATT
TAAACAAGCTAAGGTTTCAAGATGAGTAGGTAAGGTCAATCTTTCTTAAACTGTTTATTT
TTACCAGGTCATTTCAAAGAGGGCTTGCATGGCTATAAAACCAGAAGCTCTTAACGCTGT
GACCTAAGAGGAAAAGTCTCTATAGGATGCCATGATTAATTGATATATTATCATGGTCTC
TTACTAATGAGATACAAGTATACTATGATTAAGTAATAGACCCAAGGAAAGCAACTTCTT
CCTTATCAGGTTTATGTAGTTATGTTGTTAGTGATGTGATTATCATTTTATTAAATGGTC
AACAAGGCCAGAATCATCCCAATTCTTAAGTTATGTAATGCTTTTCTGTTTTTAAGAGAT
GGAGAAAGACAAGACAAGCAGGAAAAGGAAGAGCCATCAGAAGAACAGAGCTGTCATTCT
AAAGTATAGTGCCATCCACATAACAACTTTGCTTGGAGAAGCAATTTTTTAAAATATATT
TTGTGATGGACTTGTTTAAAATTTCAATAAAAATATTTTTTGGCATCTTTTTTATAATGG
ATCCTTTTTAAAAATCATCATGGATTCATAAGTTATAGGCCTAAATAGGTATGAAGATCA
AGTAAACTGAGATCATGGGAACAGTAAAAAAAATTAGTTTTAGCCACCTGATATAAGGAT
GTTTATGTAGGTGGAGAGAATATTCCAAGCAGCTGTTGTGATCATTGTTTTTATGGCAAA
AGGACAAGTTCAAAACAGCCTGTGGTACTAGGTTATGCAGCACTCCTGGTTTGGCTACAT
CAGATGTGCCTCATTGGGTCAGACAAGCCATGGGTTACTTCATGGGAGAAGACCTTTACA
ACATCTACAAGTCCCCAAGAGAAATGAAAGATGGGAGGATATTAAATTTTACTTGGGACA
AAAAGAACTGATGCTGAAGGGTTCTTGAATATCTAGATCTGTCACAGGAACCAAATCTTT
GTATCTGCAGGACCTTGTCCATTTTACATTCTACTCCAATTTCAAACTTTAGTCTATACT
GGGCCTGTTAACTGCTTGACACCAACAAAACTGAATTCATTGTCTTTCTTAAAACTTGCC
TCTTTTGAAATTTTACCTCTTTCAAGGAGACTGGTATTCATAGTCATTTTAAGGTTATTA
ACCTTGGTATCGTTCTCAACTTGATTTGAGTTGAGTTGCCAGGTGTTTCTTCTATCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved