Microcebus_murinus Locus EEF2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus EEF2
Microcebus_murinus
EEF2
GeneScaffold_3366
SNORD37
4328..4392
11829
CCAGAGAGCTAGGATTACAGGCGTGAGCCACCGCGCCCGGCCTACTATTATTATTTTTG
AGACAGAGTCTCACTCTGTTGCCCGGGTAGAGTCCCATGGCATCAGCCTAGCTCACAGCA
ACCTCAAACTCCTGGGCTCAAGCGATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTA
CAGGCATGCGCCAACATGCCCGGCTAATTTTTTCTCTATATATTAGTTGACCAATTAATT
TATTTCAATTTATAGTAGAGATGGGGGTCTTGCTCTTGCTTAGGCTGGTCTTGAACTCCT
GACCTTGAGCCATCCGCCAGCCTCGGCCTCCCAGAGTGCCAGGATTACAGGTGTGAGCCA
CCACGCCCAGTCTAACGCCTTTTTAAAATATATATTTTCAATCATTATGAGCACATAATG
ATTGTATGATACCTGTTTTTTAAAAAACCTTTTTATGTGAAACGACAGTAGGCAAGGAGT
TGCAAAACGGTAGGTAGAGGTCGTGAGTGTACTTTCTCTCTGCTGCTCCCGGGGGGCGTC
ATCTCACAGAACAATGCCAGAACCGGGTACCTGACATTCGGAAGGGTATAAAGACTCTAT
TCACTTTGTATTATGCTTTTAACAGAAGTGCTTGGCATTTTCCAAGCTAATACAGTTAAT
GTGATTATTGTTCTCAGCTAAAACAAGCCTCTCGGATTTGTGCACGTGAACAGCGCGCAC
CATTTGGGGACCACCACTGCCCGCGGGGACGCTAACCCCGAAACTTATTGCAACCAGGCT
GGCACCCAATGGGTTAACAGGGAGACGCGCCTCCGTGCGCCTGCGCGGAACGTCTCTGTG
CTCCGCCCCCGCAACGCGGTCATATGATCCGCCCAACCGGCGTTCGCCTATAAAGGGCTG
AGTGTTGACGTCAGCGTTCTCTTCCGCCGTCGTCGCCGCCATCCTCGGCGCGGCTCGCCT
CACTTGGTTCTACCCGGGAGAATCCACCGCCATCCGCCACCATGGGGAGCAGCCCTGTTC
AACTCGTGCTCCTGGGACGGCGATGCGACTTCCGTGGGTCGGCGAGGCCCAGCCTGAAGA
AGCTGGTGTCACTCTGCATATGAAGTAGAGAGACATGTCGTGACGACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCGGGGCCGGGAGCGCTTATGAGTCTTCGT
TGTAAGTCCATTAAGGAGATAAAAGATGAGCATACCGCGGCACCGGGATCAAAGGAACTG
AGTGTCTCTAATATATAAAATGGATCATTTGCTTAACTGTTAATATCAAGCAATTGTGAC
CTATATCTATCACAGCAGGTTGGTATATATTAGAGAAGACGATTGATGGGTATCTTGTGC
ACATTCGTCACTGTGTGTAAGAACAAAATAGGATGGCATAATAGATTTCGGGTGGGATGC
GTTGAGAGTGACAGATACTGTAATGGCGTGGTCCGCTGTGGAAGCGGGGTGGCGCCATTA
CATAAACCTCGGGCCACGAATTGGAGGTCGACCTGCAGTCAGGGGCCGTGGGCAGCGGGG
AAATGGCAAAACCTGCGAAGCGACTTGTAGAAAAGTCCCCTCTTAGACCCCGAAAACGTT
CCCCTGCTGTCGTGGAGCCTTGCCCTGGGCCCTGGACCTTCCTGTGACTCCCGAGTGCGA
GAAGCTGCTTTCTGTGGGCTCGTGCCTGGTGGCGTCGCTTGCGCTCCCCTGGGCTGGGTG
GGCTCTCGACCTCCCAGGCAGAGGGTCACCTTGTGTTCCAGAGACTTGCTGGTTGAAGGA
AGCCAGCGTGGCCCGGTGGCAACGTGGATGGAGTTTTAGGGGAAGCTGCATCCATTCCTC
ATTTAATACCTGGCATTTCCCGATGCCCTGTTTGGTGTCGAGGGAATTTGTTGCCGCTTC
TGGAGACCTTTCAGTTCTCAGGGTTGTCAGTTCTGAATGACAGCTGGAATCAGTGGTTCC
TCGGAGCTTGAGGGAGTGGCTTTGAAGAGGTGTCTGAGACGATCGGCCCGGTGTGTTTAG
GGACAGCATAGCACCAGCCCCTTCCAGGGATTTGACCTGGGAGCTTAGTATCGACCGGAT
GTTCTGTGCCAAGCCTGGTTCCTGGAATTCCAGGCTGGTCTGAGCCAACCCCTCTCCCCC
AGGTGAACTTCACGGTAGACCAGATCCGGGCCATCATGGACAAGAAGGCCAACATCCGGA
ACATGTCTGTCATTGCCCACGTGGACCATGGCAAGTCCACGCTGACAGACTCCCTGGTGT
GCAAGGCGGGCATCATTGCCTCGGCCCGGGCCGGGGAGACTCGCTTCACTGACACCCGGA
AGGACGAGCAGGAGCGTTGCATCACCATCAAGTCAACGTGAGTTGCCAGGGTGCCCTCTG
GACCTGGGTGGGAGGTGCCTGCCTGGCAGCTGGAGGCCTCGGGGGCCCCAGTGAGTGGGG
CAGCACTGTGAGTACCATCACTGTCCTCCTGAAACCTTCCCGTGAATCATGGGTTGGCCT
AGAGCTGGTATGTTAAACTAGGGGAGAGGATGAGGGTGGTTAGCTAGACAGGTGGGGAGA
GGCACAGGGGTGGGTGGGCATTGGGAGCTGGGGGTCCTTGAGGAGGACTCTCAATCCTGG
GGTTCTCTCTGCTTCGACTGTGCTTCCTGTCCAAAGGGACACTAGGTAGTGTCTGGAGAC
TTTGTGTTGTCACTCATGGGGGTGGAGGGTGTAGCTGGCATCTAGGGGCTGCTGAAAAGC
AGTTGTGTTTGCTCAGGGTAGTCTCTTGTGACAGTTTTGTCTCCGAAGTGATATAGGGCA
AGTGACTCACTGGTATCTATCATTAGTTGGTAATATTGGGAGGTTTCACTGGTTAATCTC
AGCTGGGGCTGAGGAGAGAGAAAGAAAGGGCAAAAGTGTTCTTTGGGCTCTCAGTTTGCT
TTGTCATGCAACTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAC
TGACTTTATCAGCAGAGGCAAGGATGGCTCTGGCTTCCTCATCAACTCATTGACTCTCCT
GGGCACGTGGACTTCTCCTCAGAGGGTGACAGCCGCCCTCCGAGTCACGACGGCGCCTTG
GTGGGTGGTGGACTGTGTGTCCGGTAAGTAGCAGGTCACCTGAGGCAGGGCCTGGAACCC
TGGGGCACTGTACCTTCCCTACCTCTGGGTGACAGGCCGTCCCGCCCCCGCCCACCCCCA
GGCGTGTGCGTGCAGACAGAGACGGTGCTGCGGCAGGCCATTGCCGAGCGCATCAAGCCC
GTGCTGATGATGAATAAGATGGACCGGGCCCTGCTCGAGCTGCAGCTGGAGCCCGAGGAG
CTCTACCAGACCTTCCAGCGCATCGTGGAGAACGTGAACGTCATCATCTCCACCTACGGC
GAGGGCGAGAGCGGCCCCATGGGCAACATCATGGTATGTCCCTTATGCTCCCGGCGAAAG
TGTGCCCAACAAGCTGAAGGGCTTTCACCTGGCCCGGGAGCCATCCTGGGAGGCTCAAGG
CTGGACGCATGCTCACCCCAGAAATGGTGGGGTGGCACAGAAAGGGGTGGGGTGTTTTCC
CATCTGACTGATCTGGCCCTTGGGCCCGTGGCTGGGGAGCGGTGCCTCCTGCTTGCGCAG
GGCTGGCCCCACGTGATGACTGACATTTCTTCACTTTGACCTGATGTCTACTGAAGAAAT
TGAGCGTCTGAGGCCTGCGGGTCCCAGTGGGGTGACAGCTGCAGGTCTGCCCGGGGTCCC
GTTCAGGCTGCTCACCTCTTGCTTTCCCAGATCGACCCTGTCCTGGGCACTGTGGGTTTC
GGTCTGGCCTGCACGGCTGGGCCTTCACCCTGAAGCAGTTTGCGGAGATGTATGTGGCCA
AGTTTGCAGCCAAGGGCGAGGGCCAGCTTGGGCCTGCTGAGCGGGCCAGGAAAGTCGAAG
ACATGATGAAGAAGCTGTGGGGTGGGGTGGGTGGGGTGGGGTGGGCAGGGGATCCAGGAA
CACTCCTGTGGGGATGGGGTGGTGCTCAGGATGTAGCTCAAGCTCACCAGACCCCCTGGT
GGAGTCTTGCCCAAGCTCTTGCCCTTGACCTTGGTCACTGCCACCCCTAACCTGGATGAC
TTGGGCCGTCTTCCTCTGTCAGGTACTTTGACCCAGCCAATGGCAAATTTAGCAAGTCAG
CCACCAACGCCGATGGGAAGAAGCTGCCCCGGACGTTCTGCCAGCTCATCCTAGACCCCA
TCTTTAAGGTGAGGAGCTAGAGCCCAGTTGAGTCCTGACTGGCACCCTGGGTCTGTTGGT
GGTGATGGGAGCATCCTCCTTGCACCCAGAGGCCCTGACAGGTCACCTGACCTGCTTGTG
GTCAGGGGCAGGAGAGCGAGCAGGCACTTTGAGGTTCAGGTTGCACCTGTACAGGCTAGT
GTCAAGGTTTCTAGACTGAGCGTGGTAGGGAGAGCTCTCTGCTAGGCTGGGGTTAGAAGC
GAGGGGCAGGTGGAGCTTTGACCAAGAGTCTGTTAAATTCTTGTGAATTTAGAATTTTTT
CACTTATAAGTCAGATTGAGTTTTTTCCCTTTGAATAATTTATCACGAGGCTTTTTTGGA
TTTGCTCAGTGGGGTCACGCCCTTGGTAAGTAGGTCAGGCTCTGTGCGGGCTGGCTGCTG
TGCCGCACCTGTCCCTAAGGCCTCAGAGCAGAGGCAGCGGCGGCTTCCTACCTCTTCCCA
CACAAGTTGTCTTGTCCCCTAATCTCTAATTTAGGTGTTTGACGCGATCATGAATTTCAA
GAAAGAGGAGACAGCAAAACTGATTGAAAAACTAGACATCAAGCTGGACAGCGAGGACAA
GGACAAAGAAGGCAAACCTCTCCTGAAGGTGCGTGGGGGCGGCTGGCCCAGTCCTCTGTG
GACTAAATGGGCTTTCGTGTTGCCATTGTTATGGTCGTCAGAGCCCTCCCTGGTCCTGGG
GGCTGAGGTCTCCAACTGGGGGGATGACTGTCACCCTTTCTCCCTTGGGACCTCTGGTTC
TGGGCGAGTGGCCATTGAGGTTTCACAGCAGCCAGCTACCTCTGGGACAGTTGTAGGCAG
TGCCTTGACCCCCTTCTGGAAGGGGACACGGTTTTTACAAGAACGTGGTTCCTAACAGTT
GGCTGTCTCAGGTCCCCAAGGAAGGACGGGTGAGCATATGATCACCCTGGGGTACCCCAA
GCTCCTGTGCAAGCCCCTCTCCCTCTGTCCCCAGGCTGTGATGCGCCGCTGGCTGCCCGC
CGGGGATGCCCTGCTGCAGATGATCACCATCCACCTGCCCTCCCCAGTGACAGCCCAGAA
GTACCGCTGTGAGCTGCTGTATGAGGGGCCCCCGGACGACGAGGCTGCCATGGGTACGTG
GGCAGGGACTGTCTGAGCGTTGGGCGCGTCTCTGGGCAGAAGGCCTTCGTCCAGAGCAGG
GTTTTGGAAGGATGACCTGCAGGGCCTTAAAGTTGTCCCTGCTGGGATGTTTTTCTTCTT
AGGCATTAAAAGCTGTGACCCCAAAGGCCCCCTCATGATGTACATTTCCAAAATGGTGCC
AACCTCCGACAAAGGTCGGTTCTACGCCTTCGGACGTGTCTTCTCGGGGCTGGTGTCCAC
CGGCCTGAAGGTCAGGATCATGGGGCCCAACTACACCCCCGGGAAGAAGGAGGACCTCTA
CCTGAAGCCCATCCAGAGGTGAGCGGTTGGGCAAAACCCGCGCTGCTTCCTCCGTTGCTC
AGGAGGTGGCCGCAGACGTGCGGAGAAGTAGCGTCAAACCCATTCCGGCCTCATTATTTT
GTCAGCATGGCCCAGTGAGCATGACGAAAGATTCTGGGCATTTAGGTGATTGCAGGAAGC
AGGGGCTGCATGGTGAAGGCCAGCTCAGAGTGCGTTGCAAATGTCCTTGGGCTCCAGGGT
TGTGGCAACAGTCTTGTTCCATGCTTGGAGCAGACAGTGACCCCAAAGATGGACCATTAA
CGGCAGTCGCCACCCCGCAGTCACGGGCTTGCGGTTGCTACAGCTCCTCAGGAGCCTGAC
CTGTGCTGGGAGCAGGTGGGCGCCCACGTGCCTTGTGTCTGCTCTCCTGCTCTCGGTTCT
GTTGTATGCACACTGGTGGCACCTGCAGGGGGTGTGGCATCAAACGGGCCAGAATTCCAT
GGAGTTATCTGGGGTGAGTGTGGAGTGCAGCCAGGGCTTGTGGCCCCAGGCAGGGGCATC
ACCATACTTCAGACAGGAGTGCCACCAGCTCTGGAAAGGCCTTGTTTCCTGGGATTTGAC
CAAGCCTTGCTGCCAGCCCCTTGACTCCTGCTGCTCTCCGCAGAACAATCCTGATGATGG
GCCGCTACGTGGAGCCTATCGAGGACGTGCCTTGCGGGAACATCGTGGGTCTGGTAGGTG
TCGACCAGTTCCTGGTGAAGACGGGCACCATCACCACCTTCGAGCACGCCCACAACATGA
GGGTGATGAAATTCAGCGTCAGCCCTGTCGTCAGGGTCGCCGTGGAGGCCAAGAACCCAG
CTGACCTGCCCAAGCTGGTGGAGGGGCTGAAGCGGCTGGCCAAGTCGGACCCTATGGTGC
AGGTGGGCACTCGGGCACGGATGCCACCTGCAAGGGGAGGGTTTGCTCTGTCTGGCCTGA
GGTGCAGCCAAGTTGGTTGCCACGGTTTTGAGATTTGAGTGATTCAAAAATAGGGTCTCT
GGTTTTTGGGGGATCCACATCTGCCCATGTAGAGCTGTTGCCCATTAAGTGGTGATTTCC
TGCCCAGGTAGCCATCGCCCACGCTTTTAGGCTACTGAGATTTCTGTAGGTTATTGTGGG
CAGTTGGTCTTAAAATTTTTTTCACGTTAGTTGTGCCAGGATCCAGCAGCAGGGCTGGCG
GGGCGGGGCCTCTTGCTGCCTTTGGTGGTCCCCGGTCTTGGGGAAGCCCAGCTGCTCCCA
CCAACTGGAGGGGACATAGAGCCTGCATTCTGCCCGTCTGTCAAATTTACCATCCCCACA
CTGTCCCCGGGCGTGGGGTGCTGCCTGCCAGTGCCCTGGGCTGACGCTTGCCCTTGCAGT
GCATCATCGAGGAGTCTGGCGAGCACATCATCGCGGGGGCCGGCGAGCTGCACCTGGAGA
TCTGTCTGAAGGACCTGGAGGAGGACCACGCCTGCATCCCCATCAAGGTGAGCTGTGGTG
GTGCGCGCCCGCCACTCGCAGAGCTGAGCACGTGGCGCCGACAGAATGGCTCAGTGTCCA
CCTGGCCTCCTCAGGCCACCGCGTGCTCTGGGCTCCTCCCGGGGCTGAGCTCAGCTCCGC
ACAGGCCACAGCCAGTGCCGGGCTGCGTCATGGGCCTTACTGGCCGCCAGGCCTCTTCAG
TCTAGTCATTACTTCTGGTCTCCTCCCGATGTGGGAATGGGGCTCTGTCTGGTTGTGAGT
GAGCTGCGTGGCAGCTTTTTCTGCTGTCAAGCGTAAGGAAACATGATCACGAGCAACAGG
CTCAGGCCAGGCTTGCTTGCACAACCTCACTTTCCAACTGATGCTGCTTCTGTCCCGGTC
CTGCTGGCAGCAGGTGGGGCTCAGTGTAGCCCATGCCCTGTACTCGCACCAGGAGTAAAA
TTGTTCTATATTCATTCTGATTGAACGTGCCACTGGCAGGCCGTGTCAGCTCTGCCTGGC
TGGGAAAGCTTTGAGAATGCCTCTCGGTGGACGTGGCCTCTGCCTCTGAGACTATGTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGCTTCGATGTCACGA
TGTGACGTTGCACGCTGATGCCATCCACCGTGGGGGTGGCCAGATCATCCCCACAGCGCG
GCGCTGCCTGTATGCCAGCGTGCTGACCGCCCAGCCTCGCCTCATGGAGCCCATCTACCT
GGTGGAGATCCAGGTGAGCCGTGCTTCCTGTCCCTGACCTGGCATCGTCCCCTGCCCAGT
GGCTGCTGAATGGCTTTCTCTCCCTTTCCTGGCAGTGTCCAGAGCAAGTGGTTGGAGGTA
TCTACGGTGTCCTGAACAGGAAGCGGGGCCATGTTTTTGAGGAGTCCCAGGTGGCTGGCA
CCCCCATGTTTGTTGTCAAGGCCTACCTACCCGTCAACGAGTCCTTTGGTAAGTGCCAGC
CCAGTGTGGCTGTGGCCGGGCCAGAGGGAAGGAAACCTGGTTCCTGGGCTCATCAGGGTG
TGTCCCCCGCCTGGGCCTGATGGGAGCAGTGACGGAGTCTGCCTTCTCCACCTGGGGTAG
CCCAGTCCTGACCCTGTGTGGACCAAGTCATTGATCATATCGAGGCAGGTTCTGTTACCC
AACTATGAGGAAAAGGGTTTTGGGTGTGTCTCAGGGATGGCTCGGCCGTGGTTGGAAGAG
CAGCCGGGCTGTAGCTCAGGTGGTCCTGGAAGGGAGCAGGTGGCAGCCATGGGCAGGACT
TAGAACGTTCTTAGAATGAACAGGCCTGCACTGAGGTGCAGGGCACCAGGCTGGACGTCT
GGCCTGAGGGGCTGCTGTTGTCCCAGCCGCCTTCCTATGCTCGTGTGCCGTGGGGCCCAG
GAGTTTTCCTGCATTCCCAGCAGGACCTGCCTCTCCTGGGCAGCCCAGCAACCCTGTCCC
TGCTCTGTTCCCAAAGGCTTCACCGCCGACTTGAGGTCCAACACGGGCGGCCAGGCCTTC
CCCCAGTGCGTGTTCGACCACTGGCAGATCCTGCCCGGAGACCCCTTCGACAACACCAGC
CGCCCCAGCCAGGTGGTGGCGGAGACCCGCAAGCGCAAAGGCCTGAAGGAAGGCATTCCA
GCCCTGGACAACTTCCTGGACAAATTGTAGGCGGCCCTGGCCGCAGCGCCCGCCACCCCG
GATAGGACGGGCACGGCACCCACACCCAGTTCGACCACAGCAGCACGTCCTTGCATTATC
AGACGACACCTCAGACTGTCCCGACACAGTGATGCTCCACCTGAGAGGTTCCGGGGCCAC
TTCGTGCCATCGCTCAACCTTAACACTTGATGCCGTTTCTTTCGATATTTATTTTCAGGT
CGCAGAAATGCCCTCTTTGCAGGGACTGATTTGGCCGGTGGGGGAGGGGGAGGCGGGGTG
GGACACCCAAGTAAGTTTTTTTTCCATTTCTTCAGAGGGAAACTCAGATGTCCAAAAAAT
TTTCAAATGAACGCATTAAGAGGTTTATTTGGGTAAATGGCCCGTGGTGGCTTTTTCCTC
TAGAAGGGAAAGGAACAAGCGGGTAGGTAATAACTAGAAGGCAGGAAGTCCTGTGCGGTG
TGATCATGAGCACGTCCAACTGTATTAGTGCCATTGGAATAATAAATTTGATATGGTGGT
GACTTCATTCTGCATCCTTGTGGCCTTTTTGCAGGGGAGCAGGGCTGCCGTGTCCCAGCA
CCAGGGCCATTCGTTGGTGCTGTGCCACTACCAAAGGTCACCTTGGCCTATAAGGGGTGC
TCAGATGCTTGAGACCTGGGCCCTGCTTCAGGAGGGGACTGTCCAGGCCCGCTGTTGTGG
GTGGTAGGTGCTGCTCAGTGCAACTTTGTAAGATGGTGGGGGTGTAACTGCTGTGGATGT
GAAATAGCACTGCCCCAAGGAACTGAAATTTAAAATGTCATCTAATTGCAGTGCACTCTG
GTCTGCTTGGCTTGGGGCTACTGGACGCTGCTGGCTTAGACTGTCCTCTGAATTGCTGGT
GTGCTCACTTCCTGTCCTGTGATCAAAGCTTCCTGTGAGCCCATTTGTGGTGGTTTGGTT
TTTGGGGAGACAAGGTCTTGCTCTGTAAACCAGTGTAGAGTGCAGTGGCGTCAGCCTAGC
TCACAGCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2222..2436, 3616..3656, 3662..3705, 3708..3744, 3746..3765, 3768..3783, 3785..3802, 3901..4112, 4470..4493, 4496..4642, 4823..4927, 5434..5547, 5914..6052, 6182..6377, 7003..7261, 7739..7846, 8887..9240, 9731..9775, 9778..9912, 9995..10127, 10636..10829
1001..1003, 2222..2436, 3616..3656, 3662..3705, 3708..3744, 3746..3765, 3768..3783, 3785..3802, 3901..4112, 4470..4493, 4496..4642, 4823..4927, 5434..5547, 5914..6052, 6182..6377, 7003..7261, 7739..7846, 8887..9240, 9731..9775, 9778..9912, 9995..10127, 10636..10826
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved