Microcebus_murinus Locus RANBP1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RANBP1
Microcebus_murinus
RANBP1
GeneScaffold_685
SNORA77
6935..7057
8511
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCCCCCAAGAAAGCCGGCCCCAAACCCTCGC
CCCCCCGTTTTTTGAGTCCCCCCCCCCCCTTTTTCCCAAAAGTGTGCCTTCCCCAAGGTT
TTTGGGTTTCCGGGAAAAGTTATTCCCCCCCGCCCCGGGGTGGGGGTTTCGGGCCCCCCC
CCCCCCCCCCCCCGGCCATTTTACCAAAGCCCTGGGGGGCCTGCGGCTGGGGACGGAAAA
TGCGCGCGGGGAGCTGCCGGGAAGAGCGCGCTTTCCCTGGCTGCGGGCGGGCCCGGGCAA
TGCGCCACCGGGCGTTTTGGCGGGAAGTGCGGGGCGGGCCGGACAATGAGAGTGTCCGCC
GCATGAGCCAATAAAGCTGCGCTGGTTTTGAATCGCGGCGCGTTTCCCGCCGCCGGGGTC
AGGGGTCGGGGTTCGGGTCGCGGGGCGGAGGGAAGAGCGAGCGGGCAGGAGGCGCCGGCG
CTAGACGCGGAGGGAAGGAACTAGGAGTAGCCGCCGAGAGGCCGAGGAGCCAGCGACGTC
CGAGCCAGCCGAGCTGCTGCCGCCGCTGCCGCCGCGCCCCCATGGCGGCCACCAAGGTGC
GGCCGGCCCCGGCGGGGACGTGGTGGGCAGACGGGGCCCAGGGGGCCCGGGGCCGCTTAT
CGGCGGCCACGTGGGCGGCCCGCGCCGACACGGCCAACCCCCGCCGGCCTGCGGGCTCGG
CGCCTGCGGGGCCTTCCTCACGCGGGGCCTGGGAGCTCAAGGCCTGCGGGCCGTGGTGCC
TGGTGTCTGGGGGTCCGGAGCCCGAGGGCTGCGGCACCCGCGTGACCTTGGGGTGGGCCA
GGGAGCAGCTATAGCCGCGCAAGGCCGCCCATTCACTGGGGACCGAGGTTGGCGGCCGGT
TTTCTCTGGCCCGGCCCACTTGGGGTTTCCCAGTAGTACGGTGGATGGTCTCTCCGTCGC
CCACGCAGCACTTCATTCATTCAATCCCGACGTCTGGAGTCGCCACCAGCCTCTGTGGGA
GAAACCGCGTTCCAGCGGCGGCGGGGGAGGGGGGGACGGGTCCAGGACGTGCCAACCCAG
GGTGGGGGCGGCTTTGTTGGCTGCCGGTGTCTGGCTGGGTGCGTGCCGCGACAGAGCCGC
AGTGCTGTTGAACTGAAAAGAGCAGCTTATATTTTCTTTTCCGGTTTGATTCTGGTGGCT
ATGTTTTGGGGTCTCTTGGGGACTTTTGGGTCACCGAGGCACGTGTTCTGCAAGAATTGA
ACCTATATTTGATTATTTGTGCTCTGTGATTCTCTGAATTGGCGGAGGGTTTTATGACTT
TGACTTGTATGATTGACCTACTAATGAATTTAATTTTACAAACTATGAGAAAACTGCTAA
CGAAATTGTGAATTCCATGTAAACACTAGTAGTTCTATAGCAATATTTTTTCCTCTAGTA
AGGTAGAGCCCAGGCATTTCCTAACTAGTGAAAATGGAAAGGGTTTCTGTTCCCTTTAAG
GGTGACGTTCTTAAGATTCATCATTGTGTCCCTTGATCTTCACACAGCAGGTATCTCCTG
CATTTTACAGATGAGGAAACTAAGGCAGTTTCTCCCAGGCCACTCAGCAATTTTCAGGAG
CCCCAGTCAGTCTGTGCACAAATCTGATTGATGTTTGCAAATGGGGGCAGGGATGCAGAA
ATCTAGTGTCTAACCACAGGCTTGCCTGGTGATCTCAAATGCAAACCTTTCCTAGAGTGA
AAGGCTGTGAGCTGAGTTTCTTACTTTAGAGTTCAAAGGCTCTTCATTCACTGTTGGCAT
GTCCACTACGGGCACTGGTGGGGCTCTGGTTGTGGGCCAGGTCTGGAGGCCAGCAGTGTC
ACTCACCTCTTTGTATCTCCCTCCACAGGACACTCACGAGGACCATGATACCTCCACTGA
GAATGCAGACGAGTCCAACCACGATCCCCAGTTTGAGCCAATAGTTTCTCTTCCTGAGCA
AGAAATTAAAACTTTGGAGGAAGACGAAGAAGAGCTTTTTAAAATGTAAGTAGACTGATG
TTCCAGAGTAGGTATCTTTAGAAGTTATGGTGTTTGGGTGTCAAAGTCTTGCTTGGCCTG
ACTTTTAATCGGACCGAAGCTGTTAGAAAGGGCCTAAAATTGTGTGGTGCTTAGAAATTC
AACCTATTCCTTCACCAAATCTTCACCAGGTTGCCCCCTGGCCAGTCACACAAGGGTGTC
TCACCACTGCCTCTCTGTCTACAGAGAGCACACTGCTGGGTCCTGGGTGTCCGGGTCCCC
AGCCTGACATGCAGCTTCTGGATGGGAAGACTGGGTGTTGGCTTAGAGCCTGGTTGTTGA
GCAGAGTCCCAGGCTCCCCCTGGGGCCGGGGGAGAACAGAGGGCATCTTAAAGTTGAGGG
AAGGTCTGGCTGGGCCTGTGGAGGCCTTAGCCTCCCCCTGCTCCAGTTTGTCCCCGTGGG
TCTACAGGCCTGAGGGGTGCACCTAAACTGTGACTGTTGGACACCCAGCCCACCTGGGAG
CTTCTTTACCCGCTTTGGGTCATTTGCATGTTGCTTAGAGAAGTCAGGGGTTTCTGTTGG
GGAAAATGTGACTACAGACATCTTTTTTTTGTTTTTTGATTGTAAAATACAAACGGCCCA
TAATTTGTTGGGCTGTTGTGCTCTTTGGAGTGATGTTTTTGCAGCCTGAGAACGGAAAGG
GTGTTTGTTGAGACGCCGGGTCCAGCAGTGCAGAGTTGTGCCATGTGTTGAGTGCAGCGA
GGACAACGGTTCTTTCTGCGAAAATGTTTGGTGCCTGCATTCCCCTCTGTGCATGTCTAA
GCTTTTTGGTGGCTTTTCTCACAGGCGGGCAAAGCTGTTCCGGTTTGCGTCAGAGAATGA
TCTTCCAGAGTGGAAGGAACGAGGCACTGGTGATGTCAAGCTCCTGAAGCACAAGGAGAA
AGGGACCATCCGCCTCCTCATGAGAAGGGACAAGACTCTGAAGATCTGCGCCAACCACTA
CAGTAGGTGGCCTCAGGCTCTCTGTTCACATCAGGTCAGCTTGGGGCCTTCAGGAATATT
CTTTCAGGACCGACTGGGAACCAGGGAGCATGCTCCTACGTGGAGTGCACATAAGAAGTG
CGTTTTCCAAATGTGCCTCTGAACTAAGAACAAGCCTGCATGAAACTTATAAAACATAGG
GGAGGTATGGAGTCTAGCCAGGCAGGCCCTGCTGGGTGACACAGAGCCCAGATAGGGCTT
GGGACATGGAGTGAGTGCTGCAGGACAGATTGAGGGCCAGCAGTGTGCCTGTGTGCAAGG
TGCCTGGGCTCTGTGTGACAGAGTGTGGGGGGGGGCAGGTATGTGAGAGTGTTGCGTGTG
GCATCTGGGCATATGTGTGGTTTCTGAGATTGTGTTTGTGGTACCTGAGCACGTGTGTGG
TGTCGGAGTCTGTAAGTGTGTCTGTGGTGTCTGCGTGTGCGTGTAGTGTCTGTGTAGTGC
CTGGGCTCGCTCTGTATGGTGTGTAACTACATGTGACAGAGGGTGTCTGGGTGTACCTGT
GGTGACTGAGCCTGTGTGTGTGTTGTGTCTGTGCATAAGTGTGTGTGCAAGGTGCTTGGG
CGGCAGCCTCCCAACCTTTAGTGTTCCACTCCCGCTAGGACCTCTCCTGGGGAGGACACG
GGAGGAGGACGGGTGGCCACTGAGTCCTGGGCACCTGTGAAGCTGCACCGGGTGTGAGTG
GAGGCCCTTGGGCAGGTGTGGCCATAAGCCCTAATCACCCTGTGCGGGGGTCAGGGAAGG
GCCACAGGAGGCCCCGCCTAGAAAGAAGTGGCAATAGGTTGTCCCCAACTCATACAGCTG
CCAGCTGCCTGCAGGCTGAGCTTGTGCTGCCCCTGCTGGGGGTGGGGCGTGTTCAGAAGC
ACACTTGTCCTGGGGAGTCCATTGGTAAAGCTCTGATGTCGTGTCTGTTTGCTGAATATA
ATATGTGTCCATTAGGGACGGGGCCCTGAGTCCTGGGCACACAGGGTGACTGCTAGCAGC
AACCTGAGCTGAGTGGCCCTTAGGTGAGGCAGAAGGATGGCCAGCTTTGCAGGGGCCCTA
AGAAAGGGACAGGGCACCCACCCCACCCAGCCTCATCCTCAAGTCCGGGTTGAATCATTT
CCGTGGGGTCTTCCCTGATGCCCTATGCTCCTCCCAAGCCTTGCTGGTTGCTGGGTTTCT
GTGAGAGTTGTCAGTCCTGGCATCTGGGCAGAGCCTCCTGTGCGGTCCTTGGTGCCTGGT
GCATGTCAGGGCCCTCAGTGGACAGGGATGGTGGTGGTGGGTGGCAGCAGCATGACCAGT
GGGGCGTGGGTGAGGCTGGCAGGTGGCCTGGTGTAAGAGGTGTAGATGTGGATGGGGACT
GCGTGCAGAGGCCTGGTAACTGCCCTGGGAGATCCTGAGCTTCCAGTTTACACGGTGACG
TGTAGATGGCCAGGGCTGGGCATGGGCGCACCCCACATTCTCAGAGACCTGCCAGGGGCA
CGATTTGTTCTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTGCCCAGTAACCGACAGTCTGGGGCTGAGTGAACCTCACTCAT
GTCCTGGGAGTGGGGTTGTCTCCTCAGCCCTTCCAACACAAGTGAGGGGTGGAGCCCGTG
GCCAGGAGGTCCCATGCTTTGGGCTGCTCTTTCTAAATTGTACACAGTCAGATGAAGGGA
GACACAAGGCTCAGCACAGCCCCCAGCCTTGGGACGGACTCAGAGGTCACTGCCCAATTC
GGCTGAAAGCCCAGGGCCCTCTGTGAACCCCAGGTCTTCAAGTCCACAGGGCATGTCCCC
TCCACCACTCCCAGCTCTTAGGGAGTCATTTCTTTTCTTCCCACAGATGCACAGAAATTC
AAAACAAAGTTCGAAGAATGCAGGAAAGAGATTGAAGAGAGAGAAAAGAAAGGTGGTGTG
GTGGCCTGGGAGGGTCCTGGGTGGGGGGCTTCCTCGCAGACTCACTCTGCATCCGGCTGC
ACTTCAGATGGGTGCTTTTTCTGTCTGCCAAAGAAATATTCCGGGTGCTGTGGCTGCCTG
ACTTGTCAGGGGCGATGCAGCTGCCTGGGGACACAGGGTGCCCAGTGTGTCTGGTCTCGG
GTCCAGCTGGGCAGGCGGTTGGCCCACAGTGCTCTGACTAAACTGACCAGAGGCTAAAGG
TGCTTTGAGATAGTCCTTGTGTTTCTTTCTCTCAGAGGCTTCAGTCACCTGCCCTCTTGG
GTTGGGGGATGGCTGTGGTAGCAAGTGGCCAGATACTACTGAGCAGCCTGCCCAAAGTCT
AGGCAACTTGTGGACGTGTGTTTACATGGCCTCCTTTGGTCACACCTCTGGTGGGGGTCA
GTCCTGAGGGCCCTGGGGGCCGAGGCAGGACTGCAGTGTGGACTAATGCTCCCTTCCTTC
TGTTTTCTTACTTTGCTTGCTTGTGTTCTAGCAGGATCGGGCAAAAACGATAATGCCGAA
AATGTGGCTGAAAAGCTAGAAGCTCTTTCGGTGAAGGAGGAGACCAAGGAGGAAGCTGAG
GAGAAGCAATAAATTGTCTTATTTTATTTCCTTTTCCTTTCTTTTTTCTTCTTTTTTAAA
ATTTTGCCCCTCCTTTTCGGTTTTATTCTGTTTTGTTTTTACAAGGGACTTTATATAAAG
AACTGAATATCAACATTCAGGTTGGTTTTTTTTTTTAAGTTTTTGTCCTATTGAAGACGA
CTTCAGAAAATCCATTCCCCAGTCATGAAAATGTACTGTGCTAACTTTCTTTTCCATAGT
GGAAACACTTATTTATAGTCATCAAAAATAGTGAATAAAAACCACATTTGGAACCTGGAC
GGGTGGCAGGACTGTGTGTGCGGCTCCATTCTGTGGGTGGTGCGGTTCCCACTGGCCGCC
AGGGTGCTCACCTGAGCCCCCAGGTGTGCGCGGCTATGGCAGGCACCACAGTTCACAGCC
AGGGTTCTCTGGAGACTCGCTCTGGTGTTGCTGGGCTGTGTGCGTCTTGTTGTGGGCCGG
TGCTGGAGAGGCAGCCTGGTGTGGGCTGGCAGTGTGCGCTGCTGCCGAGGGTCTAGGTGG
GGCTGGTGCTGGGCCTGAGGTGTGCTCTGCTCTGCCCCGTGGTGAGTAGGTAGCTGGTGG
GTGGGTGTGTGAACGTGTGTTTGGGGGAGAAAAAGGACGACCACCAAAATACCTCACTTT
GGCACAGGGAGGTGGTAACCAACTGAGCAGGTTTCCAGGCATTGCCAAGACCAGCTTTGG
CCGAGTTCTGGTGGGGGGAAAGGCTGGTCTTACAGCATAGGTCCTGCCTGGTGTGCCAGG
TGTGGCTCGGCCACACAGCCCTTAATGTCAGAAACCCTACCACTCTCCTTGGAGAAAACT
CCCAGGATCTTGGCCTCCCTGGACTTGAAGTCCAAACTGCTGCAGTGTTGGAATTGTGCA
CATCTGCAACAGTTTCAGATAGACATTTTCAAGGATGCCATGTGGCAGTTTGTCTGCAGA
CATCTTAAGTAGGGGAGAAGGGTTTTCAGGTTTTAGGAGAGGTCTTAAGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2308..2444, 3264..3421, 5651..5779, 6826..6891, 7411..7511
1001..1015, 2308..2444, 3264..3421, 5651..5779, 6826..6891, 7411..7508
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved