Microcebus_murinus Locus RPS3A
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPS3A
Microcebus_murinus
RPS3A
GeneScaffold_2408
SNORD73, SNORD73
3172..3244, 4338..4406
6073
AAGACTGTCTTAGCAGGTGGGGGTGGTAGGAGGTAGGAGATGGAGGCTAGGAGGACTGG
GAGGAATTCTAAGACTTAAAAGCTTGCTGGAGGCCTAATGAGTGAGGGTTGGTTTCTGGC
TTGGTCACACGGTTTTTTTTTGCCCCAGAGGAAGTTAGAGAAGGGAACTCAACACACTTC
TGGCTGAGTACCAAGCCTGTACGGCCAGACGCTTTCCATCTGCACACTTGAGCAGGGCAC
TTGAGCTAGTGGGTCACATCTTGCCAGGATATGCTTTGTTATACCCCTGCAGTTAAATAA
AATATTTTGGAGGGATCAGATGCTTTTTATTGAAAAATTGAGAGATTTCACTCCACTTAA
AAAAAACCCAAAAAACCTATTAATGTATAACAGACATATAGAAAAATACACAGCTTGATG
AGTGTTTACAAAGCACCATACCTGAGATTAATAACCAGCACCCATATCAACAATCAGAAT
ATTACTAGCATCCCTGGAGTTATGCTTATTTAATCCTACTAACAATCATATTACTGTGCC
CATTTTACATATGAGGAAACTGAAGGGTAGAGAGGTCACAAGGCAAAGTATTGTTGAAAC
AAGCATTTGAACCTGCGTCGGCTGTCGAATGGCAAAGCCCATGCTCTCAAGAATAGGTTT
GAGGGTTAGACAAAGAGTTCAGCTTTGAACTACGCTGAGTGAGCGTGTTCTTCTACAGAA
ACTTACTTCTCCACGGCAGAGCCGCAGAAGCCACAGGCGACCCAGACGCCTGCACCTCAG
AGCTCAGCCTCTCAGTGAGCCTGCGACATGCTGCGCGACCTCCCCACACACGAGGGCGCT
GTCGCATCTACAGAATGAAGAGTGGCGCTCTCCGTTGTCACGATATTCTTGAGGCCGGAA
GAGCAAAGGAGTAAAGGTCACGTAGACGGCGCGTCCCGCCCCGTACTTGTAAGTTCTCGC
GCGAGTTGTACTTCCGCCCTTTTGGCTCCCTGAGCAGCACCATGGCGGTCGGCAAGAACA
AGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGTAAGTAGCGACTGTCG
TGTACCCCTGCTTTTTGGGGTCCTGCTGGGATCTGCGGGCCGGTTCTGGATCACAGCATG
GGCCGGATGGCGAGGATGCCGGTTGGATTGCGCTGACCGAGGCGGGTTGGTGCTTCCAAG
AACGCGGCCTGGCGGTTCTGGCTGCCTCTCCCCTTACCTTCTGGTTCTTGCGCGTGTCGC
GTTTGAGCCAGGTTGCCACCGCGACTCGGGGCTGGAGCGTTCCATGTACGTGGGCCCACG
GGCCGTCTAAATTCCGCGGGCTTTTGATGCAGCTGCAACAGCAGGAGTTCGGGAAAGCAC
TGTCCTTGCTTAATCAGGACCCCGCACTCTGGCTGTGCTTGGGCCGGGTGGGACCTGGGA
CCTCCGGCTAGGCTTGCCTGAGGTCCTGAGGGGTCTTAGTTACCAGTACGTACTTTGACG
TAGAGGTAAAGTTCCTGAGATTGCGTGTTACTTGGAGGAAATGCTGCTTGTGTTGTGAAG
GGACCGATGAGGTTGGGGAATGAGCAAAATTTATTTTCAGAGTCTGTGGTCTGTACAGTG
AAACAGGCTCTTATTTAGTGGAAAAAGCTAAATTTACATATGCGCCCCTAACATCACTGG
TAGAAAAATAGTTTAGTCTCAGGTGGCCAGTAAGCCTTTTAAAATCTTGGTGGGGAATGA
TAGTGACAACAGCATTAGAATGAAGAAAGTAAAAAAAAGAATATATATCACAGAATTATG
TGATCTGCAATGAAACTTAATCATTTTTCCAAAATTTAGGGTTGATCCATTTTCTAAAAA
AGATTGGTATGATGTGAAGGCACCTGCTATGTTCAATATAAGAAATATTGGGAAAACACT
AGTCACCAGGACTCAAGGAACGAGTGAGTATCTTATTCTTGGTTTGTATTTTCCTTAAAT
TGGGGGATATATATTGTAGCTGGCATCTAGGTCTGCTGTTGGTCCTGTGATGGGAGACTT
TAAAGGAAATGTCAGCTTTCACACCTGTGCTGCTTGTTTTTAGTACGACACTGTAGAAGC
AAGGTGGAGCTTTTAGAATTAGTAAGAAAATGTGTATAGGTAGTTTTCAGCTCCTAATGA
GCACTGTTGATAAGCCATTGGCATCTACATGTTTATTAATGTCTAACCTCAGCTTATGTG
CATGACTTTCTAGGCTTGCCTTTGCTTATGTGGTTCTTGTTAGTAAGACTTGATTCTTGT
TTTGTAGAAATTGCCTCCGATGGCCTCAAGGGTCGTGTGTTTGAAGTGAGCCTTGCTGAT
CTGCAAAATGATGAAGTTGCATTTAGAAAATTCAAGCTGATTACTGAAGATGTTCAGGGC
AAAAACTGTCTGACTAATTTTCATGGCATGGACCTTACCCGTGACAAAATGTGTTCCATG
GTTAAAAAATGGCAGGTGAGACCAATAGTTCCCTTAGAACATTTAGTACTATGCAGTGTG
TGACCAAGGATGTCATAGTGTGATAACAGAAAGGAGCATATCATATAATTGTGGTTGAGT
TCACTTTAAATCCTTGTTTTCTTGTTATTATTGTTTACTCTGGAGTTGGCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGAGCCTTTGGTGTGATACTGAAATCTTGGC
TCCATTTCCCAATTGTGTTCTCTTTGGAGAGTAACTTAAGCTTGCTATGGTATGCCTTGG
TTTCTTTATCTGTAAAATGGAGGTAAAAATATGGTTTCATTGAATTATGAGGATGAAATT
AAAAATCCATGTAAATGTGCTTAGTATGGTGCTTGACATAAGATTTTAGTAAACAGTATC
ATTTCAGATGTGTCTGGCTAGCCACCCAGTTTTGCAATATTTTGTATGTGGGAATGAATG
ATGACAAAATGTTTCGGTCCCAAATGATACATACTGATTATACCGTTACATTTATTTCTG
ACATTCCCCTAAGTTGTGTGTTTTGTTTTTTGATACAAAGTCTTGCTCTGTAGAGTCAGG
CTAGAGTGCAGCGGGGTCATGATAGCTCACTACAACCTCAAACTCCTAGGCTGAAGTGAT
CCTCCTGCCTCAGCCACCCAAGTAGCTGGGACTACAGGCATGCATCACCATGGCCAGCTA
ATTTTCTTTATTTTTTTGTAGAGACAGGGTCTTCCTATGTTGCCCAGGCTAATAATTGAA
CTCGAGCTATCCTCCCACCTCAGCCTCCCAAAGTGCTAAGATTACAGCCATGAGCCTCTG
TATCTGGCCTTCCCCTAAGATTTTATCATTCCATTCCTGGAAATATTCTTAAAATCCCTT
GGCTGGAGAGGAAGACAGTTGAGGTGACTTGGTATTTATTTAATTGGATATGAAGGATAG
GGAGGATATGGAGGTAACTTCTGGTAAGTTCATGTTCAAGGAAGTTAATTCTATAAACTA
GATACATTACTTATTAGACTATTGCATAATGAATATTTGACATTCCACCTTTTCAAAACC
AGAACTTGAGAGAGAAGATTGATTAACATTAAAACCTGTTATATCTGACGGTATCTTTTT
TCCCTAGACTATGATCGAAGCTCACGTTGATGTCAAGACTACCGATGGTTATTTGCTTCG
TCTGTTCTGTGTTGGTTTTACTAAAAAGCGCAACAATCAGATACGGAAGACCTCTTATGC
TCAGCACCAACAGGTCCGCCAAATCCGGAAGAAGATGATGGAAATCATGACCAGAGAGGT
GCAGACAAATGACTTGAAAGAAGTAGTCAATAAATTGTAAGTGTTTCTTTCCTTCCTCAC
GCAATACACCCCTGAATATCTGATCCCTTGGATGAGGTGGAATCAGACCTCTGTTTAAAT
CCTGTCTATGGATCCTTCTAGCTTTATCCCTTTATGTGAGTGTAAGTGCACAGTAAATGT
GGTATGGTTTTGCTTTATCTCTTTTTGGATGATGCTGTCTCACAGCAGATATTGAGACTT
GAAGGAATAGGAAATGTCTTTGCCTTAATTAGTTCATAACACTGAATAGACAAAGCCTTC
CACAATTCACTGCATGGGCATAAATGATGAAAAAATGTTTCGGTCCCAGATGATATCCAA
TGATAACTGTTACATTTTTCTGATATTCCCATGCAGTATACTATAAGCTAAGAGAGGGTG
TAAATGGAAAAAGCATTAAGGCTAGACATCTTACATGAGGACTTGTGTGGGTTAAGAGGT
AAAGCGGTGTGTGTGTAGGTTTATTCTCAGGCTTCTCTGTAAAGGAATTGGCTTACCCCC
TTATGACTGAGAACAAGGACTTTTTAAAAAAAATTATTAAACTAATCTCCCATTACCGAT
GGTTTTTAGGATTCCAGACAGCATTGGAAAAGACATAGAAAAGGCTTGCCAATCTATTTA
TCCTCTCCATGATGTCTTCGTTAGAAAAGTAAAAATGCTGAAGAAGCCCAAGTTTGAATG
TAAGTGAGAAATTGCAGGATTCTTGAAAGAAAAAGTTGTGGGGATAAATAACATTGTGGA
GGTTTTTTTGTTTGTTTTATTTTTTGTTTTTTGGGGGGAGTAGGGTGGGGTTTGATAGCC
TTTTTTCCTTCCTGTCATGCCTGCATAGTATTAAAGGCCATTGTTTCAAGATACAATGTG
CTATCACTAACAAAGTTTTTTCTTCCTTTTAGTGGGAAAACTCATGGAGCTTCATGGTGA
AGGTAGTAGTTCTGGAAAAGCTACTGGTGATGAGACAGGCGCTAAAGTTGAACGAGCTGA
TGGATATGAACCACCAGTCCAAGAATCTGTTTAAAATTCAGACTTTTAATAATGACAAAT
AAAGTGTCCTATTTGTGATGGTTTGTTTCTGAACATTCTTTTTAAATAGTCTGACAGCAA
TCGGGAATCAGATATTCTGATTTGATAGCTGGTAAACTTTTCTGACTTGTGTGGATTTTA
TTAAGTAGTTAAAAAGGGGATACTCTTTACCATTTTAAGCTGTAGTGATCTGGAAGTGTT
ATATAAATGGTTAATGAAAGGAAACTATTCTACGTTTTAAAAATTTTGATGGTTCTCAAA
TTATTTGGAAGGCTTGTTAAAACATTGTTGGGCCCTGACGTCAGAGTTTCTAATTTAGTG
GTTCTAGGTGAGGCCTGAAGGTTTGCATTTCTAGCAAGTTTACAAGTGATGCTGATGGTC
CAAAGATACTTTGAGAACCAGTGTCTCAAATTGAGTAATAGGCAAGAACCCATTGGCTTT
TTGATTTTTTTTTTTCTTTGAAACAGAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTGC
TGTGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCTTAGGCTCAAGCGATCCTCCTGCC
TCAGCCTCCAGAGTAGCTGGGACTATAGGCATGCGCCACATATATATTAGTTGGCCAATT
AATTTCTTTGTATTTATAGTAGAGACAGGTCTTGCTCTTGCGCAGGCTGGTTTCGAACTC
CTGACCTTGAGCAATCCGCCTGCCTCGGCCTCCCAGAGTGCTAGGATTACAGGCGTAAGC
CACCGCGCCCGGCCTGATTTGTTTTTTTAAAATCCAAATACTATCTTCTGCCTCCAGCTA
TATATATAATAAAGTGAACAAATAAATTAGATGTAACCATACTGCTGTGTCCCTGCACTG
TGAAGCTGAATTTGGCAAGAGAAACTGGTTACTGATCTATTACCAGGTGGGTGTTTAGTG
CTGCCCACCACCAGTCACCCGTTCTGTGTTCTCTTTTCTCCTCAGATGTCCCAATTTCTC
ATTTCTTGCTTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1839..1942, 2287..2474, 3847..4055, 4629..4738, 4952..5073
1001..1062, 1839..1942, 2287..2474, 3847..4055, 4629..4738, 4952..5070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved