Monodelphis_domestica Locus Poly:6:SNORD49
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Poly:6:SNORD49
Monodelphis_domestica
Poly:6:SNORD49
2
SNORD49, SNORD65, SNORD49, SNORD65
1001..1074, 1931..1998, 2498..2571, 2772..2844
3844
TCCTTGCCTCTCTTCTTCCTACCTTCCTAATCTATAAAATGGACCCAGCTCAGAGCATC
TTTGCAGCTAGGAGGAGAAAACCAGGAACTCCTGCCCTGCCCCGCCTCCTTTCCCCCGTC
CCACGCGGCTGGGGGAGGGACGGCGTGCTGGGCTTCTTAGTCTCTTTCAAAGGCCGGACG
ATTCCATTTCAGTGGGCTCCTCCTATTCCCCCCCTCATTTCCCGAGAATGGTACGTCCCA
GCACGTTAAGAGCGGCAGTCGCCGCACACTCGTTCTTTCTGCCTTCGGAGCCGACATGAT
TCAGGATACAATTATGTCGTGCGGGCGGGCCCGGCCGGTTCAGCTTTGGCTTCCGACCCG
GGGCAGCGAAGGATGAGAAGCCGCCGCGGCAGGTACGCATTTTGGCTCGAGTGATAGAAG
TGAGTTCGGAATGGGGGTGGAGAGGTAAGGGATAAGGAAGTCAGAACCTCCCGCGATGTC
CGCTGAAGATAACTGCGCCTGCGCTGAACGCACCTCAGCCCCTACGTTGGTGTGCTGTGC
CTCACTGCGCGTGCGCGGCATCTCATCGGACTCCGGTGCAACCACGTGGGGCCTGTTCTG
GGGATTCTTTTTCCTAGACGGCCCTGGGTCGCCGGCAGTCATGGAAAGGCCGAAGGATTT
TAGAGTGTGGGGGGCTGGGTTTGAGGTTGTTTCTGTTTAATTATTTTTTAAAAACCTTTG
TTTCCTATCGTGCAAGTGGAAGAGGTGTAAAGGCTAGGCAGTTCGGGTTAAGTGACTTGC
CTGGGGTTTTGAGGCTAGATTTGATCCCAGAACCTCCCTTCTCTAGACTTCCCTGCCCCC
CGCAGTTGATTTACGGTGGGGTGGTGACCTCCGAGGTCACGTGCTCAAACCTGGGATTAC
GGGGAGCAGTGACGGGGATCACCCTGTCTGCCCACTCATTCTTCTCCGCCTCCCAAAGAC
CACCCCCGGAGTGCCTCCTTAGGCCGTCTCCTGGGCTGCTGTGGCGTGATGAGAACCCAG
AATAGGAAGTGCCGTCAGACCGACAACTGACGATAGCCTGAGCTGGTGTCTGACCCGCAG
CCCGCCCTGCCCCAGCCCCAGCCCCCAGCCCAGCCCCAGCCCCGCACCTCGACGCCATGT
TTCTTTGCAGGGCAGCAGCTGGACATGAAATCCGACTGGGCGAGACCCATAGAGAATCTG
GAGAGTCTGCCATTGGGCTGCACGAGAGAGCAGGTGAGGACGGGCCGGGGCGCGAGGGGC
CTCCTTCCTAAAGGGGTGACTGGCTCTGGCCAGAGCAAGCCCTGAGCTTAGGGCCCGGCG
TTGGCCTCCTGTTAATAATGAGCTGGCCAATAAGCAGAACCAGGAGAACGTGGTACACAG
TCACCGAAGCATGGCGGGACTCTCACCTGTGATACTTTGCTACTAGCAGGATGCGGTGAT
CCGGGACAATCCTGAGGGGCTCTTGAGAAAGAAATGCAGAAGAAAACGGGGTTGATTGGG
GTGCAGGATTTGGGGTTTGGGTTTTAAAGGTGACTCTTATAAAAATGTTTCTATGGAAAC
CGGTATTGAGTGATAATGTGTAGCCCAGTGGACTTGCTTGTCAGCTTCTGGGGGGGGCAA
AAAAGAAAAAAGAGCCTGACCTAATTAGGCAGCCTCCTAATCTGTTAAACACTAACTGGA
GGGCATAGTGTGCCTGGGATAGCCAAGGCCTCCAGGGAGGCAGCTGGGTGGCTCAGTGGA
TTGAGAGTCCTGAATTCAAATCCCTCAACCATGTGACCTTGGATAAATCGCCTAACCCCT
GTTGCCCAGCCCTTGCTGCTCTTAATCCTTGGAAGCAATAGGCAGTATTGACTCTTAAGA
CAAGATAAGGGCTCTTGGTTCCCTTAAAGAAATAATGCTACGGGAGGCCATCTAGCTAAG
GCTTTTTTGTGATGAAACAAAACCGAAACAGCTGGAATTACCGGCAGATTGTCAGTGGTG
ACAAGGTTTTATTCTGATTCAGCTTGGAATTGACCCCAGTGTCTCTTTGCACATGAACTA
CATAGTAATCTTTTATTATTGTTTCCTCCCCAGGAAGATGTGCTGCTCAGGACTTGGTAA
GTACTTTTATGCTGATGTTCTTGCACACTCCTTTTTTTGCTTTTTTACACCCTCACCTTC
CCTCTTGGAGTCAGTACTGTGTATTGGCTCCAAGGCAGAAGAGTGTTAACTAGGCAATGG
GGTTAAGTGACTTGCCCAGGGTCACACAGCTGGGAAGTGTCACATTTGAACCCAGGACCT
CCCATCTCTAGGCCTGACTCTCCATCCACTGAGCTACCCAGCTGTCCCCACAATCCTCAT
TTTTAAAATTGGCAACAATCTCCAATCCTCTTGTTGAGCTTCAGAACCTGTTGCCAGGCA
GTGAAGAGTAATCTGGTTAAGTCTTTATGAAGGGGGTTCAGCCCCTCCCCGCAGCGGTAA
CCCTGCAGGCCTCTGCAAGGGAGGGGGGTGTTTTGGCTGTTCATGATGATACCACTCAAT
AGGAAGTGCCGTCAGATGCGATAACTGACGATGAACTTGATCATGTCTGACAGCAGCCGC
CGGCCGGGCTTCAGGAGGCCACTGGCTTGCCCGTGCTTGTGCTTGATGTCCGCTTTCTTG
TGACTTCTATTCTCTTCACCCCCAGCAATGAAGAGCCCAAGTGACGGAGATGAGACGCAG
AGCAGGACCGCAGCCCGCCGCAGGTAAGACTTGGAAGAGTGCAGGCGAGGTATAAGCTGA
TATGGAGATACTAAATGATGAGATTCACCCAAACAGCTGGAATTACCGGCAGATTGTTCA
GTGGTGAGCCCGCGGTTTTCTGATTCTATCTCCAGTCATGAATGAGGCTGCTCCTGGGGG
AGGCAGTGAAGCTGATGTTGTTCTTCCCTTTAGGCTGTTGGAGGAAGTCCGGATGGGATC
CTGGAAGACCTGGCTTGGAGCTGCAAAGTCACTGCATTTCCCGTTGGCTTCCTGGAGCAG
AGCTGTTGGCCCATACGCTGTTCTGTAAATCTTCTGCCCAAAGGCTTCCTGGCTGAGTAA
AAGCTCCCCTTGTATTGCCATGAGAGGCCCTTGGTATCCCCCCGGGCTCTGAGGAAAGGC
CCAACATGCCCACGGCATTTAGAGGTCCAGCTCCTCCCACTTCTCAGATCTCAGTGATTG
TAATCCTTTGTCTGGAAGGAGAAAGGGAGAAGAGCTGAGCTCTTCTCTTGTCATGGTGTC
GAATTTGACCAAGGGAGAAAAGGGGAAGTGAGTGCAGTTCCCCTTGCAGCCTCCTCCCAG
TTATGGCTACCGGCCCGAGCTGCCCTTGAGTTCCTTCTAATTCTCTCCCACAGCTAGAAC
GGTTGCCCCACTTGCACTGGATTCGATTGGGAGAAACCCGGCAAACTTTATTCTGGGTGA
TCCATCAGGAATGACAGGGGAAGGGGTCCCTAACTGGCTCCCCCTCAAGTTGGGGGAGCC
AGGCCTGGGCAGCTTTGGGCCCCGAGAGATTCCAGTTTGAAGGACCTGTCTTGGGCCCAA
CCGAGCCCAGTGCAGAGGCGGCACTGGGAGCTGCGAGGTGGTTCTGTTAGGCAATCAGGC
CTCCTGGGGCCCCTCAGCCTGTCCCCTTCCACAGGGTCCCCTGCTGCAGCCGCCTCCTGG
GGTGTGCCGGCAAGGGCGGGGCGGCTTTTTGAAAGCTTCTGAGCAGCTGAATGAACCCTG
CCAGTGTCAGCGTTGGTGCTAATTGGATTTCTTATCTGGGTGCCCGGTGTAGCAACTTCT
TGTAAGCCAATTTAATTAAAATCTTCACAAAACATGTTTGTTGTCAAGTAATTATGCGCT
CACAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved