Microcebus_murinus Locus ENSMICG00000004658
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000004658
Microcebus_murinus
ENSMICG00000004658
GeneScaffold_3970
SNORA70
2868..3002
4443
CACAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGGAGGCGCGACATCGTGGGT
CTCCGGGGAACGGCGCAAGGCTCAGACCAAGGCTTGCTCCAGCCTTTTCAGTCAGGGGAA
AGCGGAGACGGTCTCCCGCTAAGGGCTCCCGGTTGATAAAGGAACGCAGACCCAGGCCAC
AGCATGGCGCTTCTCTGCTTGGCCCTGGAACCCAGAGAGAGGCACGGAGCGCGTGTCCAG
GGCGCCCAAACTTGGAAAAACTCGCGCGGTCGCTGCGAGGCCACCGGGGTGGACATTCCT
TCTTTCCACTGTTGGAACATGCGTCTATTATAGTTACAGAAAAGCCTAGGGCAAGAGTTC
TATGTCCAGGATGGACAGCCAGAAGCGGGCTTCTAGCACTCACGTGGCAATGCCAGATTC
GTCACCAGGTCGCGGACGCCCATCCACCTCTCTGCTCTGCGCATGTGCTGGGTTTAGCCC
GCGCGCAGACGCAGAACGCCGCTGCGTCTATGGTAGGGATCTATGACAGAGCGTCCACCT
ACCCTCGTCCAGACTCTATGGTTACTACGCGGGAAGATAGGCCGAGTATATAAGACTTGC
GCAGACGTGGGAGCGCCTCTTTTCCTTCGGCGCGGTGAGTAAGTGCGGTATTGAGTTGTT
TTGGCGCCCTTGCTGGGTCTCACTCTGGCTTAAGGCCTGTTCTGGTGTGGTGTTCCGACT
TTTTGTATTTCGTTGCAGCCACCGAAGATCCTGGTATCGCCATGGGCCGTCGCCCCGCCC
GGTGGTGAGTGCCGAATCTGTACTTTTGCACTGCTGGGGAAGGGGAGGGAGAACTGCCCT
TGGTCGCTAAAAACGACTGTCGTGTGGAGCCTCCCTCGTTTGGCGGTCTTGTCTGGGGAA
CTGATCCCATGTTTTCCCTTAATACCTTCCAGGTCGCTTTCAGTTTTTGTTTATACTATC
TGTTCTTTTTCTTCAAAAGTTTATGCCACTCTATAGCGCTTCACCCCTTTTGTTGCTGGG
GTGGCGGATTGACCCTGGACTACATGTACTGCGCCTGTGTCGTGTTGGAAGCGACGTCTG
CCGTGTATCTCACCTCTGTCCTGCAAATTTGCCGAATTTTCCAGCTTGATGCCCTTTAGG
GCCTTTGTGTGCGATCCCTGCCTTATTTCCGGGCGACGTGCCGCGTGTGGACTCAGAAGG
CAGTCGAGGCGGGGGGAGGGGGGGAATTGGGCGCAGCCACCACGCGTGCCCTGCAGGGGG
CGCCGGGTGCCCTTCTCGTGCCTCAGGCACATTTAGTGCCACGTGACCTTTAGTAGGGTC
AGCTGAACTGTATAACTGTCATGCGGTGAATGTTTTTTAACTGGGAGAGCTTTTCAAAGT
GTTGGCTTTATAGGAACTTTAAAACTAGGGGTAATGGAAAGCATTGGTGCTATTGTTTCT
CGTGTGGGTGTCGTCTGTCATAGCCACCTGTTCTGACCGTGTGTTGCTTTATGGCCAATT
TCTGCAAATGGAGACAACTTAGACGTTGATATGTATTCCTGACCCCCTTTCTAGCCTTAA
CTTTGGTTGTTCCTTGAGGCAGGCAATCAAAGTGCCTATTGAGTTTGCTTGTGAAAACCA
CCTAACATGGGTTTTCCTCTCTTCTGCAGTTACCGGTATTGTAAGAATAAGCCATACCCA
AAGTCTCGTTTCTGCCGAGGCGTCCCAGGTAAGTAGTGAAAGAGCTTCCAAGCTGCTTTG
GCTTGCTGACTGAGCTGCCACCCCACACACTTAACCTGAGTGTTTTTCAGATGCTAAGAT
TCGCATCTTTGACCTGGGGCGGAAGAAGGCAAAAGTGGATGAGTTTCCGCTCTGTGGCCA
CATGGTGTCAGATGAATATGAGCAGCTCTCCTCTGAAGGTGATGCGGGACTCTTCTTAAT
CATTCCCAGTCCTTCCTATGTCCTCAGTCAGCCCAACCCCAAATACTGCACTCATGAATT
AGCAGTCATGAAGTGTAGGCCGTTTTACAGAACTCACTAGGCCAACACATTTCCTCTGAG
GGCCGGGGGAGGTTGTGAGGTAAGGGCTTTTCTACTTTCTTGTCTTACTGCTGCTTTCCT
TCCCCCTGCCTAGCCCTGGAGGCTGCCCGTATTTGTGCCAACAAGTATATGGTAAAAAGC
TGTGGAAAAGATGGCTTTCATATCCGAGTGAGGCTTCACCCCTTCCATGTTATCCGTATC
AACAAGATGTTGTCCTGTGCTGGGGCCGACAGGTGAGCTCAGTCTGGGCCTCCTTGGGGC
TTCTGTGTTGGGCTTGGGTTTTCATCAGTCAGGGCATAGATATGGCCTCACACTCAGCCA
TCTGTGGGTAATGGGAAGGCCAGGACATGGCTAATAAGTGGCTTTTAATGGATACTCCCT
CTTTTGGCAACCAGATTGGTCTGACCCTGTTGCAGAGTAAGTCAAACAAGCCCAAAAAGT
GTCATGATTAAGTCTGTCTCTGGGCCACAGGTAGAGGGAGGCACTCCTGATGGGAGTCCT
TGCTTGGAGTCTGACAATACCTGCTTGCAAGCAGGGACCTGTCAGATGAAGATGAGCCCG
GTGGTACCTTGCAGAGCCTCCCATTGGTTGCTTTTGGGATCCTCTGTCCTGCAGCCAATT
AAGCCGACCGTGCTCCTTTCCTCGTAGGGGCCCGGTGTGCAATGGCTGCAAACAGCAGCC
TCCTTGGTAGTGTATGCAACCTGTTGCTTGTATAGGTTGCTCTAAGGGACCTTGGATACA
GTCCCTTCTGATATATGTTCATGTGTGAGACCTTGTGCTGTCCCCAATCTAGGCTCCAGA
CAGGTATGCGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCC
AAGTCATCATGTCCATCCGCACCAAACTGCAGAACAAGGAGCATGTGATTGAGGCCCTAC
GCAGAGCTAAGTTCAAGTTCCCTGGCCGCCAGAAGGTAGGCAGTGCTGCAACCCCCTTCT
CCCACCTTTCCTTGCCCCAGGCCTCCTGTATTCTTTCCATCTCTCCCTAGATCCACATCT
CAAAGAAGTGGGGCTTTACCAAGTTTAATGCGGATGAATTTGAAGACATGGTGGCTGAGA
AACGGCTCATCCCAGATGGCTGTGGGGTCAAATACATCCCGAATCGTGGCCCCCTGGGAC
AAGTGGCGGGCCCTGCACTCATGAGGGCTTCCATGGTGGTGTCCCCAATAAATTCTGCTT
TCTGTCCACTTATGTTTTTGCCCTGGATTCTTGTGGGGGAGGGGAAGAGGAACCTCCTGG
GACTGCTAACTTCATTAAGGGACAGGCTGATGACTAAGCAGGCTGTATAACTGGGCAGTA
AGCAGGGCTAATGAGGTAATGCCCTAAGAAAGGGGCCAGGCCTATTAGCCTTTCCTCCAG
TTGCATAGTCTGGGCCTTGACTTGGACCTCCCCAGATCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGGCGAGGCTGAGAAATGAGAGACACAAAAGATGGGGACAGGAGGAT
GGAGTCTTGGTGGACTGCTGCGCCTCGTTTATTTCAGTTGCTATATTTATACAGATAAGA
ACAAAGGAGAAGTGAAATGCATTGGAACAGGTGGTACATGTCTTCGTTAAACCAGAAAGC
AAAACAGTTCTTGTTTCTTTCAACCTTATGTCACTTTGATAGCCCTTTCCCTCGCTTAAG
CAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1889..1947, 2030..2137, 2353..2492, 3053..3212, 3288..3414, 3416..3443
1001..1023, 1889..1947, 2030..2137, 2353..2492, 3053..3212, 3288..3414, 3416..3440
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved