Microcebus_murinus Locus RPL3
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPL3
Microcebus_murinus
RPL3
GeneScaffold_720
SNORD43
1493..1556
8488
ACTACTGAACTCAAGCGATCCTCCTGCCTCAGCTTCCCAGAGTGCTAGGATTACAGGCT
TGAGCCACCTCTGTAGCAATTTTAGTAGTCTTATTTGGTCTGTGAGAGTGGCCATCTTGT
TCCCCTTTGTATTCCCGCGGCCTGGTGCAGTACGTGGCACACAGCAGGCTTTCAGTAAGA
ATTTCTTTTTGCTCATGACTCCAGAGCTCCTTGTTCCATGAGGGGGTTATTGGACCCCAA
GTCTATGTCGTGAAAACCCAACGTAGAGTCAGACAGACTTGAGCTGTCCTTCATTAATTA
TACTTTTGTTAAGTAAGTAACATCTTGGCCAGAAGCTTAGTGTTCTCTGCAAAAAGAGGA
CAATACAGGCCATAATCCCATGTCTACAATCCTGAAATTAAAAAAAAATAAGAAATTCAC
GACCCTGGGTCGTGAGACCGTTTGGCAGCCTTGGGACGCACCTCGCCAACTCAGAGACTC
TCTGAATTAAGTGCGGGACACTGCAGCTGGATGCTGAGAGCAATGGCTGAGAAACGGCTT
GAGGGAGGGGTGCCCCAAATCAAGAGGCAAGTTGGAAAAACCAGGTCGAGAGCCAGGAAA
CTTGGGGTTTCAGTCTTTCCGATTCCAGAGGTGATGACATGTCACACAGGAAGAAGACAC
GCGGCCATGTTTCGTCATCATTGTTAAGTTTGGCTGCTGCCGAACGCCGTAGATTTGTTG
CACTCCAAATACTTAACCAGCGCATCCGCGACTTTTCACTAAGTTTGAACCCAACGACGC
GCCGTAGAGTCTTTAATTTGTGTCTCTGAAGCTGACGATCCGTTCGGAACGAACGCTAGG
CGTGGAAGACTGTGCGCGGAAATCGCGCCCGGGGCGTGACCCCCGACCTGGCGTCCGCCG
GGGGCGCGCGCTCGCACGCCGGAAGGGGTGGAGCCAGACTTGGTCTTATATAGCGTGCGC
CCAGAGTCGGCCGGCCTCTAGCGGCGTGATTTGGCGGCGGGATGGTACGTATTGTTATGG
ACTTCCTTCTTGGTCCCGGCGTTGGCGTGGCTGAATCCGCGGCGCATCGTCGCCATCTCG
CCTTCGCCAGTGCCAGATATCTGCTCTAGGAGCGTAGGAGACACGGTGGGGGCCGCAGTG
AGGTCTCTTTTCTGAAAACTCGCGAGGCTTGTGGAAAAGGGCGAGTGGAGGGCCCTGGGC
CTGCAGATCCGGCCGGAGAGGCCTTGGTGTGGGAGCAGGCCTGTGGGCCCGACACTTTTA
AATTCACGGGACTTTTCCGGGTCACAACCTCACCTATTTTAGCCGTAATCGAGATAAGAT
CCCGTGAGCAGTATGCGGGGCCGGGAGGACCTTGAGTGGGGCCCTAGGCATTCTTACCAA
GCCGGGAGCTGAAGAATCTTGCGGGAGGGAAGACTTAGGGTGAGGGTTGAGGCTCCCTTC
TGGAACCTGGGACGGTTGGTGCAACTCGAAACGCTTCTGGGGTTCGCAGAAACCACAGGT
GATGAACTTACTGACGGGCGGACAGAGACACTGTGCTGATTGTCACGTTCTGATTTGGTT
CTGTCGAGTTCTAGCGGCCTTCGTGTATTAGTCTAGCTCTCCCGTCCCAGAGCTGGAGGA
GTCTAGTACGATTACTGCCCAACCGTTTGTCCCAGCCATGAGTGCTGTTGGTGGTCAGAT
TATAGATGATTGTTAATATAATGAAGCCAATTGTTATGTGGCTTTCAGTGCTATTACTTA
CTATGTTTTTGTCTGATGTTAGAGTGAAAAAGTAAATGGCTAACTTTTTCAAAAACCGAG
ATGAGTTGGAATAAAAGTTAAGCTCATTTTGTTGAGTTTTAATACACTCATCAGGATGTG
TGCAATCCTGGGAAAATTGAACTTGATATGTAATCCTCTTACCAGCATTATTGGATTTAG
GTGTGGTTAAGATTCAGCATTGCTGAGACCATTTAGAGCTAGGCAGCTGGGAACTGAACT
GGAGGGTTTTGGGTGCTAATACTGGTTGTTCCTTCCCAGTCTCACAGGAAGTTCTCAGCT
CCCAGACACGGGTCCTTGGGCTTCTTGCCTCGGAAGCGCAGCAGCAGGCATCGTGGGAAG
GTGAAGAGCTTCCCCAAGGATGATCCGTCCAAGCCTGTCCACCTCACAGCCTTCCTGGGA
TACAAGGCTGGCATGACCCACATCGTGCGGGAAGTCGATAGGCCAGGATCAAGTATGTAC
AGGCTGCATCCTCCAAGTTGGGGGGATAGGAGTTGACAGTGGGGAAACGTAGGTTATCGG
AATCCTTCTGATTGGGAATTAATCTTCAGGATTAATCCACAGATTACAGATGGCTGGTAC
TGTTTGCTTTAGGCAGAGGAATATTTTTGAAGTCAGGGGCATGACATGAGTACATTTTCC
AAGAGCCGCAGCATAGAGGAGTATGTTAGCTTGGGTGATTAGAGACTGGGATAGAAAATG
CCTCATTCACACGAGTATCACTTAAAAGCTTGAATAATACCCATTTACATGGGTTTTGGT
GAAGTTAAAACTGGAAAAATCACTAAGTAGAACCGCAGCACTTGTCACTGAGCCATGGTA
GATGGTAACACTGGGCAGCATTTTCTATTCCAGGCCAAGTTCAGTGCTTATTAGTTTGCC
CTGTTATATACTCTGGACTCTGTACTGTCATGATAAATAACAAATTTGTCTGCCTTTAGA
GATCTGACAGGAAGAGAACTGAAGCCAGACTGGTATTTGGCTGACTAGGTCTTGTTTTTT
ATTTTTCTCTCTCTGATTAAGTACTGACTATACAGAGCAAGGGGGTCATGGTATTTTTGG
TTTAGGGTGACAGGTGTGGATGCAGGGAGAGGGAAAAGTATGTAGTAAGGACAGCTCTGG
GATTCAGACTGCTGGTGTGGGCTTCACATAAGTTTCCCTGTCATCCAAAGCAGGTTGCCC
TCAAACTGGCCTAAGGGGGCTCCTGTCAGGCTACTGAAGTCTACCTGTTTTCCCCCCAGA
GGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAGACGCCGCCCATGGTGGT
CGTAGGCATTGTGGGCTATGTGGAAACTCCTCGAGGCCTCCGGACTTTTAAGACCATCTT
TGCTGAGCATATCAGCGATGAGTGCAAAAGGCGCTTTTACAAGAACTGGTAAGGGAGGAG
CAGGCTTGTAGTCCCTGGGTTAGGGGCTGGAGAGCAGGGAGCACCCTAGGGCCTCTCAGT
TATGCAGCAGGGGAGGAGCTGCTGCTCAGTTCTCAGGTTTAATTTCCTCATGAGCATAAA
ACTACCTGAAGACAGACCTTGACCCCCAGTCATTGGGTTTCTGAGCTTGGAGCTGACGCC
TTAATTTTGTGTCCAGGCTGGGTGTTGGCTTAGGATCCAGTAATTACCTTGTTTGCTGAG
TCCAGCAAGAAACTGGGAAAGATGAGCAGGATAATTCAGCCCAGAAAGGATGGCAAGGGC
CTTGGGCCCTGGCTCGAATTTCCCATTACCTTTACTGTGAGGATGGTGCCTCCCCGAAGG
TAGAGAAAGCTGCTTTCAAGCACCCTCAGAATGAGAATTTGTCTGTTTTGAACATTTGTG
ACTTAAATTAACCTTGTGGACCTCTGCTCAGCTCCTCTCGGCTCTGCCCGATGAGCTCCA
TCTAGGCTCCGCTTGCCGGTGGAAAAGGCTCCTTAGAAGCCGGCAATGAGCCCCATCCCC
ACGTGGTGCCATGTGCCTTCCGCTCACTCCTCCTGAGGGGTGATGAAGGCCTGCACCCGG
CCCCTCCCCAACTCTGCTCTGCTCCTGAAGGCATAAATCTAAGAAGAAGGCCTTCACCAA
GTACTGCAAGAAATGGCAGGATGAGGATGGCAAGAAGCAGCTGGAGAAGGACTTCAGCAG
CATGAAGAAGTACTGCCAAGTCATTCGCATCATCGCCCACACCCAGGTAAGCACCACCAT
GCTGCCAAGGGTGGGGATAACTGCCTGCCACTTCCTCCCTGGAGGTGACCTACCCTGTGA
GGTTTTGAATATGAGGGTCCAGTACCCCGCATTTGTGAATAGGCCTCTTGCTTGCCAGCA
GAGGGCACTGTGTCCTTCCTGGCTCTTGGCAAGGGAAACCATACTCTATTTGGGGAATAT
TCAACTGGCTGATCCAACTGGTGACTCCTGATAAACATTGAAGTGCCATGCTGAAAGTAG
TCCTAAAATGTTGGCTGGATGCTCTTTCAAACCTGGCTTGCTGTGAGCTGTTGGAGCCCC
ATGTTGGCCTGGTTAGAATCCTCTGGCTGTTTCATGTGCTCAATACAGCCCCATGTGGCT
AGGGGCCACTGTTTATTAGTACAGATGGTAGTATGTTTTTGTTATTGAAAGTCTTGGAGG
ACGTTGCTGGGCTACCCTTTAAATGGAAGGTTTGACCCTAAGTGCGTTTCCTCATTTAAC
CCTTAAGGCTTGTCCTCTTGACTTCTGTGTTCTCGAAAGCAGACTTGTTGCTAGAGCAAG
CATGGGCAGCTAGGGGGAAACTGGTACTACCCTCACAGGAAATGTGGCCAGGGTAGAGAT
TGAACAGGGGGCTGGTGGGGGCCGGGATCTGCTTGTTGCATGTCTTGGTGTGGGCCCCAC
TGGCTCATCCTGACTGTGATTCAGGTACCAGAATCCAAAGTTGAATTGCTGGTATTGGCA
AAAACAAAGGTAGTTTTTGGTGTGTGTGTTTCAGAAAGACTTGTTTGAGTTAAGCTTTCC
TGTTGTCATGGCTTTGATACCAGACCGCAAGCCCCAGCCTCAGTGCCTCTGCCAGGAGCA
CTGGAAGCTCGAATCTAAGCTGTGCATGTCCTCCTAGATGCGCCTGCTTCCTCTGCGCCA
GAAGAAGGCCCACCTGATGGAGATCCAGGTGAACGGAGGCACCGTGGCTGAGAAACTGGA
CTGGGCCCGGGAGAGGCTAGAGCAGCAGGTCCCTGTGAACCAAGTGTTTGGGCAGGACGA
GATGATCGATGTCATCGGGTGACCAAGGGCAAAGGCTACAAAGGTGAGCTCCATAGCAGC
TCCAGTTGCTGTGGTCTCAGCCCACCTGTTCAGCAATGAGGCCTGGAATGTGCGCTAGGC
ACGGTGCCCCGAGTCAGACTGCGGAACCATTCCTGTTGCCTGCCTTCTGAGAACAGCCCT
GTGGACGTGGCTGAGGTGGGGCAGCAGGGGCTGCCCCTTGCTCTGCACCCCCTGCCAAAC
ACAAAGGGGAGCTTCCAGTGGGAGAACATCGACATAACAGATAGCTTAAAATGGCCTGTC
CTTATGCCTACATTTAGAACTTAGGACTCTGGATTTACGTGTGTATCTAGGCAGGTGTCC
AACTTGACAGGAAATACAAGAGGAGATATGGGGGTAATGCAGATTGAATAACCGTGTCTG
TCCCTTAGATTACCCAGTCGCTGGGTAGTAATTATTTATGGAATTGAAGTTGAGCATTCA
CAGCAAGAAAAGGGCGAGTGGGTAAGTGCCAGGCCCTGAGGTGCAGTAATGGCATGTGTC
CTTTCCAGGGGTTACCAGTCGTTGGCACACCAAGAAACTGCCCCGCAAGACCCACCGAGG
GCTGCGGAAGGTTGCCTGTATCGGGGCCTGGCATCCTGCCCGTGTGGCTTTCTCTGTGGC
ACGGGCTGGCCAGAAAGGCTACCATCACCGCACAGAGATCAACAAGAAGGTGAGGTTCTG
AGGGTGGTTCTCTGGGAGAGGGGCTGTGGTTGCTGTCCCTGTCGTTGCTTCATTGGTTGT
ACAGCTTCTGAGCATCATGGACTTCAGTTGTCCATATCTCGTGGGTCTGTTCTGGCTCTT
GGGTGTTGGGGTGATTTGTACAGTGCCCCTCTTAAAGGCGTCTTGGTGGAGCTGGCCGTT
GGTGTGGCTGCGGCTGAGAGTCTGTTCTTTGGGTCTGCCTCCAGGGAGGTTTTTTGAGTT
TTCCATCCATCTGCTGCCTTGTTCAGCAGGGTCTTTAGTTTGGGTCCAGCCACCTTCCAA
ACCATGGGCTGTGTTTGTAGGTGCCCCACTGGAGTGCTTTGTAGGCCAGCCTACTGGCAT
GTGGGTTTTTTTTTTGTCCTTAATGTCTTGTCACCCTGCGTCCAACCTATCTTGCCTGGG
GGACCAGCCCCTCTGGGCCTGCTCCCTGCCCCCCTTTCCAGGTTACTTACGAATTTCTCC
TTGTCCAGATCTATAAGATCGGCCAGGGCTACCTTATCAAGGATGGCAAGCTGATCAAGA
ACAATGCTTCTACCGACTACGACCTGTCTGACAAGAGTATCAACCCCCTGGTGAGTGATG
CTGCCCCCTGAAGCCACCCCAGGCCTCTTCTGTGGGGTTGAGGGGGCTGGTGCTATTGGG
GCACAACACCCAGTGGTGGCATGGTGTAATGTGAGCCCACTGCTTCGGGTTGCTGGGGAG
AAGTGGGTCGTAGGCGTAGCTGTTCAGTGATGAGGCCTGGAATGCGCTGGGCACAGCGCC
CGAGTCAGACTGCGGAACCATTCCTTGTTGCCTTCCTTCTGAGAACAGCCCTGTCTGTGG
TCAGGGGTGGCTGGTGTGGGGGGCTGGGTGACCTGAAGTTTGAAGAGTCATTTCCACAGA
ATGATTCCCTGTTTGTCTTGCTTGGTCTGTGCTGACCCTGTGGCCTTGTTTGATTTCAGG
GTGGTTTTGTCCACTACGGTGAAGTGACTAATGACTTTGTGATGCTGAAAGGTTGTGTGG
TGGGAACCAAGAAGCGAGTGCTCACCCTCCGCAAGGTGAGGCAGTGCCCTTCCTGTTTGG
TTGAGTGTGGCCCTCTGGGATCCTGTGGCCAGGAGGATCACAAGTCCGTGGACACAGTGA
TAGGAAAGTGCAGAGGAAGGGGGGTTTGAGTACTGCTTTAACGGAAGCTTTGAAGTCCCA
GACGAGGAAATTCCCGGCTTGGCCTTGTGGGGCTGTTTGCTTTGTTCATGTGTGTCCTCA
TCCGGCTGGAGGGACACAGTTGGGCCAGGAGATGGCGATGGTTGTGGGGGGAGGACTCTT
GCCTTCAGTTGATCCTGTGACTTCCCAGACACTCTTCATAATTGTAACTAACTGCCCCTC
TTGGCCCACAGTCCTTGTTGGTGCAGACCAAACGGCGGGCTCTGGAGAAAATTGACCTTA
AGTTCATCGATACCACCTCCAAGTTTGGCCATGGCCGGTTCCAGACTATGGAGGAGAAGA
AGGCGTTCATGGTAAGCACCTCCTGCTTGCTCCCTCACTGGGGTTGGGGTGGCTCCATCG
GCCTGCTTTGGGTGCTCTGTGTGGTGTTGGTGCAGAAGGAAGCAGCTAGGCTGCCTCTTG
GGTCCTACAAAAGAACTCTATGCCTTAGTGACCCAGAATCTTGGTCCCCTTTAGAGTGTC
AGTATCCATGCTGTCCACCTGCCTAGTCTACCCCTGACCTTACCTACTGCATCTCTCCCT
ACAGGGACCACTTAAGAAGGACCGAATTGCCAAGGAAGAAGGAGCTTAATGTCAGGAACA
GATTATACAGCTGGTGGGATCTCAATAAAAGTTGTTTTCCAGTGACATCTGCCTCTGACT
TTGCTGGAGGGAAGCAGCGGTAGGGGGGGCAGGCAGTAGCCTGAGGGGCCTTTGCTGCTC
TCCTCTCCTTAGCTGCACTTGGTCTGCACTTTGACCCCCACCTGCCTGGAGGGAGGTAAA
GAGCTAAGCTTGGGTCTGATGAAAGCCAGCCTGGGGCTTTGTGTAATGTTTGTCACCTGG
GCGAGGCAGCTCTGCCGGAGAAGTCAGTTCTGTTTGCACAGCTTGGGTGATGCCAGAGCT
GTAGAGAGGGGAAGACAAGGAGGACTGGATGTTCCCTGACGCCTTTGGCGGGGGTGATTA
GCGTGGCATGACAGACCCTGGGTCTGTTGCATGTGCAGAAAAGTTCATCGAACTTGTATA
ATCCATGCAGGGGTGGCTTCCAGTAAAGGCTTGTCTAGGTTCTTTTGTAACTTGTGTAGC
CGAGGTCTGGGAGAGGCTGATGCCATACAGAAGTCCTATGCAGCACCTGGAGTGCTGACT
TGGAGGAAGGCTTTAGTTTGTCCACCCAGCCTCATTACACAGGGGGGCACTGGGCCCGCA
GCAGCCTGCCCAGGCTCAGCCCCTTGGCAACCTAGTAGTAGCCCATGCCCTTTGAAGGGG
CTGTGTCTGTTTTGGTCTGGAGTCTTCTGGGGCTTGGGCTGGCAGAGTCCCCACTCCCCA
CTGGGGGTGTGACAGGCCCTCTTCTGGTGAGTGGCTGGCTGGTGGAAGACTGATCTGGCC
TACCCTGAAGCCAGGTGACCCAAGCTGTAACATGGGCCCTACCTGGAGGCTCAGATTCTG
GCTGCTGCCTTTGACCTTGTGCTGCTGTGGCTGCATGCTGTGTTCTGCCTCAGCCACACT
GAGCTAGGTGTGGGCAGAGCCCACAGCTGGAATAGCTGACTGCCCCCTGCCTACACAGTG
ACTGGCACATCCAGGAGTCCTCTGGGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2019..2211, 2999..3167, 3810..3945, 4837..4995, 4998..5022, 5528..5688, 6188..6289, 6659..6754, 7091..7210, 7444..7488
1001..1003, 2019..2211, 2999..3167, 3810..3945, 4837..4995, 4998..5022, 5528..5688, 6188..6289, 6659..6754, 7091..7210, 7444..7485
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved