Microcebus_murinus Locus EIF5
snOPY snoRNA Orthological Gene Database
Microcebus_murinus EIF5
Microcebus_murinus
EIF5
GeneScaffold_748
SNORA28
2505..2629
7228
CGCCCCTCCGCTCTGCTCTCTGCTTGGGGCTCCGCCGGGGGCCCCGGTTCAGGGGACAC
GCTGGGAATGTGCCCCCACGCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGCCATTGGTACCTGTATTGGGGAAACATAGCATAC
AAGCAAGAAGCTTACAGCCTCAGTGGCGAAAATTTTTTCATGTCAGAGACCGAGAACTCT
TGCAGTCGTTTATGTCATCCCTTCTTCTCCAGACAGAAGATACCAAAAAGTTGCAATCAA
AGATCTCTTCATCGTATTGATAAAGCCACTAATAAGCCAAAATGTCTGTCAACGTCAACC
GCAGTGTGTCAGACCAGTTCTATCGCTACAAGATGCCCCGTCTGATTGCCAAGGTAATAC
TGATCTTCCTTTTTGTAGGAAGTTGATAGCTCTCTTCGTAGATTTTTAAAGATTGCATCT
CACAGGGAAGACTGCAAAGTTAAAATTCTTATTTCCTTTAGGTTGAGGGCAAAGGAAATG
GAATCAAGACAGTTATAGTCAACATGGTTGACGTTGCAAAGGCGCTTAATCGGCCTCCAA
CGTGTAAGTAAAGCTTGGAGAAGCCTGAAAGGGCGTATTATGGATACAGTCTTTGAACTG
CAGAACTTGGCTGAATTGTATGTTAATTAGCTTAAAGGTTGAGTGTGGACTTTTTCCACT
TGGAAAGTAGAATTTATTGATTACCTTAAGTTTACAAAACTAGGGCAACACATTTGTTTA
ACCCAATAATTAAAAAACAGTGATGCTTGTGTAAATATGGATGAGTAGCCAAAGATTAAT
TTAGTTAACTGTAATGATTCAGACTTTTTTCCCCCCCTCAAATAGATCCCACCAAATATT
TTGGTTGTGAGCTGGGAGCACAGACCCAGTTTGATGTTAAGAATGACCGTTACATTGTCA
ATGGATCTCATGAGGCGAATAAGCTGCAAGACATGTTGGATGGATTCATTAAAAAATTTG
TTCTCTGTCCTGAGTGTGAGAATCCTGAAACAGATCTGGTAAGTACCTTTGAGGTTTTGC
GAAAGAAAAATACATGTATGCTTTATCAGTTCTGTGATACCACTAAATCATGTTCCTGAG
AAGTCTGAACAGATGTAATTGTAAAAAATGCAAAACCTCAAGTTCATACTTGTTTTTTTT
TTTTTTTCTTTTTTTTTATTATTTTACATAGAAAGTACTGGAGTGAACATACTTGTTTTT
TTTAACAAGTCACTGTTCAAAAGATTTGTTTTGTAAAGCTGGTATTTTAGATGACTTCTG
AGGATTATATATTTTCCCAGAATTTTTCATCTTACGAATGACATACTTGTTTTTACTCTT
TTGGCAGCATGTCAATCCAAAGAAGCAAACAATAGGTAATTCTTGTAAAGCCTGTGGCTA
TCGAGGCATGCTTGACACACATCATAAACTCTGCACATTCATTCTCAAAAACCCACCTGG
TAAGTCTTCATGATGAATGCTAAGATCTTAACGTGAAACAACCAGTTGTTGGAAACAAAA
GTGAAAGGTGTTTTGTTACAAAACTGGAATATAAGGGCGCTGTAATCCTTGTACTATTTT
ATTAAATCTGAGGCTCCGTTGGAAAATGTACGATGATTTTACTTACCATTAAAGGTGAAA
AAGATTCTGCCATGTATATCTATTTTAAGACAGGTTATTTTAGAATGGATGAAATTATTA
TAAAACAGACTTATGTTGGGAATCCAATTAAGGATCTACTTCTGGTACTGTTTTGTGTAT
GAGGGCTTAACTCATTAAATTCATTAAATGTCCTTAGAGCATTGCAAGCAACACTCTGTG
GCAGATGATCAAAACTGTCTGACACAATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTA
TTCCGGTGTTCTCTTTCCGTGAGACAAGCCGTTATATAGACTTAAACAGTGTTCCAACTA
TTGGCGTAGCTGGGTTTTGAGGTAGGTCCTTGTTCAAGTTTATGAGGGATGGTGAAGGGG
GGTTCATCCACCTTTCACTGCCTGGTCATCTGTGGCATCACCAACTTATCTTAATCTTCC
CCAACAGTTAATACCCCCAGTATTTTGTCAGTCCATTCTTAGCCTGCGTTTCTCACCTGT
GATGAATTTGATCTGTGAAGAAGCCCCTTAGAGTTATAGATTGTGTTATGTGGGTTTTCA
GAGGTGATCCATAGCAGAAAGGCTGAGCTTTAAATGTGTATGATGGGCATTGAGGTGTAA
TATGAACTATGGAACTAAACTCCTGTTTTCCTTGTTTTTTCTTGCAGAGAATAGTGACAG
TAGTACAGGAAAGAAAGAAAAGGAAAAGAAAAATAGAAAGGGCAAAGACAAGGAAAATGG
CTCTGTATCCAGCAGTGAGACACCACCACCACCACCACCAAATGAAATCAGTCCTCCACA
TGCTGTGGTGAGTGCAGGGTTGATGGCATGGTAGGCACAAAAATTGCGTAAAGTATGTGG
CATTTGGTGGAAGTGGACAATGTCAACTGTATTTTGGATTCCAAGTGTTGCTGCTTCAAT
TAAATTGAATTTATTTTGGTAGGAAATTAGCTTGATGCTATTAACTTGACAAAATTTTTA
CTATTTTTTCTATTAAGGCCTTTGACCAAGCATTTGATTTTGTAAACAGGAAGAAGAGGA
GGACGATGATTGGGGGGAGGATACAACTGAGGAAGCTCAAAGGCGGAGAATGGATGAAAT
CAGTGACCATGCAAAAGTTCTGACACTCAGTGACGATTTGGAAAGAACCGTTGAAGAGCG
CGTAAATATCCTGTTTGATTTTGTCAAGGTAAAACATTTCCTAGATGTATAAATCAACTT
CATCTTAACCTTGGGCTTTTAGATGTTTATAGCTTTCAGCTGGGTAATTGGTAATTTTCA
TGATATCTTTAGAATATTCTAATGCAAGGCTTTTTTTTTTTAGCTTTTCTGTTGATTGAT
TAAATTCTTTTTTTTTTTTTTTTTTTTTGAGACAGAGTCTCACTTTGTGCCCAGGCTAGA
GTGAGTGCCGTGGCGTCAGCCTAGCTCACAGCAACCTCAATCTCCTGGGCTCAGCAATCC
CTACTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCACCACCATGCCCGGCTAA
TTTTTTGTATATATACTTTTAGTTGGTCAATTAATTTATTTCTATTTTTAGTAGAGACGG
GGTCTCGCTCAGGCTGGTTTTGAACTCCCGACCTCCAGCAATCCGCCCGCCTCGGCCTCC
CAGAGTGCTAGGATTACAGGCGTGAGCCACCGCGCCCGGCCCAAATCCCTTTATTAAAAG
GATTTTATTAAAATTTTATTAAAATTTGGATTCAGTCAAGGAGCCACACTTGGGGGATCT
GGAGGGCCACATGTGGCCTTGAGGCTGCATGCTCCCCACCCCTTAAATTGATCATAAGTG
TGATTGTTCAAAGGGATCACTTACTAGGTACTTCATAGTTCATTCGAGAATACATGAAGA
CATTTAGATCACATGGTTTTTTTCATATTTAGAGACCAAGATCCCTTTGCAAATCTCATG
AAAGCTAAGAATCTTCTCCCCAGAAAAATAGTCATATGTACATATAGACAGAATTTTGCA
AGGAATTTCAAGATGTTTATATCAATAGATCCTAATTAAATACCACCATCTCCGCTTTAG
ATTGACATATAGATGTATTTTGGTGATAATTGCTTTCTCCCTTTCAGATTTCTGGGTTTT
CCAGACTATTATGGTCTTCTACTATAGACCATATTATAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATGACTATTTGGATACTAGAATTGTCAACTTAGAACATCTAAAAAAGTTTGTTTC
CACAAATGTTCGAGTGCAAAAAAAAAAAAAAAAATTAAAAAAGTTTGTTAATGCCAAGAT
GTCTATTTGCAGTTCTGTCACAACAACAAAAAAGCTCAACGGTACCTTCTTCATGGTTTG
GAGTGTGTGGTAGCAATGCATCAAGCTCAGCTCATCTCCAAGATTCCTCATATCTTGAAG
GAGATGTATGACGCAGACCTTTTAGAAGAGGAGGTCATCATCAGCTGGTCGGAAAAGGTG
GGGTATATACTTAGTGATCTTATCAAGTTCAAAAGTATTAAAGAGGTGTTGATTTTTTTT
GGATGAAGTGATTTCTGGTCTATGTTAAAATGCAGTCCCTGAGCTTGACTGGTAGAACTT
GTAGGTGCTTCCCCACTGTGTCAGCTTTGTAGTCATAACAGCAGAAACTGCTTTAGAATC
TAATAAACGTATTTGTTGAATATGTCTATTCTGTTGAGGATTCAAGATTAAGATGACCTA
GTGCCCTCAAAGAGCTCAGAAGAGGAGGGGAGGGGGATTATATAAATCCAAAGTAAATTA
AAGTTCTTAAACTAAGAAAATTGTACTGAACATTTTTTAGGCCTCTAAGAAGTATGTCTC
AAAAGAACTTGCCAAAGAGATTCGTGTCAAAGCAGAACCATTTATAAAATGGTTGAAGGA
GGCAGAGGAAGAATCTTCTGGTGGTGAAGAAGATGATGAAGATGAGAACATTGAGGTAAA
CACTGGGGGAAGTGTTGAATGTGGTGTTGGCAATAGGTGTTTGAAATTAAAAGGTTTGTG
AGCAGTAATATAAAATGGGAATTTTAAGTAGCTTCAGATTTAAGGTGCAATAAAATGCAG
CCTCAGTATATTGGAAAATCATAATAGGGTGGTGGAGATTGCTCCTACCCACAGATGTTA
TGGTCTATAAAGACTAAAAAGATATGTTTAGACTGTAGAGACCATGTCAGATAACTTTTA
AGTTTTTCTATTAACAAAACTGATGAAGAATGATAGCTGCATCTAGGCTGTTTTCTACTT
TGTGACCACAATTTATATTTATTTATAAGCAGGTTTATTGGGACAAAGGTTTGTAATCAA
TAAAATCGTTTTTTATCAGGTGGTGTATTCGAAGACTGCCAGTGTACCGAAAGTTGAAAC
TGTGAAGTCTGATAACAAGGATGATGACATTGATATTGATGCCATTTAAAGGGATGGATG
CAACCTAGCTTAACAATGTAATGCTGCAAATTTTTCTCATTTATCAGCCAGAAGTGCAAC
ATGTATGTGCAAAAAGCTAAAATGGCTTAACATCATGCTACACTTTATACTAAAAATCTG
TTACTGTGAGTGGTCTGTAATTAAGCCCAATGAGACATCTAGGGAGTCCATACACAAATC
AGTGAGCAGATGTAGTTTGCTTATTTATAGCATGTTTCTTTTTGAAAAACTAGTGGTGGA
CACATTTGGATCACATTTATACAGTTATAAAGATATTTGATTTTGGTCATTCTTCAGATT
TTTGGCTCTGAATGACTTAAGCTGAAGCAATAGGCTCCTTTTTAAAATGTTGCACCATTG
TTTAACTGATAGCATTCTTGGAGCCTGTTAGGTATTAGGTGCTGAGACCATAAAGAGGTC
TTAAGCAGAAGGTAAAACAAACTTACTTGTAATTACCTTAATTCAGCCATTAAGAAATAT
AGTACTTTATAAGTTTCCTCTAGTCCCTCAAATTGGCATCTGATAATGTATATTCTGAGG
TAAACTGAGACAGTACAACATCTTACTGAGAAGTAAAAATGTTCTGAGTGTCCTATAAAT
AATTGTAAGAGCAGGACTTGAAATTTGGAATTGTGTTTTTTTCAATTTGTGTACACTTGC
CCCCAATTTGTAGTCTTTGAAGTCATGTGCATTGCACGTCGGATGAGCCAGGGAAATTAT
TACATTAACAAATAAGCATTTTATGTGTATGTAGTGGTTGCTTTGTACTGAGATAAAAAC
TCACTTTGGGGTGTGATTAAATATTAAACTATGATTTCTACTTGGGGGAAACAGGAAAAG
GTGCACTTAATCTCTGGCAAAAACTAAGCATAATTTTTCAGCTTTTGTCCTTATGGTTTA
AATTATAATTTCAAAATGTTTAGACTTTATCTTTTGTTCGGTGTGGGTTTCTTTTCCCCT
TATGGTTTGTTCTTTAATGCCTTTTACAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 1181..1262, 1545..1717, 2047..2158, 2987..3126, 3349..3507, 4651..4812, 5112..5276, 5620..5754, 6139..6228
1001..1072, 1181..1262, 1545..1717, 2047..2158, 2987..3126, 3349..3507, 4651..4812, 5112..5276, 5620..5754, 6139..6225
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved