Microcebus_murinus Locus RPL39L
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPL39L
Microcebus_murinus
RPL39L
GeneScaffold_4573
SNORA69
10027..10158
11652
TACTATGAAACCATCTATGATTTCTACCGGTGACCAAATCAGAGGTATTGCTAACGTCA
CTGTAGTCTGTTCATACATTCGTAAATAAAAAAAGCGTTAAATCTCAGTTTGGTGAAAAT
AAAGTTTTGTTTTCCCATCCAAGTTCATGGACCCTCTGAATTCTATACATGGACGCTTGT
GGACTCCAGGTTAAAAACCCTTACCTTAATCCATTGGTGCAAAAATGCTTGAGGTGACTG
CAAATATAGAGGTTTTTGTTTTTAAATGGGAGAAGATAAAAACGGGGAACGCTAGCATCC
CAAATGCATGCTATTAATTCTTGTACATCTTGCCAAAGGTCGGCTACAGTGTCAGCATGG
ACTTTCTAGAAGCTAAGGAGAAGCTTCTGCCTCTCACTTTCTCAGCTTTAAACCATGATT
GGCAACCTCTTGCCCTGTCTAAGACTCCAAAGCCGTCCCTAGGTCCTGCCCCTGCCGACT
TCTCTAGCTTCCTCCCACAATACCGTCCCTTCCTTCCCACACCTCCCAGGCAGGGCAAAA
CTACTCTGGGAAGATGCCCGGTTGCTCTCCGCCTGCCCACCCCGGCCGGGCGTTCCCAGT
CCCAGGCACCCGGAGGTGACGGACACCTTCCCCGCCCTCCCTTGGGTTAGTCCCGCCCAT
TCTGCTCCCGCAACTTTCTGGAGGGAAAGTTAGCACTAATCACCGGCTGTCTGCCTCACC
CACGAAACGGGGCGCCCCAGCACACTGATGGGATCCTGGGGAAACCCACTTAAACGAAAA
GAAGTATAGAGAATTCCACTTGGCACAAACCAGCGCACTTTCCGCCAGCGCCTCCCGCGA
GCACGCGGGGACGGGGAGGCGCTAGGAAACGTTGGCCGGCGCGTGGCGTCACCTCCTAAG
CCCCGCCCCCGGCGGCGCCTTCTAAACGCGTTTTTCCGGTTTCTTAACTCCTCTTTCTCC
CTTCGTCCGCCATCGTGCTGCGTGCGTTTGACTCTCTCGCCATGGTAAGTCAATCGGCAG
CCATCGGCTCCGGAGTGGCTTCCGGAGCCCCGAGGCCGCCGTGAGGTCGCCGGGGCCGCG
CTGAGCGTCGAGGGGCAGGAGCCCTTTAAGGGCTTTCTTAAGAGAAGTTCGAGTTTTGTC
CCCGATGTAGTCCGCGGGCCTGGTGGGATGCTAGTTGAGCAAAGGAGCGCCTGGGAGGGG
CGGACTGCGCTGGCGTCGCGGGTTCCACGGGGTGCTTTGTTCTCTGGGCCGCCACTGAAG
GGGACAGGGATTCCCGTTTCCCTTCGCATTGAACGAACTGTGACTTTGGCACAGGGAGAG
AGGTTGGGAGGCCACCCCAGAAATAGTGACCTGACTACGTCTGCCGGTGCCTGGCATCGG
AGGGGAGTGTGGGCTACTGGTTTTCGGAAAGTTTTTAACTTGGTGCAGGGGAGCCTACGA
CGTTATTAGGTTACAGGACTTTTGTTCAGAAACCGTTTGTACGCAGACTTGAGCGTCACC
CCGTGGAGGCACTGGGAACAAGAGGTGTTGTATGAACTTATGTCATTCGGGAGTTCTTAG
TAAATGACAACAGCGAACCTGTCCCTGTCGTAGATTTTTCCTGTAATAGTTTACAAAGAA
ATTAAAACGTTGATTGGCTTTTAGGTATCGAGGGGATCAGTATCGGTTGGTTTATTGCAG
TTAAGATTCACACCAAAATGGTGAGTGGGTTAGATCTATTGAATGTCAAGGGCTTTGCAT
ACATCTTAACTACCCTTGCAGTGACAGTCTAAAAGTGAGTACTCCTATTTTACAAAGTTG
GGCACTGAGACTCATTAACTTGCAAGTGATAGGTGGGTTCTGTTTGACCCAAAGCTGTGT
TTTTTCCAGGCAACCAGGTTCCCAGCCCTAGCTGTTCCCAATGTGGTCATTTTAATCCTT
GAGTGATGACAGGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTATTCATGTTCTTTGCCCACTTTTT
GATAGGGTTGTTTCATTTTTTTCTTGCTGATTTTCCTGAATTCTATATAGATTCTATTTA
TCAGCCTTTTATTGGCTGTATAGCATGTGAATATTTTCTCCCATTCTGTAGAATGGAAAA
CAAGCACCACATGTACTCACCATCAAATTGGTATTAAATGATCAACAATTATGTGCACAC
ATAGGAGTAACATTCATCGGGTGTCAAGCAGGTGGAAGGGAGCAAGAGGGGATGCATGTA
TTTCCACCTAATGGGTGTGGTGTGCACTGTCAGTAGGGTGAACATGCTTGAAGCTCTGAC
TTGGGTGGGACAAAGGCAATATATGCAACCTAAATATTTGTACCCCCATAACATGCTGAG
ATAAAAAAATAAATAAAAAGAATATATGACCAACTATCATGACTCCATAATAAAAATAGA
AATAACCTACTTAAAGAGTTGGCAAAGGATTTGAACAGATCTCCAAAGCAGACATACAAA
TGTCCAATAAGCATGTGAAAAGATGCACAACAACAGTCATGATGAAAATACAACTCAGAG
TCATGATGACATAACACTTCACATATACCAGGGCTATGATAGGCAAAAAGACAGACAAGT
GTTGGTGAGTATATGGATAAATGGAAATATTCATACATATTTCATGGGAATGTAATATGA
TGCAGCTTCTATGGAAAACAGCTTGGTAGTTCAATAAGTAGCATATAGAATTACCGTATG
ACCCAACAATTATACTCCCAGGTATTATACCCAACGAATTGAAAACATACATTCATACAA
AAGCTTGTACAAGAATGTTCATAACAGCATTATTCAACATAACCAAAGGAATGGAAACAA
AGCAAATGTCCATCAACTGATAAATGGTAAACAAAAAGTAGTATACACATACAATGGAAT
ATTTGGCAATAAAAATGAATAAAAAGAAAGGAATGCTATAATATGGATAAACCTTAAAAA
TATTATGCAAAATAGGCCGGGCGCTGTGGCTCACGCCTGTAATCCTAGCTCTTGGGAGGC
CGAGGCGGGCGGATTGCTCAAGGTCAGGAGTTCAAAACCAGCCTGAGCAAGAGCGAGACC
CCGTCTCTACTATAAATAAAAAGAAATTAATTGGCCAACTGATATATATATATAAAAAAT
TAGCCGGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGAAGG
ATCACTCGAGCCCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACGCCACGGCACTCACT
CTAGCCTGGACAACAAAGCGAGACTCTGTCTCAAAAAAAAAAAAAAAAATATTATGCAAA
TGAAATAAGTAAAACACAAAAGTTCACATATTATCTTATCCATTGATATACAATTTAGCC
CAATGCAACAGAATAGAGAACCCAGATATAAACTTATAGCCAACCAATGTTCCGCAAAGG
TATGAGGAGCATACATTAGGGAAAAGACAGCCACTTCAATAAATAGTGCTGAGAAAATTG
GATACCCATATGCAGAAGAGTAAAACTGGATCCTTGTCTCTCTCCATAAACAAAAATCAA
CTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCTGCTGTAGCTCTCGGAGATTATTATCGGTGGCTACAGA
GAGCTGTAGGTATTGTTGATTGGAGGTGACTAGAGAGGCTATGCCTGTTCCAGCCCCTGT
GGCACCAAGGCCTAGAACAACTGCGAGTGTTATGGCCGTGATGGGTTCTCTCTTTACCCG
GGGCATTGTGGTGCCTCGCTCCCAAAACTGAAGTAACTCATTAGCAGGATGTATAGTGAG
TCTGGGAAAGAGCATGACTAATACACAATACTCTCTATGCTCAAGAAACGTTGCAGAGAC
TACATACAGGGTAAGGCCGGAGGAACAAGCAAAATAAGAGGTGTTAGATGCCTGAATATA
CTGAAAAGTGGAGTTGACAGTAATTGACTGATTACATATTTTTTCTAAGGGTGCGGGAGG
GAGCATTCTTGGGCTAAGAAGGCAAAGACCTAGGCCTGTGACTTGGCTGAGCGTCAGGCC
ATCATGGGTCTCTAGACCCCATCTGAGTCTGCTGGTGTCATTAGTAAATAATGGCTCACC
AAAAGTAGCGACGCCTTCATAGAAGGGAGGCCGGGGGGAGTAGCATACCCAACACTCCTG
ATATTCTGAATTATTGGCCTCTCGGATGGTCCTGATAGAGGCGTTGACTAAGGAGAGAAT
TAGTTCTGCCGAGGAAGGGGGCCCCTCGGGCAGGGTAGGTTGGTAAAGGGAGGTGCTGAG
CAGAGGAGGGGACATAGTTGGGGAGGAGGGTAGGCCCCTGGAGGGACCGCGAGGCCGTGG
TGGGTGTAGGTTGTTATTAGGGCCTAATGCGACAGTAGGACCTCTGGGGAGGCTTTTAAT
TAACTTGATTTTAAATGTGAGACCAATATCTCTCCCAGATATGTAAAGTCTGAGCCCCCA
TTCAAATCCCCTGGACTGGTCCCAAGAAGCCTTTTTTCCAGCTTCGGTGAATGAAATTAA
CAGGGGATTGCACCATTGGTTGTTACACTGAGGATCAGTGGGTGGTTGTGGGGCGTAAGG
GAACGAAGGAGCTTGACGGGGAAACTGCTTTCTGACGGTAATATAATCCCAGGAAGAGGA
GGGATTCCAGTAGGTATCACCGGTGGTCTCACAGCCCCAGGAAGCACAAAAGAAGTCAGG
GGCGTAACCACATTGGTGGTTGTTGGTACGAGGTCGAACATAAAAATCTTTATGGGCAAA
CATAAAAATCTTTATATCTCGTCGCAGAGCGTCCGGCTCCCAAGGAGCAAAGGCCTGGGG
AGGAGTCAGCCGTTGGAGGAGCTGGCTGAGGGGTGAAAAGTGCGGGAAGGCCCCACGCAG
GGTCTTTAGACCCAAGAGCTAATACGCATAGGTCAATTTCTAATGGATCCCATGGTATAA
TGGCGGAGAGATGTGAGGAGGAATTAACAACGTCTCCTGCCTCATTAATTACCTGCCATG
TATAGTTGTAGATCTGATGGATGTTGGTTGCGATGGTGCTCTTGATCACGACTAGAATCA
GGCATAGGAGAGGCAGCGCCTTTTCTCGGGGAGTCATTGTATTTCTGGAAGAGAACAGAA
TTAAGAATTCTTCTCAGGGGATTCCCTGGGTGGGTTATATAACTTAATTGCTCTCTCTGG
TAGCCATCTGGCGTTTCCTGCCTGGGTATCGTAGATGCAGGCATGTCTTTTTCCCCATAT
GAGGACAGGGTCAGGCCCTAGCCATTTGCCTGTAAGCGGCTCCTTCCATAAGGCCTGTGC
ATAAGTATCTGTGGTGGATGGGTGCCAAAGGTGGTCCACGGCCGTTTTACCGGCAGTGTC
AAAGGTGAGAAAGTTTAAAATGAACAGGGCATGATTAAGCAGGGTTTTGGAATTACCTGT
CAAAGGGTACAAAATTCCTCCTCCCGATTGTAATTTGGAGAGCGTATTTTTTAATGTCTG
ATGAGCTCTCTCTACAATACCTTGGCCTTGAGGGTTATATGGGATGCCTGTAACATGCTT
AATGCCTAACTGAGCACAAAAACTTTTGAAATTGGAGCTGACATATCCCGGGCCATTGTC
AGTCTTAATAACTTTAGGCTGAGGGAGGGAGGTGAGACAGGCTATAATATGGTTGATAAC
GTGGCGGGTGGCCTCGCCTGTTTGTAGGGAAGCAAAGATAAATCCACTGCAAGTATTTAT
AGAGACATGTACATATTTAAGCTTTCCGAAAGAGGGGTAATGAGTGACATCTATCTGCCA
GAGCTCCCCAGGGATCAGGCCGCGAGGGTTGACTCCTAGGTGTGGCTCAGGGAGAAGGGT
AAAACAAGCCCTGCATTGGCGGACGATTTCTCTGGCCTGTTCTTTAGTAACGGAGACTCA
TTAACTTGCAAGTGATAGGTGGTTCTGTTTGACCCAAAGCTGTGTTTTTTCCAGGCAACC
AGGTGCCCAGCCCTAGCTGTTCCCAATGTGGTCATTTTAATCCTTGAGTGACGACAGGGT
AGACTGGAAGGTGCCCCTGGCTGTGGAGCAGAGAGAGCCTAGGTTTGAATCCCAACTCTG
CACATTAATACTATGATTTTGGGTGGGTTACTTACTTCCTGATTCTGCTTATTTTTATTT
GAACGATGGAAACTATGGTATCTGGCTTCAGAGAAGTTGTGAGGATCATAGGATGTGATA
GTTTAGCATTTAGAGATATTTTTGGAGTACATTAAGCACTTGGATGTTGGATTTGAGAGA
GTTCTTGAGTTTGAATCATTGGGCAGGCTCTAGTATCACTGTCTGAATTAATTGCATTTC
CTTCCCAGTCTTCTCACAAGACTTTCAGAATCAAGCGGTTTCTGGCCAAGAAACAGAAGC
AAAACCGTCCCATTCCCCAATGGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAGGCTG
GTTTCGAACTCCTGACCTTGAGCAATCCTCCCTCTCGGCCTCCCAGAGTGCTAGGATTAC
AGGCGTGAGCCACCACGCCTGGCCGGGAAGACTAATTTTTTGAAGCATTTATCTTTGCCG
ATGATTAGGAAACTGCCCTCTACTGCAGGAGTAGTTGAGTTGATCATTTTGGAAGAAAGA
CATTACTAGAATAGCTATAAAGGACTTCCAACATCATGCTGGCTAGGTCCAGGCAAAGGT
AGACCTAAAACTCAGGTCTTCTGCATGCCTTTTAGTCCATTATTCTTTGGACCATGTGGG
GTTTAGAGATGGGTCTTGAGGGGAAGAAAAATAAACATCAAAAATAAGTGCAATTTGCCC
AAGGTCCTGTAGCCAGCAATAGTCCCCAGTGTGTTAAACAACTTTCAGGACTTAGGTTTA
AAATGAAATACCTAGTTTCCTGGCTGTCCCAAATAAGCTGGCATTTTAGGGTGAGCCTAG
CAAATGGGTCCCTCTTGAATGATGGACACTGAAGCTCAGCAATGGAAGATCATTTGTGCA
TATTAACATATTTAGTGGATATCTAACTGTATAGGCACAACTAGATTTTAAAACTTACGG
TTTTCCCATCATAAAATACTGAGAAAGAGTATTGAGTCACTAGGTGAAGTGGTATTAGTC
CATCTCTCCTAGAGCTGGGAAGGTATTTTGTATTTAAGATTACATACCCTTGACCTAGAG
AATTGGCACAATAGAATGATTTTTCTGTTGTCTCAGCTCTCTTACAACAATACAACAAAG
TGTATTGAAAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGCCATTAATCC
TGCTGAAAGAAAAGCTGTGTTAATCGTTTTGGTTTTGCCTTTATGGGGGTAAAATCATGA
CAGATTGACATGGACAATTTTGAGATTGCTTTAGCTCTGCATCATTGTTGCTCTTGGGTA
GAGATGAATGAAGTGTTCGTTACATAAAGATTATGCAGGAGCTTTTATGTGTGCATGAGT
TATCAGGAGGGAGTTCAAATATATGTGTATGTCTGCTGTGGGTCTGTTGAATCAAAAGTG
GGTGAGGGTACACTTGGGGAGTGGTGTACCTTATTACTGATTCCAATTAAGAACCTAGCC
TTGAATCATTTTGCCAGGTTAAAATTTGGCTTGACTAGTTTATAAACATATGTAGCAAGT
CATTTTTTTTCACTCTCCAGAAAGAGGTCCAAACTTGTTAAAGGAAGGAAAATTGGGACC
CTTTGTGTTTTGTGGTACATAAAAGGCAAAGTTTATGATGAATGGGCACCGCTAAATTGC
AGTCGGACTGCCTTTGTTATAACTTGCACTTTCCTTCTGTGTAGGTACAATTCCAAGAGG
AGACATTGGAGAAGAACCAAGCTGGGTCTATAAGGAATTGTACATGATATAATGGCACAC
ATGTTTATGCTGTATCAAGATCACTATCATCTTACCATATCAAGTTGGAAATCTCACTGT
TATCCGGACAGACACATTTCATTGGGAAAAGTGATTTTTCTCTTTGTTTATATGCTCTGT
ACTAATAAGCTGGTTCAGTAATAAATATGTGAGACCTTTTGTTTAATTGCTGTTTTATTC
TGGTTTGTGATGTACTGAATTCCCCTGCCCCCTGCTAGACCTAACACTACACTGTCCAGT
AGAACTATCTGTAATGATAGAAATGTTCTCTGCTTACCAAGTACTTAAAGTGTGTTTAGC
CACTTCGGTACGGCGCTCACCGGCCACGAACCCGGCACTGACAGTCTGCAGGATAGTTTG
TGCTGTGCATTGATGACAATCCATTTTGCTCTGTGTGATGAGGAAAGCTTTAAAGTACTT
GTTTTACTTTACAGGCAGCTTTACTTGTAAATCGGAACAGGTAACATATGTTTTTATTAT
GTTATTTTTAAATGTTCACAATTTTATTTTGATAAATGAAAAGTAAGAAAAATCAAATTC
AAAATTATGGACTGAAGTCGACGCTCGGCTGTGCACGCTCATCTGTGGCTATCAACTATA
GTCAACGCTTGTACCGAAGTGGTTAATGTAAGATTTCATTTAATTGTAAGTAAATCTGAA
TAGCTCCATGTGGCTGGTGGCTCTTACCCCTTCTGTTATGAGGGATGCATATGTATCATC
CTAGTACCTGAGAGTAGCACATTCTTCCTTAAATAGCATCTGCATTTGCTATTTATGATA
CCAGTTCTCAAGAGTAGGGATTATCTAAACCAGGGGTTGGCAAACTGGTCTGCTGCCTGT
CTTTATATAGCCGGCTAACTAAATGGTTTCTGCATTTTAGATGATTTAAAGAAATTAAAA
GAATATTTTATGACACCTGCAAGTTGAAATTCAAATTCCAGTGTCCATATAAAATTCTAC
TGTTACACAGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 8468..8543, 8646..8673, 10604..10652
1001..1003, 8468..8543, 8646..8673, 10604..10649
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved