Microcebus_murinus Locus TNPO2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus TNPO2
Microcebus_murinus
TNPO2
GeneScaffold_1822
SNORD41
11358..11427
16737
GTTGAGGGGAGTGCTCCTGGGGGTGTTCGGCCAGGCCTAATTGGGGGAAGCTGCAGGGA
TCGGACCAAGGGGGTTTCCGACTCGAGGTGGTGGGGGGCTTGGCCGAACTTGATTGGGGG
AGGCAGCAGAGATCTGTCAGCAGGAGTTACTGCTGACTGGGGCGGAGGCTGGCGGGGGGG
GGGGGAACGTTTGGTCAGACCTGATTGGGGAAGGCGACAGGGACCCGTCCAGGGGGTTTC
TGTCGCAGGTTGGGCGGGCTTGACTGGTTCTCATTCGAAGAGGCAGTGGAGATCCATTTG
GGGACCGCTTCGGGCCTGATTAAGGGGAATCGCTGGACAGGGTCTGGCTAGGCCAGAAAG
GGGGGGCGTCTGGCAACCGCTGAGCTCCAAGGGCCGGATTAGGGAAGGCGAGAGGGATCG
GGACAATCGGAGCGTCTTGGGACCGTGCACCCGGGGAAGCTCAAGAACCGAACCAGGGCA
GGAGGCCTCTGGGATCTGGCGGAGCTTGAGGGCCGGATTTCGGGAGAAGGGGAATCTTCA
GGGACCGTGCCTTCACCGGGGAGACCACGGGGGCCGGGGCGCTATCGCGGTCTGGGGCGG
GGCCCCTGGACGTGGAGGAGGCTGAGCCCTCGCCCAGTCGCTGCGAGGGAGGTGGAAACC
TTAGGGCTCGCAGCCGGGGGCGGCAGCATGGGGCATCCTGGGACGAGGCCTCTGGGGTGG
GCCCGATGAGGATCCGCCGGGCCCCGCCGCCGCCGCCGGTGGCCCGCTTCCACATCCCTC
CTCCTGCGCTCCCGTGCCCGCGACTGCGCGGCCGAGGATGGCGCAGCTGGCGGGGACCCC
GCACTTGGGCAGGGGTGGACCGGCGACCGCCGCCTGTCCGCCGAGGGCGCTCCCGTCGTC
ATGCGGCTACTGCGGCCTCAGGGGCTCAACCCGGGTCTCACACGGAGCCCCAGAGACCCA
GCGCTGACCCTGGCCCCTACCCCCGCAGCTCGCCTTGCGCCATGGACTGGCAGCCAGACG
AGCAGGGCCTGCAGCAGGTCCTGCAGCTGCTCAAAGACTCGCAGTCGCCCAACACAGCCA
CGCAGCGCATCGTGCAGGATGTATCCTTCCTTCCTTCCGGGGCTAGGGGAGCCAGGAAGA
CATCTACAGCCCTTGAAGGCCAGAGTGGGGGACGGGGCGACTTTTTCTGTGTAGTGAGGA
CTTGAAGACAGAGAATTAAGGATTAGAATTTCTGGGTCCCACTCCCAGAGCTGCAAGGAT
GGATCATTATGGAAAATAATGAAAATACCTAATGTTCATTGAGCATTTTACTCCATTAAA
CTGTGAATTATAGTAGGTACTCTTGCTCTTTCCATTTTACAGATGGGTAAATCAAGGCTT
AGAGAGGCAAAATGACTTGCCCACGGTCGCAGCTAGGAAGCAGTGGAGCTAGGATGGGAA
GGTCAGGCCCTGTCAGATTGGAGTCCAGTCTGTCCTGTCCAAGTGGAGGAAAGTGTGGCC
CTGGGTGAGGGGCGCGCATTTAGTTGCCACATGGGTTTTTATTGGGCTTTGTGGTAAAAT
TTCTTCTTTCTAATTGGTTGTTTAAAATATTAGAAGTTAAAAATGTTAATCTTTAAAACA
TTAGCAACTTTCACTTGAAGTTTGAATACCTTTCCTTTTTTGGTGTTTAAAATAAAGCAG
TCACCATTGGACTGCTAGTGAGCAGGGCTGAGTAGTGGCTGTCACCTTCAAAGGAGCAGG
GTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATAGGGAT
TGATGGAGGGGACCGCAGGAGTGGCTGCCTGGTCCCAGTATTGAGAGGTGCTCTCAGCGA
CTTTGACAGTGAGGGGGGTCCTGCATGGGGAAGGCCCCCTGTCTCCCAAGTCCCTTAACA
GCCTGGCAGAAACTCAAACAACTCAACCAGTTTCCTGATTTCAACAACTACCTGATCTTC
GTCCTGACCAGACTCAAGTCAGAAGGTACGCCCATGCGCCCCTGCAGGTGGGCTGGACAC
TGCCTTCTCCCCCGTGGCCCCCTGAACCTCGGCACTCTCCCCCTAGATGAGCCAACTCGC
TCTCTCAGTGGCCTCATTCTCAAGAACAACGTGAAGGCCCATTATCAGAGCTTCCCGCCG
CCAGTGGCCGACTTCATCAAACAGGAGTGTCTCAACAACATTGGCGACGCATCCTCGCTC
ATCCGAGCCACCATAGGTGAGAGGGGCAGCAGGTGTCAGCCTCTGAGGAACCTGCCTAAC
TCCCAGAAGGCTGCCCGAGGAAGTTACAGGATGACTAAGGATTAACTGAAGCAGTTTCAC
CTGAAAGCTTTTCACTGCTGATAAATACTAATACTACTATTTGTTAGCGATTTAGGCTTT
TCCCTCTAAGTCTATGTCAATTTAAAAAAATTGCTTTCAAGCTGGTCTTGGTGGTGCATG
CCTGTAGTTGCAGCTGCTCAGGAGGCTGAGGCAGGAGGATCACTTGAGCCCAGGGGTTCA
AGGCTGCAGTGAGCTATGATCGTACCACTGCACTCTAGCCCTGAGTAACAGAGTGAGACC
TTGTCTCGAAAAAATCCTTTTAAAAGTAAATGGTATGTGCATAACTTTTAAATGAAAAGA
CAAAGTTGCTTCAGTAAAGAGAAGTTAACATTGAAATTAAATGCAGTGGACAGAAAGGTA
GTATTAAATTTCAGCTAGATGCTGGGTCCTGCTAGAAGTGCTCATCTGGTGGTCTGCTGC
CTCTGTTAAAAGTGACTTTTAGCAAGAGGATCGCTTGAGTGGAGGAGTTTGAGACCAGCC
TGGGCAATGTAGCAAGATTCCGTCTCTACAAAAAAAAAAATTAAATAAAAGTGACTCTTA
GCCCCAACCACACCCCCTCCCAGGCCAGCCGAAGGCTCTAGGCTCACTGAGCTCATTCTG
GGTACCAGACTCTGCTCTAAGTCTTGGATTAAGTCATTGAAACCTGCCAGTGGCCATAGG
TGGCTGATATTTCTTTATCCCCATTGAGGGCTAAGAGCACTGAGGGCGCAGAGAGGTAGG
TCCTGTGCCCAACACTACAGAGACCGGATGGGATGGGGAAGTGCACCTTTGGTGTCCTCA
GCCTGTACATCAACTCCTGCAGGGAGCACCTTCCTCCCAGTGGCGGTTTCCACCTCTGGG
AATACTGTCATCTCGTGGCAGTCTATGTAACACTGCGTTGAAAGATCCCGAGTACAGTCT
GTTGCCAGAGCATTCCTCTGTGCCTCATATCGCCGGATGCGTTGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGCAGTCGATGTCACCTCTGCGCTGACAGTTCCCGCATTCAGCTCTGTTGCCAGACGCT
TCCTCTGTGCCCTCAGATGCCAGCTGCATATGGCACCTGCATTTCTAACAGACAGGCTCA
ATCATTCCCACGGTTGCAGGCCAGCACGACTTGCCCCCGTCGCCTCTCTGCCCCTACCCT
CCCAGTCTGCTCAGCCCCACGGGCTTCTGGCCCATCTATGTGCACTGCACGCCTGTCCCA
CCCTCGGGCCTTTGTAGGGCCCCATCCCTGTGTGTGGGATACTCTTTCCCCAGGTACCTG
GGTGGATCCTTCCCTAGTGCCTTCCTCTCCTTCCAGGTCTTTGCTCAGATGTTACGATGT
CACTGCCATGTAGCCTACCCTGGCCACCCAATTTAAAGTCGCTATTCTCACCTGCAGCCA
TTTCCAGCAGCCTTTTCTGCCCACCCCCCAGCTTAGTCCTTGGCATGTGGCCTCCTGGTC
TTGTTGCCTATTTAGCTATACCTCATGGCCTCCCTCCAGCTCCCCCAGGGCAGGGACTTT
GTGTTTTGTTCCGTGCTATATCCCAGGCCCTGGAACAGAGGTGGCCCATAGTAAGGCTCA
GAGGATGCTTGCAGAATCAATGAGTACCCTCTCTCTGTGCCCACCTCAGAAGGGGTGTGG
AGTGCGTGTGTGGGCTAGTGGGCAGAGAGGGAGCGCCGTGAGTTCCTGGTGGGGAGGGTG
AGGTGCCCCACAGCCCTTGCCCAGCCCAAGGCAGCGTCCTTTCCTCTTTTCCCCTTCCCC
ACCATCCCAGGCATCCTCATCACCACCATCGCTTCCAAAGGCGAGCTGCAGATGTGGCCC
GAGCTGCTGCCCCAGCTGTGCAACCTGCTCAACTCAGAGGATTACAACACCTGTGAGGTA
GGCAACAAGCAGTGGCTGGGCCCCAATGGGTGCCAGGGCCGTGACCAGGGCTGGTCCCCG
CAGCCACACCCATCTCTCTGCCCCTGTCCACTCAGGGAGCCTTCGGAGCCCTGCAGAAAA
TCTGCGAAGACTCGTCGGAGCTTCTAGACAGCGATGCCCTCAACAGGCCCCTCAATATCA
TGATCCCCAAGTTCCTGCAGTTCTTCAAGCACTAGCAGCCCCAAGATCCGGTGTGTGTGG
CTCCCTGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGCCTGCACCTGCCAGGTCCCACGCCAT
CGCCTGTGTGAACCAGTTCATCATGGACCGGGCCCAGGCACTGATGGACAACATTGACAC
CTTCATCGAGGTGGGCCGCCGGGCCAGGGCTGGGGGCGGGGCCGGGGGTGAGGACTGAGG
GCCTGCCAGAGCTGACACCCCCCCCCCCCGCCTCCCCGCAGCACCTGTTTGCCCTGGCCG
TGGATGACGACCCCGAGGTGCGGAAGAACGTGTGCCGCGCCCTGGTGATGCTCCTGGAAG
TTCGCATCGACAGGCTCATCCCTCACATGCACAGCATCATCCAGGTGCGCCTGACCCCGG
CCAACCCTGGGGGGGGGCGTAGCGGGCGGGGGTCAGGGAGCCTCCCCCAGCTGGGCTGGG
CCTAAGCCCCTGCCTCTCCCTCTTGCTGCAGTACATGCTGCAGAGGACCCAGGACCACGA
CGAAAATGTGGCCCTCGAGGCCTGTGAGTTCTGGCTGACGCTGGCCGAGCAGCCCATCTG
CAAGGAAGTCCTGGCCTCCCATCTGGTCCAGTGAGTGCCACTCCCGCCTCTGTCCCGCCA
CTGCCTCAACCCCTCGCTGCGCCTCTGCCTTCCCTTCTGGTCCCCTCTTGTGCCTGCCCC
ACTCCGTGTCCTCCTTGTCAGTTTCTCTTCAATCTGTGTGCATTAAATTGTGCATGATAA
GAATGTAGCCAGATGTGGGGGGGGGCGGGGCACATCTGTAATCCCAGCACTTTGGGAGGC
TGAAGCAGGAGGATAACTTGAGGCCAGGAGTCCCAGACCAATCTAGGCAACATAGTGAGA
CCCTGTTTCTATAAAAAATTTTAAAGATTAGCCAGGCATGCTGGTACGCACCTGTAGTCC
CAGCTACTCCAAAGGCTGGGGCAGGAGGATCACTTGAGCCCAGGAGTTTGAGGCTGCTGT
GAGATATGATCCATCCTGAGTGACAGAGTGAGACCCCATACCTTAAAAAAAAATAGCTTT
AATGACATAAAAGTTTAGTAATTGATAGGCATAGATGAGCAATCAACAAAGGTTTCAGGC
ACGGCTGGATCCAGGTGTTCAAAGGATGTGAGAAGCATCTGTGTAGCTTCAGATCTGCTT
CCTTTGTGTTGGCTTCATCCTCAGACATGACCTTCCTTCTTGGTAGTGCCTTGGCCTTCA
GCACCCTTTCAGCTCAGCAGCCTCAGAGTAAAGAAATTCTCCCTGGACCAGTCTCTCCAG
GAGTTCTAGAGTTCACTCTCCTCGAGTGGGCGTGTGTTTTGATTATGCAAAAAGCTCACT
GTTGATCGCGTCTGGGAGTCTGGCGCTGGCCACATAGGCCCTGGGAAGAGAAGAGGCCGT
TGCTAATTATGTTGTGGTATTCAGTGTCTGCAAGGAAGAGGCCAGGTCTGGGGAAAGAGC
ATTCCTGTGGAGCCAGGCGTGGTGGCTGAGACTGGGTTGGAATCGTCCTCCAAAGGAAAA
TGAATGGATGGCAACAAGTGGTGTGGGCATGTGGGGCACAGTGTGCTCTGTGGCTTGTTG
GTGGCTCTGCTTGCACCTCTGCTGTCCCCCCCCACTCCCCGCCATAGCTGGGGTCCCCCC
GCATCCCGACAAACAGCCTCTCTCCCGACAGGTTGATCCCAATCCTGGTAAATGGGATGA
AGTACTCGGAAATTGACATCATCCTGCTCAAGGTCAGGCGGGGTGGCAACCAGACATGCG
TGGGTGCGGGTGGGGGTGCTGGGGCTGGATGTGGTGGTACTTAGCAGTCTGCCTGGCCCC
CAGGGGGACGTGGAGGAAGACGAGGCAGTCCCTGACAGCGAGCAGGACATCAAGCCACGC
TTCCACAAGTCTCGCACGGTGACGCTGCCGCACGAGGCTGAGCGGCCCGACGGCTCTGAG
GATGCAGAGGATGACGATGACGACGATGCCCTGTCGGACTGGAATCTGAGTGTGTGGCCG
GTCCGGGGATGGGGGTGGCAGCCCCTGGGCTCTCTGTTGGGAGGTGACCAGAAGTTGATG
CAGAGCAGATCTCGAAGATTCTGATTCTGATCTCTCTGATCCTGGGGGTGCAGTGAAGGA
GGGCCAGCCGTCTAGCCTACGGGCTTCCCTGAGCCTGTCCCTCAATGTGTCCCCCCGCTC
CCCAGGGAAGTGCTCAGCGGCTGCACTGGATGTCCTTGCCAACGTCTTCCGGGAGGAACT
GCTGCCCCACCTCCTCCCGCTACTCAAGGGCCTCCTCTTCCACCCCGAGTGGGTGGTCAA
GGAGTCCGGCATCCTGGTGTTGGGCGCCATCGCCGAGGGTGAGTGCCACCTGGCCTGACT
GTGCCTGACCTCTGACCCCGTGCTGACATGAGGCCATGGATGCAGCCCCGCAGCACTGGC
CACGCCATGTTTGAGTTCTCCCTGGTGCCCTAGTTACCGCCTTCCAGACAACTCTGAGGT
CCCTGCCCTCCCCTTGGCCCCTGGGCCTGAAAGGAACCCCCAAAACCGCAAAATGCAAGC
CCTCACCTTCATTCTCAGGGGCAGGCAATTCTTGGATGTTATAAGTATAGTTACAACCTC
AGTAACAACAGGTTCTGGTGCACACCTGCCCTGTGGGCTTAGGTACACGAACGTGTTGAG
TCCTCACTGCCATTTGATGAGTTGGTTGCGATATCCCAGTGTCATAGACGGGGAAACTGA
AATGCAGAGAAATTGATGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGCTTTCTTTGTCTTGATGGGACATAAAACTTGGACTACAGGAGG
GCTTTGCGAGTTTGTTACAAGTGTCACAAGGGACTGCTTCTGCACCCAGACCTGCCCTAA
AAGTCTCAGGCAAGGCAAGGGGAGCCTTCCACCCATAAAACTTTTAAAATTTGGCTAAGG
AAAGGTTTCCACATACAATAGATGATTAATATATCTTATATTGATAGAGGATATAATATG
TTACGTGATTTGTGGGCATATATTAACAGATGATGTTAGGTTTATTGGGGTTTTTTTGAG
ACAGAGTCTCACTGTGTTGCCCAGACTAGACTGCCATGGCGTCAGCCTAGCTCACAGCAA
CTTCAAACTCCTGGGCTCAAGCGATCCTCCTGCCTCAGCCTTCCTAGTAGCTGGGACTAC
ATGCATGCGCCACCATGCCCCACTAATTTTTTCTATATATTTTTAGTTGGCCGATTCATT
TCCTTCTACTTTTAGTGGAGATGGGGTCTCGCTCTTGCTCAGGCTGGTTTCGAACTCCTG
ACCTTGAGTGATCCACCCACATCGGCCTCCCAGAGTGCTTTATTGGGTTTTTTTTTTTTT
TGAGACAGAGTCTCACTTTGTTGCACAGGGTAGAGTGAGTGCTGTGGCGTCAGCCTGGCT
CAAAGCAACCTCAATCTCCGGGGCTCAGCGATCCTACTGCCTCAGCCTCCTGAGTAGCTG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCCTGGGTGGAGACCTAATCTTTTAAAAAAAAAAAAAA
GGCCGGGCGTGGTGGCTCACCCCTATAATCCTAGCCCTTTGGGAGGCCAAGGCAGGCTGA
TCGCTCAAGGTCAGGAGTTTGAAACCAGCCTAAGCAAGAGTGAGGCCCCATCTCTTCTAA
AAATAGAAACAAATTAATTTGGCCAACTAAAAACATAGATAGGGCGGGGCGCGGTGGCTC
ACGCCTGTAATCCTAGCCCTCTGGGAGGCCCAGGCAGGCGGATTGCTTGAGGTCAGGAAT
TCAAAACCAGCTGAGCAAGAGCGAGACCCCGTCTCTACTATAAATAGAAAGAAATTAATT
GGCCAATTAAGATATATATAGAAAAAATTAGCTGGGCATGGTGGCACATGCCTGTAGTCC
CAGCTACTCAGGAGGCTGAGGCAGCAGGATTGCTTGAGCCCAGGAGTTTGAGGTTGCTGT
GAGCTAGGCTAATGCCATGGCACTCAGTCTAGCCTGGGCAATAAAGCGACACTCTGTCTC
AAAATAAATAAATAAATAAATACATACATACATACATAGCTAGCACATAGATAAAATTAG
CCAGGCATCGTGGCACATGCTTATAGTCGCAGCTACTGGGCAGGCTAAGACAGAAGGATC
ACTTGAGCCCAGGAGTTTGAGGTAGCTGTGAACTAGGCTGACGCCACGGCACTTTAGCCC
AGGCAACAAAGTGTGACTCTGTCTCCAAAAAATAAAAAATAAAAAAAATTTTAAAAAGCT
AATGAAGAGAAAAAGAAAAATCACACACATCTAAGAAGGGGTTCAGATGTAAAGTGGCTT
CCATCCATCTGGGTCACTGCTGTCCCTGAAATCCGGTACACTGTGCATGGTGGCAAATTT
CTCATTGACCAGTGGCGGCGTAAGACAACATACCCTCTGTGATGAGATCTAGCTGTTTTT
CCTCTCCTGCCCCTGCCTTTCCTTGGCTCTGTGAAATGACTGTTATTTAACTTCTGGGCC
TCAGTTTCCCCATCTGTCAGGTGGGGTTCCTGCTTTGACTCCTTAGAGTGGCTGTGGCTG
GGCCCTGCTGACCTGTCCCTCTTGTTTCCCGGTTGCTGCAGGCTGCATGCAGGGCATGGT
GCCCTACCTGCCGGAGCTGATCCCACACCTCATCCAGTGCCTGTCGGACAAGAAGGCCCT
GGTGCGCTCCATTGCCTGCTGGACGTTGAGCCGCTACGCCCACTGGGTGGTCAGCCAGCC
ACCTGACATGCACCTCAAGCCTCTCATGACGGAGCTGCTCAAACGCATCCTAGATGGCAA
CAAGAGGGTACAGGAGGCAGCCTGCAGGTGACCCTTGACCCCTGACCCTACAGTCCCCAC
TGTCTGCTTGCCCACCTCTGGGAAGTGATGACACCCGTGACTGCTGATGTGGCACTGATT
TCTCTCGTATTCGTACTGGCTGATCCCGAGCACGGCCTCCCCAGCTGCCCAGGGACTGGT
GCCCCTTGCTGGGGTCCACTGAGACCCCCTGCCCTGCCCTCCCTCCCACTAGTGCCTTTG
CCACCCTGGAGGAGGAGGCCTGCACGGAGCTGGTGCCCTACCTCAGCTACATCCTGGACA
CCCTTGTCTTCGCCTTCGGCAAGTACCAGCACAAGAACCTGCTCATCCTCTACGATGCCA
TCGGCACCCTGGCCGACTCTGTGGGCCACCACCTTAACCAGCCGGTGAGACCCCAGAGCA
GCTCCTGTCTCCCTATCCCCGTGCTCCTCGGCATCCAGTGACCTGGCGGCGACCCTATGT
CGCATGCCAGGGATGTGGCCGTGACCTGGACAGGCAGACAGACAGACCTGGCCCCCTGCC
CTGGCCCTGCTCCCAGTCTAGCAGGGAAGACAGTTATGAGACAGCGTGGTAAGTGCTGCG
CTGCGGGGGCTCAGGGGCCCCTGGGGACCAGGAGGCAGTGACCCAGGCTCCTGGGGGGGG
AGGGTGGCACTTGGCCGAACGTAAAGAAGGGTCTGGAAGTCTGGCCATATGGCAGGCCAC
TGCGAGGAATCCAGGTCTCACTACTGAAGTGACAGGTGCCTCTGAGTCTCCTCAACCCCG
ACCCAGGGAGCCCCAACTTCCTGCCCCCTCCAGGAATACATCCAGAAGCTGATGCCTCCG
CTGATCCAGAAGTGGAATGAGCTCAAGGACGAGGACAAGGACCTCTTCCCACTGCTGGAG
GTGAGTGGGCTCCAGGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCATGATTGTGGCACTAGACCTGCTTAGCGGCCTTGCCGAGGCCTGGCGGACACG
TGAGCAGCTGGTGGCCCGAAGCAACATCATGACGCTGCTCTTCCAGTGCATGCAGGTGAG
TGGGTGCCCCATGCAGGCTGTGCACAAGGCATGCCCAGGGACACTTGCTGTCACCTGCAT
AGTGACAACATCCAGCAGCCTGTGTGGGCTGCCCCAGGGGGACTCACAGCCCTGCTTGTG
CCCAAAGGATGTCAGGGAAAAGGAACCCTTTAAAAAAAGTTTCTGGTTATTGTGATTATT
CCCTAAACAAGTATGACAACTATTTATACAGTGTACATTTACATTGTATTAGATATTATA
AGTAATCTAGAGGTGATTTGATCGCACCCAGGAGGATACGCATAGGTTATATGCAAATAC
TATGCCACTCTATCGCAGGGATTTGAGCATCTGTGGATTTTGGTATGAGCTGGGTCCTGG
AACCGATCCCCCACAGATCCTGAGGGACAAGTGTATGTCAGGATGGGCAGCAGCAATGCC
TGCTCTCCTTTGTTGTAGCGCCCTGAGCAAAGCATTCTCTGGGTCCTGTGCTTCTAAGTT
CCCAGGGTGGGGCACTGCCAGCCCCATTCACAGATAAGGGCTGGAGGCTAGAGAGGTCAA
GAAATAACTGAGAAGTGGCAGGGTCAAGACAGGCACAAGAGACTGTGCCCCATCGGCTGC
CCTGGGGGAAGGAGTAGGGGAACCCTGCCACATTGACCCTTCCTGGACCCCCAGGACTCG
ATGCCTGAAGTCCGGCAGAGCTCCTTCGCCCTCCTGGGGGACCTCACCAAAGCCTGCTTC
ATCCATGTCAAGCCCTGTATTGGTATGACACTCCCCTTGTCCCTCATCCATGATCCCAGT
CCTGGCCTCAAGTGATGCACAAATGCCCTGGGGAGAACTGTGACCTACTGGGATGTATTC
GTACTGTCTGATGGGGCCTGCCGGGCTGGGTGCTGGAGCTCACCCTGGCTGGCCTTCCTG
AAGCTCAGCACCCCTCTATCTCCCCACCAGCTGAGTTCATGCCCATCCTGGGCACCAACC
TGAACCCCGAGTTCATTTCTGTTTGCAACAATGCCACCTGGGCCATTGGAGAGATCTGCA
TGCAAATGGGTGAGTGAACACTGTGTGAACACTGAGGCCCCATTGGCCTGTTCCTAGCCC
GGGGGCAGGAGACTCTCTGACTGACAGCGCCCCTAAGGGATGCCTCCCATTGGCCAGGGG
CAGGAGGATGTGTCTGTGTGTTTTCCTTAGGGGAGGAGCTAAATGGCTACAAGGCCATTT
CTGATTGGTTTATTCAAAGATGAGGACCAGGAGGGGTGTTCTGATTGGACTATTTCATGC
AGTTGCCTGCAAGACCCATTGGGATTGGTTGGGTAGCTTTGGCATTTTTCCCAGGGAGAT
TAGGCAGTGTGGTCTCATCCTAGTGTCTGAAGGGGCCTTCAGAGAAAACTCTGGTGTTTG
GAGGGCATGGATGTGTCTCTGGTTGGGGATAAGCTGGAGAAGATCCTTTAATCCCTCACA
GGTCGTGGTTGGCCAGTCTCTGGATGGCACTGGGGTCATTGAGTGAGGGGGCTGTACCCC
TGGCTGGCCCACTGTGGGTGGCATGGGCTGTGCAGGGCTCTGATCGGGTGCTCCCCCAGG
CGCAGAGATGCAGCCCTACGTGCAGATGGTCCTGAACAACCTGGTGGAGATCATTAACCG
ACCCAACACGCCCAAGACGCTGCTGGAAAACACAGGTGGGCACCAGGCCTTGGCCTGCTT
CCTGGCCCTCTTCTTGAAGGTGGGGTTCTGGGCTGGGAGTGGGAGCTGGCCGTACCTGGA
AGGGGGCTCTGAAAGCCCCAAGAAAGACGCTGGCCTTGGGGTGCCCTGGGGAGATGCCAG
ATGGGGTGGGGAGGAGACCCTGCTGGGGCCAAACTCAGGGGCCCAGGCTGGCGAGAGGAG
CCATTCTCTTGGGGCCCGTGGGGCGGGGCTCGGTGCCTCGTGCCAGAGGCCCCGCCACGT
ACCGTCCTGGGGCCGCTCAGGGTTGCAGGTCGCCTGACGAGTCCCTCTGCCATTCCAGCC
ATCACCATCGGCCGCCTGGGCTACGTGTGCCCACAGGAGGTGGCACCCATGCTGCAGCAG
TTCATCCGGCCTTGGTACATGCCCATCTGTGTCAGGCCTGCTGGGTGGTGGGTGGGACAG
GCCTGATCCCTTCCCTCACCTCTGCTCTCCCAGCCCTACTCATATCCCCATAGACGGGTG
TCCCAGACCCACTCCCTGACCTTCCGTGCCCTCCACACCCCAGCCCCCAAAGAGAGTTGT
CCTTCCCAGAGTGGATCTCCCCCTGACCCGCTGCTCCCTGACCCTCACAGGTGCACGTCA
CTCAGGAACATCAGGGACAATGAGGAGAAGGACTCTGCCTTCCGGGGCATCTGCATGATG
ATCGGTGTCAACCCCGGGGGTGTCGTGCAGGTTGGGGCAGCTGGGTTCTGAGGGAAGGTG
CGGGAGCTGGGCTCGGGCGGCCCCTCACATGGGATCCGTCACGTTTCAGGACTTTATTTT
CTTCTGCGATGCTGTAGCCTCCTGGGTGAGCCCGAAGGATGACCTTCGGGACATGTTTTA
TAAGGTGGGGCTCCCACTGGGCCCTGATCAAGTCCTGGGAGGGGGCAGGGAGGACACCCT
CTGGCAGGGAGCAGGGTAGGGGAACAGGAGCGAGGGACAAGCGAGCTCATCTCATCCCAC
TGTGGCCCATCTGTCACCCACTGCCTTCCCACAGATTCTCCACGGCTTCAAAGACCAAGT
CGGGGAGGACAACTGGCAGCAGTCTCAGAGCAGTTCCCGCCGCTGCTAAAGGAGAGGCTG
GCGCTTCTACGGGTCTAGGCGAACGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCGGGACCCCGGGGCGGGGGGAGGAGGACGGCTTACCTTGG
GGCCGCCCTGTCAGCACGTGCACGCTTAGGACCTGCTCCGCACACTTCCTGCCAGCTTTG
TGGCAGCCTCAGCCAGTGTGTCCCTGTCCTTGTCCTAGCCCAGCCAGCAGGGTGAGGACC
ACCAGGGCAGCTGGGGCTGGCCAGAGGTCGCCCTTTCTCCCTCTCCTGTGCTCCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 1989..2064, 2146..2295, 4810..4916, 5015..5132, 5134..5149, 5868..5949, 6041..6163, 6271..6389, 7471..7531, 7623..7788, 7985..8137, 11081..11306, 11512..11683, 12093..12179, 12445..12552, 12799..12885, 12887..12901, 12904..12954, 13614..13701, 13890..13988, 14519..14614, 14908..15013, 15230..15329, 15409..15483, 15634..15681, 15684..15722, 15724..15729, 15732..15737
1001..1099, 1989..2064, 2146..2295, 4810..4916, 5015..5132, 5134..5149, 5868..5949, 6041..6163, 6271..6389, 7471..7531, 7623..7788, 7985..8137, 11081..11306, 11512..11683, 12093..12179, 12445..12552, 12799..12885, 12887..12901, 12904..12954, 13614..13701, 13890..13988, 14519..14614, 14908..15013, 15230..15329, 15409..15483, 15634..15681, 15684..15722, 15724..15729, 15732..15734
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved