Microcebus_murinus Locus IQCG
snOPY snoRNA Orthological Gene Database
Microcebus_murinus IQCG
Microcebus_murinus
IQCG
GeneScaffold_4175
SNORA42
6766..6901
37380
CTAGTTTAGAGTATCTTGTTTCAAGTTTACACAAATATTCTGTTATATATGTTTGAACT
TTTGCATATCAGATTTTTCTTGTGTGAGACATACTTTCACCACCTCTCTCAGGGATATTT
AATACTTTTCTGTGGACAAAATCACACTGGAAACTTAACATTCACTAGTCATTTACTATA
AAGCAAAATTCTCCATGGTGGTCTCATTGTAAAGCTAATTTAAGCAGAAAGGGTTTTAGT
TTACTCAGGAGGGGTAACATCTTACTAGCAGCATTAAACTGATTTCCAGGAGTTAATAGT
TTTTCTAAATGTAATCTCATTTGTTCTTATAAGTCCAGGTGCAACAAATTCTGTTATCTG
GCAGATGAGAGGAATGATGTGATCTAATTAAATATTTATAGTAATTAGAATGATAGAAAA
TATGTTGTATAGAGATTACCAATGAAAAATCAGAATGCAATAAAAACACATTTACAGCTA
CTCAGGAGGCTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATG
ATCATGCCTGTGAATAGCACTGCAATCTATGCTGGGCACATAGCAGACCCATCTCTAGAA
AATTTAAAAATTAAAAAAACCTGAAACCATGTTGGACATTAATTTACCTTAAGAAGAGGC
TCAAAAGGTGCATGTGTCTTCAGGTTTGGTAGACTACTTACTGTGTTCCCCCTCATCAGT
GGTTGTTTCCTCTCCGGGACTACTCTACTAAGTGAAAAGAGGGGATAAGCCACAGCTCTT
GTCATTCTTTAATTTTCTCTTACTAAAAAGGGCATCAAAATAACTCATACATCATTTAGG
ACTCCCTTAAACTAATCCCAGTGTTCTTCCCATTTTAGGTGACTGCATTTTTGTGAGATT
ATAAATACACCATGGAGGATAACAAAACTAACTCTGGAAGAATGGAAGAGTATGTTCAAA
ATTCTAATTTATATTGTATATATATATTTTATTTTTTTTATTTCCCTTTCATATATTGTA
TATATATATTTTAAATTATGCCTTCTGTTAAATTTCATCTATTACTTGCCTATTGCTGTA
TAACAGATCACCCCAGAACTTAGTGACTTAGAATATAAACATTTATTATTTCACACAGTA
TCTGTGGGTCAGGAGTTTGGGAACAGTTTAGCTGGATGGTTCTGGCTTGGGGTCCTTCAT
AAGGTTGAAGTTGGCCAGGGACTGCAGTTTTCTGAAGACTTTTTTTTTTTAATCTTTTTT
TTTTTTTAATTTCAGCATATTATGGGGGTACAAATGTTAAGGTTCCGTATATTGCCCATG
CTTCCCCTCCCCCTTCAAGTCAGAGCTTCAAGGGTGACCATCCCCCAAATGTTGCACATC
TCACTCATTGTGTTTGTATATACCCATCCTTATCTCAACACTTGATGGGGACTAGAGGAT
GCACTGCCAAGATGGTTAATTTACAGAGCTGGCAAGTCGATGCTGGCTACTGGCAAGAGG
CCTTCATTCCTCCCCTTCATGGATATCTCCATAGTACTGCTTAAGCGTTCTCATGACAAG
GCAGCTAGCTTCCTTCAGAGTGAGAGATATGAAAGAGTAAGGCAGAAGCTGCAATATCTT
TTATCACCTAGCCTTGGAAGTCACACTCTGTCATTCCCATAATATCCTTTTGGTTACATA
GGTTAGTTCTAGTCAATGTGGGAGAGACTACACAATTGTATGAATACCAGGAAGTGAGAA
TCATTTGGGGCAACTTTGAAGACCGGCTACCACATTCTGTTTTTTACTAATCATGAGTCA
CTTTTGCTTAGCAACTAAAGTTGTTTCTAAAAAAAAAAATTAATTTTGGCTCAAATTCAA
CTTAGTTAAGCATCGCCAATAGCATGGGCTACATATCTTTATTAAATGGTTAAGTAGGCC
GGGCGTGGTGGCTCACACCTGTAATCCTAGCACTCTGGGAGGCTAAGGTGGGAGGATCAC
TCAAGGTCAGGAGTTCGAAACCTGCCTGAGCAAGAGCGAGACCCTTTTTCTACTAAAAAT
AGAAAGAAATTAATTGGACAACTAAAAATATATATTAAAAATTAGCCAGGCATGGTAGTG
CATGCCTGTAGTCCCAGCTACTCGGAAGGCTGAGGCAGAAGAATTGCCTGAGCCCAGGAA
TTTGAGATTGCTGTGAGCTAGACTGATGCCATGGCACTCTAGCCAGGGCAACAGAGTGAG
ACTCTGTCTCCAAAAAAAAACCAAAAAAAAACCAGTTAAGTTGTTTACTTTTCATTGGTC
AAAATAGAAGGTATATGCAAAATCACATGTAAATTCTAGCTTTTGTTTTTCATTTAGGTT
ATATTATATGATAATATGAACTTCACAGAAGCCAGTCTAAGTGCTGCCTGTGCTTTTGAA
TTTAAGTAATATTTAAATGATGGTCATTGACTTATTTTTTTCTTTATCCTTTCCTTAGAG
GCAGTCTGGAAACCTTGAACCTTCCTCCAAATCCTTCGCATTCTGAGATGATGGTGTCAG
TGACTGGTGAACCACCTACTGCTGCAGAAGAAGTAACAGCTGTATGTACAGATGTAGAAA
TCATCCCAGAAATCATAGAGCCACTCTCCCTTCCAGATATGCTGAGGATCTCTGCAGTTC
TGGAGGATACCGTAGACCAGCTCTCTATTCTAAACTATATCATGCCAGTTCAATATGAAA
GAAGAACAAGTATCTTCATGGTATATACTCACTCACCATTTAACTTTGCTTTCTTTCCTT
TATATTTCCTTTATACCTATGCCTTAAATTTCACTTGAGAAATAGCACTTTTATCTCAGA
TAAAGGGCTACAGTAACTATCTGAGATGTGTACTCTCAATTGATGGAATGAAACTGCCAT
AGCTCAGTGTACATTACCAGGCAGAATATCCTTTTCTGATATGTTGACATTATTCAAAAG
GCCTATAGTTAAATCAGTATAAATGCAGTATATATACTGAGGAGATCAAATTAACTGAGT
TTTCCTACCTACCTTGTATTTCTCACCTGCTAAATGCTAACAACACTAGGGGTAGGAAAC
TCAACTCAATCTTCTCAATATTACTTTAATCTAAAATTGACTTTGCTTTCTGCCACAAGG
TTATTCCCACTTAAAAAAAAAGACTGTTGTCATTGCTGACTATGTTGCAACCTGCCTTTC
TGAATGTCCAGCCATATTATTGTATTAACCATTACATTTTTTTTTTTTTGAGACAGAGTC
TCACTTTGTTACCCAGGCTAGAGTGAGTGCCATGGCGTCAGCCTAGCTCATAGCAACCTC
AAACTCCTGGGCTCATGCGATCCTCCTGTCTCAGCCTCCCAAGTAGCTGGGACTACAGGC
ATGTGCCACCATGCCCGGCTAATTTTTTTTTTTTGTATATATATTTTTAGTTGTCCAATT
AATTTCTTTCTATTTTTAGTAGAGACGGGGTCTTGCTCAGGCTGGTTTTGAACTCCTGAC
CTCGAGCAATCCACCCGCCTCGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACTG
CGCCCGGCCTTAACCATTACATTTTTAATAATGTTTGGGCTCTTCTGCAAAGTACCACTA
GGTTATCAAAAAAATTTAACTTGGTCTGTAAGCTGGAGATCCTTGGAAAAAAGTAAACAA
AAGAAAGAAAGAAAGAAAGAGAGAAAGAGAGAAAGAGAGAGAAAGGGAAAGGAAAGGAAA
AGAAAAAGAAAAAGAAGAAAAGAAGCCTTAACTTGGTAGTGAGCGAAGTCCTTATAAATA
ATTTTTTAAAAACAGGGTCTTGCTATATTGCCCAGGCTGGTCTCGACCTCCTGATCTCAA
ATGATCCTCCCATTTCAGCTCCCAAAGCACTGGGATTACAGGTGTGAACCACCATGCCTG
GCATAAATTTTTAAATTTCAGTACCTTTGCTTGTAGATATAAAATGCAAACAATGTGTAA
ATACAAATACACATTTATCAAGTTTCAAAAAATATTATAATTTTATATAAAATGTATTAT
TATTTCTGATTCTATGACAAATGAAAATTTCTTTATAAATGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGATTGCTCAAGTCAGAGTCGAAACAAGCCTGAGCAAGAGCAAGACCCCATCTCTACTA
TAAATAGAAAGAAATTAATTGGCCAACCTAATATATATAGAAAAAAAAAATTAGCCAGGC
ATGGTGGCACATGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGTAGGATTGCTTGA
GCCCAGGAGATTGAGGTTGCTGTGAGCTAGGCTGATGCCACGGCACTCACTCTAGCCTGG
GCAACAAAGTGAAACTCTGTCTCAAAAAAAAAAAAAAAAAAAAGTAATTCGCCATCATAG
AAACTCAGGAGAGAATTAAAAGAAGCTAAATTGTTCAGCATCTGTCACTCTTCCAGTATA
TAAAAGAATGAAACTTTTGCACTGTTTTATTTTGGTTTATGATAGTGATCTTTCAACCAA
AAAATTTTCTGACTTAATAGAAACCCTCTCATGATTTTATAGTGTAAAAAGTAAACCCTT
GCACTATTGTGTTGATTATTAGCAGTTTAAAAACTCCTTTCTCAATGTTAGTTATATACC
TTTTAAAAATTGTGACTCTCTTAAAAATTTTTGTTTTTTACTTCATGAAACTATAGTTGT
TCTAACTCATGAATCTTAAGATGCCATTGCCCTATAAAGCATAGGATATATAATTATTAT
TATTTTTTAAAGGCAAGGTCTTCCTGTATTGCTCAGGCTGGCCTGTAACTCCTAGGCTCA
AGCAATTTTCTAGCCTCAGACTCCTAAGTAGTTGGGATTATAGGTGATCACCACCATGCC
CAGCTAGGATATATGTATATTAATTAATTAATTAATTAATTTATATTTTAGAGACCAGGT
CTCACTCTGTTACCCAGGCTGGAGTGCAGTGGTGCAATAATAGCTCACTGCAGTCTTGAA
CTCCTAGAATATATATTTTATTTTTTTACTCATGAGGTAGAACAGCAATAGAATATATAT
TTTAAAACCTTAATATGTATATGGATGTTTTCTTTCCCCAAAGGCTTTATATTATTCAGC
CTTATAACAACCTTGGGAGGAAGGGTTTATCCCACTATTATACCTATTTTTACAGGTAAG
GCCATTTCCAGATAGATTTTCATTTACTAGAATTATGAAGTGGGATGCATGGGTTTGGAT
TTATGACAGGCCCATCCCCCTGGGCCTCTCATAGTGCCCCATGCCAGAGCAAACTGTCAC
CCTAGACCAATGTCTGGTCTCTGTGCCTATAGGCTGCTGGTGCTGAAGCGGGTTGAAGAG
TAGATAAAAGAAAAAAGAATTATGATGTAGAATAGTGAAAATTATATTAAAGTACCAGGT
TCTACCAGAAGTGGGATGATTTGAGCAAAGTTTGGAAATAACTTTCTTTCAGGGAATACT
GTTTTTCCCTTAGGGTCTAATGCCCTACCTTGTACATAGTGTGTGCTATATAAAAATACT
TTTTAGTGAATGTACTAGAACATTTAGTAGGCTTCTTTAATTATCACGTAAAAATTCACA
TTTTTTTGTCTCAGTGTGCCAATGTGTAGAAAAAAAAGAAAAAGAAATTTTTTTAAAAAT
TCACATTTCCCTCTTGTAATCAGTAAATCAGGCCATAAGTCACATTTGCTTCCTTTTCCC
AATGCCCAAACATAAAGGTAGAGAAGTAATAAATTGTTAGGTAAATCAGAAAATGGGGCC
TCCTAGGCCTTACATTTTCTCCATAATCTCCTTAGACAAAATCTAAAATAATAACCATCC
GTTTTACCAATGGGAAAATGGAGGCACAGAGATGTTAAATAGTTGCCTAAGGTCAATATA
GTTTAGTATGAGATAGAGCTGGATTCAAACATGGCTTCCAAGTTCACATGTGTAGTCACT
ATATTATATGGCCTCTCAATGGCTCAAGCTTTTACCCACATATTAAATAGGAATCATCAA
TTAAAAGACATGTGCTAAGGCCGGGCGTGGTGGCTCACGCCTGTAATCCTAGCACTTTGG
GAGGCCGAGGCGGGCAGATTTCTCAAGGTCAGGAGTTTGAAACCAGCCTGAGCGAGACCC
CGTCTCTACCAAAAATAGAAATAAATTAATTGACCAACTAAAAATATATATACAAAAAAT
TAGCCGGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGTAGG
ATCACTGAGCCCTGGAGATTGAGGTTGCTGTGAGCCAGGCTGACGCCACGGCACTCACTC
TAGCCTGGGCAACAAAGTGAGACTCTGTCTCAAAAATAAATAAATAAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCATGTCTGTAAT
CCTAGCACTTGGGAAGCCGAGGAGGGCGGATTGCTCGAGGTCAGGAGTTTGAAACCAGCC
TGAGCAAGAGCAAGACCCCGTCTCTACTATAAATAGAAAGAAAATGAATTGGCCAACTAA
TATATATAGAAAAAAAAATTAGCCGGGCATGGTGGCACATGCCTGTAGTCCCAGCTACTT
GGGAGGCTGAGACAGCAGGATTGCTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGCTAGGC
TGATGCCACGGCACTCACACTAGCCTGGGCAACAAAGCGAGATTTTGTCTCAAAAAAAAA
AAAAAAGATGGCTGGGCGCGGTGGCTCATGCCTGCAATCCTAACACTCTGGGAGGCCGAG
GCGGGCGGATTGCTTCAAAGTCAGGAGTTCGAAACCAGCCTGAGCAAGAGTGAGACCCCC
CCCATCTCTACTCTAAATAGAAAGAAATTAACTGGCCAACTAATATATAGAAAAAATTAG
CCGGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGCAGGATC
GCTTGAGCCCAAGAGTTTGAGGTTGCTGTGAACTAAGCTGATGGCATGGCACTCACTCTA
GCCTGGGCAACAAAGCGAGACTCTGTCTCAAAAAAAAAAAAGATTACTAGGTGGTAAGTT
TGAGAATGATGAAGAGGGGGAATGTTGTGTGAAAGCAAGAAGAAATAAAACAGCAAGATA
TATAGTTTGGTGTGGCTGAAGAAAGAGCTACATTTTCTTGGAGTATGGTGTACAAGTCAG
AGAAGATGAGATTGAAAATGTGGACGGGGCCCTCTTATATTAATGTCTTTTGATTTTTTT
AAAAAAATCTTTCTTAACATCATTTCTTGTTTTAAAAGAAAAACAAAGAAATGAATTCAG
AGAGGAAAAGCTTAGAAAAACTTCCAATGGCCTCAACTATCTCGAAAGTACCTAAAGAAG
GACCCAAGTTGCCAGAAATCAAACAAGGAGGCCTAGATTTTAACAAAATGCAGGAATTTA
TCCTCAAAAAACCTACAAAGCAGTCCTTAATAACTATGGAGACACTGAAGAAAATTCAGA
TGGACAGGTAAGGAAGGAGCATATTTGACAATGTAATGATGCATTTATACATAGATAAGA
AAATGAGTGCAAGGTTGACTGATGGCTCTTTTCTCTTATGGGTTAGTCATTACTTTATAT
CCAAAATGACTGCTGGGAATAGGATTAGCTAAAGACTGGCTACAGGCAGTGTGGTACAAT
CTAAAGCATGGCAGCTATGGGATCCTGGACAGTTATTAAGCTTTTGTTTCCAATTTTTAT
TTTTTAGAGCTGATGTCTTGTTATGTTGCTCAGGCTAGAATGCAGTGGTTATTCACAATC
AGGATCATAGCTCATTGCAACCCTTGAATTCCTACCCTCAAGCAGCCCTCTTGTGTAGCT
GGGACTATAGGCATGCTCCATGCACGGGTGTTTCCAATTTTAAAAAACAAGACTACTAAT
AGCAATCTTGTAACATTCTTGTAAGAATTAAAAGTAAGGCACTAGCCTATTACCTGGCAC
ACATTGGTAGCTATTGTGATGCTTTATCCATTAATAAGAAACAGCTACTATCAAACTAGC
CAAATTCTAAATTGTATTTTAATCCTGAGGGTTTCTTAAAGGCAGATGCAATTTCCATTG
TCCATTATTCAGTTTTTTCTTTTCAACTGGCTTGCTAACAAAGAAGCCTGTTAAGTTTAA
AAGAGGGTGTAATGTCGTGGCCCATTTACAGGATGGAGGATGAACACAGAACACAAAACA
CAAATGCAGAACACAAAGAAAAACGCGGACACACATACAGATGGTTGACTTGAGTAATAA
TACACCGAGTCAGTTTTATTTTTATACTTAAAAAATTTAAAGTTAGTTCCTTGTACGTAA
CCACCCAGGCATTGCAGCAATGGCCATAAATTCCAGAATACGTAGCCTTAGGGAAGCAGA
TATCCCCTGGCTCAAGGTTTCCAGGTGGTTGCTCTAGGCACTAGGCATAGATCATGGACT
GAGATTAGCAAGGATGGGCAAGGCAAGTCACAGGGGGCATTTCTCATCCCCATCTTTTCT
TAGGGCGATCCCCCTAAGATCTTCAGCTGAACCCTGGTGGCTGTGTGTGGCTTAGGTCGC
CCCTCCCTTGAGGGGTCTTACCCATCATTGACTAACCAGCCATCTTATGGGGTGTACACA
GCAATCACAGGAATAATGTGTTTATTGTGTGGCCTCCAGACCCCCAATGCCGAGGGGTGA
GGTAGCTCTTGCTAACTTGCAACTCAGGTCCTTTGTTATGCCTCTAGGCAACACCTTGTT
TTTGTTATGCCTCAAGGCAATAGGGGCCTTGTCCGGAACATATTACTTTTAAATGCTCTG
GGCAGAGCACGTACATTACTAAATTTAATTCTTAAAAAAAGGAAAATATATGTCAGTCCT
CTACAGTGTAACATTAATGTAAGGACTTTTGATAAATGAGAGTTTAAAGCAATTACCTAA
AGTCCGTTTTTGAAAAGTTTTATTGGACCACAGCATTGCCCATTTGTTTACATATGGTTT
ATGACTGCTTTCATGCTACAGTGGCAGAATTGAGCTATAAAAGTGAATTTACGGCCTACA
AAGCCCAAAATATTTACTATGTACTTGTCCATTTATAGAAAAAGTTTGCTGACCCCTTTT
TTAGACCATAACCAACGGTAAGCTCTCTTACTTAAGTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGAGAGTGAAAAGAGAGATTTTTTTTTCTCATATATAGAGAATACTATTTAT
GTCTCTAAGCTATAGGCCTTAGGCTTCGAGGAGAAAGTTGATTCATAATGAAGAGTTCTT
CACCTACTTCAGTTTTGCCATGATAGTTGAAGTCTAGATATAGTGACCATGAAAGATATG
ATGCTAATCCTAGTCATTTGACTGGTTATAAAAGGAGCCAAAGATCATGAAAATGGATGT
CCTGGAATCCTACAATATTATTACAATAGTGACAAGGATTTTCCCAATGGTACTCAGTGA
TTTTGAATACAAATTGTTGCCTTGTGACTCTTATAGTGCCCTACTTGTATTCTACTGCTT
GATGAAGAGCATGTTGCACCTCCTCCTTAGCAGGAGCTAATTGTAAAAATTTATTCCTTA
GACTTGGATTCACATGAATGTCAAGACTAGGTGTCCCTAAGCCAAATACAGCACTACTAA
TTCCTTGCCTTTTGTTGTTCTTTCAGCCTTCCCATTGCCATACATGGTCATTGACTGTAA
TTTTGGAAAACTCAATGCTGTTCAGGAAGCTTGCCATGATATCTTAAAATGGACCTGAAC
TACTCCATTCTCCAAGCTATATTTTGTTTTTTTCTCTGGCTACCCTATCATTAACTTTTG
CATGTTACCTAGCTTTTTCTCCACTCAGCCCCCCCAGCTTTTTTCACTCTTTGATGAATT
TTTTTTTTTTTTTTGGCCAGATGTAGAATGGGTAACAAAGAGAATAGATTGAGATGAGTA
TGATCTATTTGCTCCAAAATGGGTTAAAGAATTAAATAAAGATAAAAGGCATGCTTGCTA
AATTTGCAAGCTACTCAAAGCTGGTATGTGACAAGGAATAGAAATCAGAATAGCGATTAT
AGAACACTGAACTGACTCCAACACAAGATGCAAAGGTGAAACTAAAATCCTGATTTTCAT
TAGAAGAATCTTTTAAGTTGTGAATTGTGAAGACCTAACTTGTCTTCAACAGTTTCGTTA
GAGGCTCAGCCAGGTTCTAACATGAGTACCTGAAGTTAGGACCCTACTACTGGTATTTGT
AGTAACATCATTTGAGAAGGTACCTGGCTTTTTGTCTTCTCTAGACTTCTTAAAGTCTCC
CTTTCACAGTGTTTCTTGTAGTGGCTTGTCATCAGAGTCTTAATAACAATCATGACAATC
TATTAATATAAAATATTGTGAAAAGCATTTGGAGTGCTTCCTCTTTGTTTTGATCATGCA
ATTAGTGGCATTGAATCCTGTTTATACAATAGGGAGAACATACTTCCCTATCCTGTGTTG
TGGTTAGACATCTATAATGTTGTATACAGTTTTGAGCATCACATTTAAGAAGGAGTTTAC
TAGTCATAACATGTAACCAAAATGTTTGTACCCCCCATAATTATCCTGAAATAAAAAATA
AAAATTAAAAAAAGGAGTTTACTCAGAAGAGATCAGCCAAGATAGTCAGGTGTGTGGAAA
CTCTATTACAGAAGGAAAGGTAAGAGGAAATTGGTATGATTGACCTGGGAAAGAGAACAG
TTCAAATGGAAATGAAAGCAATGGGTGGAACTAGAAACTGAAACTTTAGAAGTTTAGATT
TGATTATGTTTTATCTGTATCTCAGAATGGGAGACTATGTTTAGCCCAGAGTCTATGGAC
TCTTACAGAATCAGCCAGCCAGTATTCTACATCATAGGCAGACAGACAAATATAAATGTT
AACTTAATACAGAACTGTATTTTTTCTGTGGCTTTTATCACTTTAATAGACTACATTCCC
ATTTGCCCTTTTGCCATCCAATGAAAGGGGCAACCTGAGATGTAGGACAATTTCCAATTT
CTTCAGATAGTGGCTTCTAAAATTCCAGGAACTCTCTTCTTTTCCTTCTGTTTAATTATG
AAAACAGACACTATCACTGGCAGCCGTTGGCTCACACTACTGCGGCAGCCTTTAAGCCTT
ATTAACTCTAATTGGTTGATTCCCTCTTTTTATTTCTAAATCATGCTTCTCTGAATTCAA
ATAACAAGTCCAAAAGTCCAGTTCTGAAGGCAGTTTTGGGATTTGGAAGTAAAGTTTGAT
GTGCCGTGAAAACCCACAAATATGATGGGTCACTCCATGGACCTTGGTCATGGGGAAAGC
TCCAGGCACCGTGGCCAACCAGGATTATAGGTAGTGGTGAAGGGAAATCTTTTCCTAGTG
AAAATCATAAAAGAAATTCATGTAACTCAAGACCGTTGGCCTGTAGCCCACTGCTTGTCT
GCTGGCTCTTGTCGCACACTGGGGAGATGAGGAAATGGAACAGTACTTCAGGTCACTTAC
TAGTTTGCCATGATTGTGATTTACCATCACTAGCCTTGTCAGTATTTTACATCTCCTTTT
ATGTTTCCACACTGTCACCGTGGAGGGCCATAGCAATGTCTGTGCAAAACATCAATAAAT
GAAAGAACTCAGAGTAACCAGAGGCCCATGGCAACAGCATTAAAACCAGATGCCTTTGGC
TTGGCACAGCTGATGTTGTATGAACTTATAAATGGTTATATAATGTAATACCTTCTGTTT
ATCATAGGCAGAAACTCCTAGAATTTTAACTTTGCATTTATTTTTTTAAATTTATTTTTA
ATTTAATTAATTTATTTATTGAAACAGAGTCTTGCTCTGTTGTCCACAGTGTCAGCCTAG
CTCACAACCACCTCAAACTCCTGGGCTCAAGTATCCTCCTACCTCTGCCACCTGAGTAAC
TGGGACTACAGGTGTGCACTGCCATGCCTGGAGCATTTTTTTTTTTACTTTATATTTTTG
TAGAGACAGGCTTCTCTCTGTTGCCCAGGCTGGTCTTGAACTCCTGGCCTCGAGTGTTCC
TCCCACCTCAGCCCCCCAAAGTGCTAGCATTATAGGCATGAGACACCGGTGACCTATGAT
GCTTTAAGCTATGTTTATTTTTCACTGTGGATGATTTTGACTAATTTCCACTTTGTTTCT
CCTTCCAATAGTTACTTAGAACTAATTCCACCCAGCTAATGTGGTAAGATTAAAGGTGGA
TGGTATTTAGAGAAACACAGATCTCTGATTGAAGCCATGCATTTTTGTTATTAGTTGTAT
ATTTGCTTGTTGTGCTGTCAGGTAACACTGATCACCTATTTGTGAAGTTACTTACACCTT
GATTCTTTTCAAACAAATGTTACATCTCTTACTAAAACCTTTCCAGGGATTGCTATGGCA
CTCATAATGAAATCCAAACTGCTTACTCGTGCCCCTGAGGTCCTGCATGGTTTGTTCTTA
CCTGCTTCTCCAACTTCATCTTGTCCCACTCTCAGCCCTCACTAGGCTACATCCACCAGA
GTTTTCTTTCAGTTCCTGGAATGAATTCAGATCTCGACTAACTCAGGACTTTGACATATA
CTTTTTCTGTTTTTAGAATTCCTCTTGATCCCATTTTTCATGTGATAGACTTACTTACCC
TTCAGGTATCAGATTAAACATTGGTTTCTCAGAGAATCCTTCTTAGACAGTGCAATCTAA
TGTAGGTCTCCCTTGTTATTTTCTCCCATAACCTGTTGTCCTTGTTTTTCCTATAATTTT
GCACAATTTAAAAAAGTTTACATATATTTGTTTCCTTTTAACCACATTTCTCCCATTAGA
CTATAAGCTCTATGAGGGCAGGGATTGTGTCTATTTAGATCTCCACTATTTACCTAGTGC
CTAGCTTAATGCCTAGTACTGAATACATAATTTTTTTTTTTTTTGAGACAGAATCTTACT
TTGTTGCCCAGGCTAGAGTGAGTGCCATGGTGTCAACCTAGCTCACAGCAACCTCAAACT
CCTGGGCTCAAACAATCCTTCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGCATGTG
CCACCATGCCCGGCTAATTTTTTCTATATACATTAGTTGGCCAATTAATTTCTTTCTATT
TATAGTAAAGATGGGGTCTCACTCTTGCTTAGGCTGGTTTAGAATTCCTGACCTCGAGCA
ATCCGCCCGCCTTGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCACACCCGGC
CTGAATACATAATTTTCTTAATAAATATTGAGCCCTTAAAATTGCCGAACACTTGATAAC
CTACAAGGAGTTTCCACATGAATTCTCAGTGAATCCTTATAATTGTTGTCTAAGAAATTT
CAGGCAGGGTAGATATTATTTTTTCTATTTTATAGAAGGTAAAACTTGGAGACTTTAATT
GACTTGGCCAAGTTCAAACAGGTGGTGAGGTGTGGATGGGAAGTCAGTTCTTTTGATCTT
TTTGACTAGTGTTCTTTCTATCGAAATGAGATATTAATGGGAAATCTGTGTGGAAAATAG
TGTGCCTATGAAAGAATCTTGCGGTCCCAATTTTGAGAACTACTTTGTTATCTTTCATCC
TCATTTATAGTATTCATTGTCTAAATTTCTCTTAGTGTGATAGTAGAAAAATAATTTTCA
TTCTTTATTGACTTATAAATATAAAAGGTAAGCTTAAGCCACTGACCAAACTGAATGGAA
GTAGACTGCATTTTCAGTTTAGAAACCTAGTCTGTCTTCTACAGAATCGGAATGAATATA
TTGCTCACCTCAAGGACCAATTGCAAGAGCTGAAGGCAAAAACCAACTTGGAGAATCAGT
ATATGAAAAGAAATACTGAGCTGCAGATTGCCCAGACCCAGAAAAAATGTAACAGAACAG
AGGAACTCTTGCTGGAGGAGATTGAGGTAATCCCTGCTACATTAGGAAAAAGAACCAAGT
AGATGGCATTTGAGCTGTCACTCCCCATATTGTCTCAGCTAACAAAGGAAGAGGGAGATT
TCCCTCCATGTATCTTTCCAGTAACTGCCCCCCCTCACACTTGAGATTGAAAAGAAAAGC
CTAAATGAAGACTTGCATATTTGCAAGCAGAGATTCTGATGGGCTTAATCCTACATCTCT
TGCTTCTCTTACAATGACTTTGCAAATTGGTTGTACTTTCTCCCCTTAGTCATTTTATTC
TTATTTTATAAAACCACTAGCCATTTATTTTTCTTTCTTTCTTTCTTTTCTTTCCCTCCT
TCCCTTCCTTTCCAATGTTTTTGAAACAGGGTCTCACTCTGTTGCCTGGGCTGGAGTGCA
GTGACATCAATCATTATAGCTCAGTGCAACTTCAAACTCTTCCGGCTCAAGCAATCCCCC
TGCCTCAGCCTCCTGAGTAGCTGGGACTAGAAGCACGGACCACCATGCCCAGCTAATTAA
AAAAAATTTTTTTTATTAATTTTTTATTTGGTAGAGACAGGGTCTTCCTATGTTGCCCTG
GCTGGTCTCAAACTTCTAGCCTCAGGCTACCCCCCTACCTTGGCTTCCCAAAGTACTGGG
ATGATGCCATTTCTCTTAGTAATTATAAGGAGAGGGCAAAACCAGGTACGTAGTAACTGC
AGTTTTTTGCTTGCTGCTGATATCATCCAACCAGTAACTTTTAGCCCTCCAGTAAGAAAT
ACAAAATCTAGAGAGCTGAACTTCATTTCAAACCTAAATTTATAGAGATGAGATGTCACA
GTGAAAAATATCAGGAGAAAGAAAGAAATGGTAGACCTTTTCATTGGAGGAGGAATGCTA
GATGGCTAAAAGAACAACAGGCAAAGCTGGGCATGGTGGTGCAGTAGTCCTAGCTATAAT
ACTTAAGAGGCTGAGGCCAAGACAGGAGGATTGCTTGAGGCCAGGAGTTCAAGGCCAGCC
TGGGCAACATAGTGAGACCCTTGTCTCTGTAAGAAAAAAAAAGGACAACAGAAAGGACAA
CAAGCAATTATTCCCCAGGTGTGGCTTGAGACCATGGTGACACTCTTTTTTCTTGTACTC
TGGAATTTCCATTTCTAGGCCTAAGAACCTTGTGCACTTAAAGTATCGTTTCTCTCCTTA
AATGGGAATCACTTTCCAGGTAACAGGATTGTGGTCCTCTTGTTGGGGGGTACTCGCACG
TATCTAGCACACTGCCAGCCACGTGGCTTAACAATGTTTGTGAACACGAATTGCGTTGAA
CTGAACTGAATGACAGCGCTAGAGCAATTCTGTGGAATTCTTGGGATCCCAGCTGGTAAA
GGAAACCTGTGCTGCTGTCCAAGCTGCACCTCTAATCTGAAGAATTTGTGATTCCGACCC
CTGTCAGGGAGAATTCCTTGTATTTGATTGTCGTTCTTACAGAAAATAAGAATGAAAACT
GAAGAAGAAAACCGGATTCATATGGAGATTGAAGTGTTCCTTAAAAAAGAGCAGCAGGTA
GGTTACCAAAACTTTTTTATCCTCTGATTTTTTTGTATTCCACTTACAAAATACCAAGGA
GAGCAAAAAACATTTTTTTTTTTGAGAAAACATTATTACAGTTTTTCTACGTTGGTCAAA
AGAATTTTTTTTTTTTTTTTTGAGACAGAGTCTTGCTTTCTCCCCCCAGGTGGAGTGCAG
TGGCATCATCATAGCTCCCCACAACCTCAAACTCCTGTGATCAAGTGATCTTCCTGCTTC
AACTTCATGAGTAGCTGGGACTGCATGCAGGCAGGCCATAATGCCTGTCCAAAAAAATTT
TTTTAAAGGAAAGACAAATCCACCATAATTCTTCCAGCCTAATGAACATGTTCTTTCAGA
GTTATCCATCTGAATAGATATTTTATATAGCTGTAATTTAAGTAAGTACAGGTAAAATTT
TGTTATCTGCCTGTATAATTTAGCTTATATAAAAAACTGTTTTCTTATTCCTATATTGCT
TTATAGTCATAGTCATAGTTTAAAAATAAAATTTACTGAATTTTTTAAATTATAAAAATA
ACATTTTCAGGCCAGGTGCGGTGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCCAGG
ATGGGCAGATCGCTCAAGGTCAGGAGTTCAAAACCAGCTTGAGCAAGAGCAAGACCCCGT
CTCTACTAAAAATAAAAAGAAATTAATTGGCCAACTAAAAATGTATAGAAAAAATTAGCC
AGGCCTGGTGGCACATGCCTGTAGTCCCAGCTACCTGGGAGGCTGAGGCAGAAGGATTGC
TTGAGCCTAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACGCCATAGCACTCTAGCCCGG
GCAACAGAGAGAGACTCTGTCTGAAAAAAAAAAAAGCATTTTCAGTTGAGGGAAGATTTT
TAAAAATCACCAACTGCTTTTTCACCCATTTTTTTCATGTTATTAGAATCTCTTTATAAA
ATAATTTAAAATAGTTGTATAATGTTCCATTGAATGGTTATGCCATAGTCCAGCTATTAC
TCTTTATTTTCGATATTTAGGTTGTTTCCAAAGTTTTATTATAATGAATAATGCAGTAAT
GAAAGCTTTACCCAAAGAATTATTTTCTTCATTGCAGTTATTTACTAAAAGTAAATCTCA
AGCATAAGATTATTATTTCAGAGAGACTGGTATTTTGTGACTCTTGATAAATGTTGCTAA
TACTTGCTAATCTATATTGCCATCAGCAATGTACGAAGGCAGTAATTTCAAGGTATCCTC
AATAGTACTGGCCATTTTAAATATATTTTTTCTTTTTTTTGAGACAGAGTCTCACTCTGT
TGCCTAAGCTAGAGTGGCTGTGGCATCAGCCTACCTCACAGCAACCTCAAACTCTTGAGC
TCAAGCGATCCTTCTGCCTCAGCTTCCCGAGTAGCTGGGACTACAGGCATGCGCCACCAT
GCCTGGCTAATTTTTTCTATTTTTGGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTC
TCAAACTCCTGAGCTCCAACAATCCGCCTGCCTCGGCCTCCCAGAGTGCTAGGATTATAG
GCGTGGCCACCACTGCCCAGCGTTAAATATTTTCAAAAGTCTGCTAATTTAATGAATTGT
TTTATTTTCATTTTAAACTTACTAGTAGAACTGTACAGAACATTTTTCTTTATATTTACT
CAATTTATTTCCCCTTGTGTGAATTATATGTGATGGAAGTGGCCCTCTTGAAGGCAGAGA
CCTTTGCCGAGGTGCCCTGGGCCAGAGCTGGCTTATAGCTAGATGGATAAAGCTGGCAAG
CAGGGAACTGTGGACCTGACTAAACAGTCCCCCCCCTCCAAGTCCCCCCTCCCACCGCCA
TCAGGATGAGTACTCAATTTTATGAGATGGATTTCTTTTTCAATGATGAAACATTAAATA
CATTAATAGATTCGCTTATGTTGAGTAATCTTTAAATTCTTGGGATAAATCCTACCAGGT
TTGACAAACAAGAATCCTCCTGTGGGCTGGGCGCAGTGGCTCACACCTGTAATCCTAGCA
CTCTGGGAGGCTGAGGTGGGCGGACTGCTGGAGGTCAGGAGTTCAAAACCAGCCTGAGCA
AGAGCGAGACCCCCGTCTCTACTATAAATAGAAATTAATTGGCTAACTAATACATATAGA
AAAAAAAAAAATAGCCGGGCATGGTGGCGCATGCCTGTGGTTCCAGCTACTCGGGAGGCT
GAGGCAGCAGGATTGCTTGAGCCCAGGAATTTAAGGTTGCTGTGAGCTAGGCTGAGGCCA
CGGCACTCACTCTAGCCTGGGCAACAAAGCGAGACACTGTCTCAAAAAAAAAAAAAAAAA
ATCCTCCTGTGGTGGTATCAGTAAAACCTGTTGGTGAATGAATGCCACTGAGTGTCCCAT
ACACCTACCTTACTCTAGGAACAAGAGACAAGTCCACACTGGAACCTGTCATGTTCCTCC
AGCGCCCTCTACTGACAAAGTTTACCATTTTGCTCTCTGGCTATATTAATAGCAAGCATC
CAGTTTCACAAAGCAAGGCAGTGAAGGATTAATTCGGAGCTGAGGCTGGGCGAGGTGACT
CACGTCTGTAATCCTAGCACTCTGGGAGGCTGAGGCGGGAGCGATCGCTTGAGCTAAGGA
GTTCAAGACCAGCCTAAGCAAGAGTGAGACCTCGTCTCTACTAAAAATAGAAACAAATTA
GCCAAACAACTAAAAATAGAAAAAAAAAAAAATTAGCCGGGCATGGTGGCACATGCCTGT
AGTCCCAGCTACTTGGGAGGCTGAGGTAGGAGGATCGCTTGCGCCCAGGAGTTTGAGGTT
GCTGTGAGCTACAGTGACACCACTGCACTCTAGCCAGGGCAATAGAGTGAGACTCTGACT
CAAAAAAAAAAAAAAAAAAAAAATTGGAGCTGAGAGGCAATAAATTGATAACTGACACAA
ATAGGGATTATTTTTTCTTTTATCATTAAGTATGAGGTTTTTACTCTAGGTTTTGGTAGA
TAAACTTTATCAAGTTAAGGAAGTTTCCTTTTGGTCTTACCTTGCTAAAAGTTTTTTTTT
TCCTTATCAGGATTAGTTCGCAATTTCATGAGATAGATTTTTTTCATCCATTGTGCTGAT
ATAGTTTTTCTCCTTTAATATGTTAAGTAAGTAACACATTAATAGATTTGCTAATGTTGA
GTCATCTTAAAATTCTTAGAATAAACCTTACCTGGTTATAATGTATTATTCTTTTAATAG
ACTACTAGAATTGATTTATAGATTTATTTTGTATTTGATAAGTAAGATTAACCTATACAT
TTCTTTTTTGGTGCTGCTTTATTGTATGGCTATCAGAGTTATGCTAGCTTGGCAGGACGA
GCTGGAAGCTTCCCATCTTTTTGTGGTCTGAAAAACAAATTATTTATCTGTTCCTTGAAG
TTTGGTAAAATTCAGTCATAAACAATTTTGTCTGGATATCTTTTTTTTAAGGGGAGATAT
TTGACTATCTTTTCAACTTTTAAAAAATGATTATTGATCTCTTCATTTACCTCTTTTTGA
GTCATTTTTTTTTTTTTTGGTAACTATGTCTTCCTAGAAAATAATCCATTTTCACCTAAA
TACTGATTTCAAATTTATTAGTATAAAGCTTTGCTCTATAGCCTCTTTTTTTTGTTTTTT
TTTTTGAGACAGAGTCTCGCTTGTTGACCAGGCTAGAGTGAGTGCCGTGGCGTCAGCCTA
GCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTTCTGCCTCAGCCTCCCGAGTA
GCTGGGACTACAGGCATGTGCCACCATGCCCGGCTAATTTTTTCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCACTCAGGTAAGTCACCACTG
TTCTGACTTCTATCACTATAGAAAAGTGTTGCTTGTTCTTGAACTCTATATGAATGGAAT
CATAAGGTATATACTGTTTTATGTCTGGTGGATACCATGTTTTAATGTTCTTTCCTAATA
GAAACTTGAGGAGAAGCTAGAGTTCTGGATGGAAAAATATGATAAGGACACAGAAATGAA
ACAGAATGAACTAAATGCTCTCAAAGCTGCAAAGGCCAATGACTTAGTACGCCTTCAAGA
TCTTGCAAAGACGGTAAGGAAGTAGTAAGGGTACTCACTGAGGAGTGAGTGGTAGCTAAG
CTGGGTAATGCTATTTTTGGTCAAAAGTGGAGGGGTGCCTGTAAACCAGTGGGACTGATT
TTTGATGATGACGATGACCACGACAATAGCAGAAGCTAACACTTACATATGGCTTATTCT
GTCCCAGACACTTTTCTAGTATTTTACACATATAACTTATCTAACCCTCACAACCCCTTG
AGATAGATACTATTATTTCCACTTTATGGTCTCTGAACATAATTCATAAATGATAATTTC
CAAAAAGCTTCTGATTATGGTTTTATCATTGAATAAGTATAGAATTTCCCAAATTTCTCT
TTTATTTATTTATTTATTTTTTAAAGACAGGGTCTTGCTTTGTTGCCCAGGCTGGAGTAG
AGTGACACGACTAACTCATTGCAGCCTCCAACTCTTAGGCTCAGGTGATCCTCCTGCCTC
AACCTCCCCAGCAGCTAGGACTACAGTCATGTGCCATCATGCCCGGTCCCAAATTTCTCT
TTTATTTTTTTTTTTTGAGATAGAGTCTCGCTCTGATGACCAAACCAGAGTGCTGTGGTG
TCAGCCTGGTTCACAGCAACCTCAAATTCCTGGGCTCAAACAATCCTCCTGCCTCAGCCT
CCCAAGTAGCTGGGACTACAAGCATGCACCACCATGCCTGGCTAATTTTTTCTATGTATT
TTTAGTTGTCCAGCTAATTTCTTTCTATTTTTAGTAGAGATGGGGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTCTTTTCTTTGGTTCATCTTTAGATTTAG
CATGTTTTATTTTAAAATTTTATGTTAAAAGTACAGGGCTGGCTGGGCCACAGCTTAGCC
AAGAGAGTACTGTAATATATGATTAATGTCTACTTTTGCAGATAAGGGAGTATGAACAGG
TCATCATTGAAGATCGTATAGAAAAGGAAAAGAGCAGGAAGAAGATAGAACAGGATATGT
TGGAATTAAAGAGCATCATAAAGGTAGGAAACTATAATCGGTATCCTGGGGCCCCATCAG
TGCCATAGCTAGCCTAACACTGAGGAACGCAAAGCATTTCTTGTTCATGTATCAAACACA
TAGCAGTTTACCGCACAACAGATCTGCGAAGAAGCATCCCCTTTTGTTGTTATTGGAATG
TGACACCACAGTCCATAGTGCAGGGAGACAGTTAACATAGAAAAGGACATGCCTCCAGCT
CTTACTCTGGGGAAAAAGAGGTGGTTAGTAGTGGAAGCAAAACCTAGGTGTAGAGGTCAA
ATATAAGAATATTATTTCTAATCAAAACCAGCTCTTGACAGAATTTAATATCCTATTGCT
CCTTAAAATCCTGTTTATAAATCAGCCCCAGACTATCTGCTGAATTCTGATACAAGTTCC
TTTTAAAAAAGGTGGAAAGGATAGGCAGCAGCTTAGACAAAAATAGAGAGATTTTAGTTT
TGTGTGAATTTGTATATATTAATAATGATGAAACTGGCAGGTCACAGATCCTGCAAAATA
TTTTCAAGCAAAAACTGTAATGCAAAAAAAGTATCAGCTGTACTGAAACTGTTGCCTGGA
GAATGGCCCTTCTCTCTGAAGGCTGAGACCCTAGTGGGCAAACTGTAGTTTGGCGTGTAT
ACTGGGGGGTGTACTGAAAAAGTAAATTTTAAAGTACATTCAGGACCAGGTAGCCAAACC
AAGTTTGAGCTTTTCATTAGGAAAGAGTCAGATATATACATAGCAAGTATTTCTATGGTA
TTCTCCATTTGTCAGGATTCCAGGTTTAGAGAAAAAACATAAGGTCTAGCTGAAGACCAC
TTCTATTTTCTTTTCACTAGTCGATTTGCTTCTAGTCTTTAGGGCTTAGTCTGATTTTAA
AGTAGCCTAGACTGTATTGAGAACAGTTGTTATCTAACAACTAAGATATTCAACAGAGCT
ATCTAAATTCTTTCTTGAAGAGAATTGACCCTGTAATCAATTACTAAAGATATGAAATGC
ACCAGGAAGCTACTGAAGTCACCTAGGTTTATTTGTGCATTTTTGACTGAGTACTTTTGT
CCTTGGCCTATGTAAATAACATTACTTTACTTTGGGATCAGCTAGTTATTAGGTATGGGG
AACCTAGATGTTCATTAAGGGAATAGAACATGGAAGTCAGGTCTCTAAGTATGAAGGAAA
ATTGGCCTACTCCAATTCCTTTTATTTTTATTCCTTGAGTACTTCATTCTTGAGTCCAGA
GCTTAAGCTCTGGGTCCCGCACAAAAGGGGAGCATCACTGTACCAATTAAGGGGCCTGGC
CACTTCCATGTCCCAGACAGAGACCATTCTTCAGACAGAAGTTACATTATCAGACAATCC
CTTTAGGTGGAAAGAACGCAGCTTGTCACGTATACTATAAGTTGTACTCACTCCTCCTTT
CTCCTCCAGCTCCAGTCCTGGTGGCGAGGCACTGTAGTAAGAAGGGAAATTGGTACTTTC
AGACTGCCTAAGGAAAGAGAAGATAGCAAGGATTCAAAAGGTAAAGGCAAAGACAAGGAT
AAGCGGAAAGGCAAGAAGTGACCAAGTTATCGTTTGTACTTTCCTCTGGTGTTCTGGAGA
TGGGAATGAGGACTTGGAGGGAGTATGAAGCATCTTGTACCATCACAGATAACTCACCTA
CAGGTTGTTTCTTATTTGACATTCCCAGAGGAAGCCTGCTGCCTTCACTTTGCCTGTTAT
ATTAGTTTTCCAACCCTGAATTCGGTTTATACCATCAATTTAGGGCATCCTCATATTTTG
AACTTTAGTGGGAAGAAGTGTTTCTGGTAGCCTTGTGAACATTCCTCTTGCTCTTTCTCA
CTGGAAAAAAGTTCATGGACTTAGTTACAGCGAAGCATTAAAACTTCAGTAATTCATGTC
TCTGATTCTGATTTTATCCAATTTGTCAACCTCTTATGAGCAAAAGTGAAGTGTTCAGAA
AGAATTACAAGATGATGTTTATCAAGTGTCTAGCATAATACATACCTAGTAACATTTTAA
TCAATGTTGGTTCCTGCCTGCCATTTAGATTTATTATCACTTTAGTGGTTTCCTTTGGGT
GGGGGGCCGGAATTTTGCTTGCTTTGTGACCTGGGCTAGAGTGCTGTGGCGTCAGCCTAA
CTTACAGCAACCTCAAACTCCTGGACTCAAGCAATCCTCCTGCCTCAGCCTCCTGAATAG
TTGGGACTACAGGTGCATGCCACCACGGCTGGCTAATTTTTTTCATTTTTAGTAGAGATG
GGGTTTTACTCTTGCTCAAGCTGGTCTCCAACTCCTGAGCTCAATCCTAAAATGCTAGGA
TTACAGGTGTGAGCCACCGTGGCTGGCCTTTTTTTTTAAGACAAGGTTCTCACTCTGTTG
CCTGGGCTAAAGTGCAGTGGTGTCATCATAGCTCACCACAGCCTCAAACTCTTGGGCTTG
AACGACCCTCCTGCCTCAGCCTCCTAAGTAGCTGGGACTATAGGTGTGTGCCACTACACC
TGGCTAATTTTTCTATTTTTTGTAGAGAAGGGAGTCTATGTTGCATAGGCTGGTCTCAAA
T
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1008, 2518..2779, 9638..9846, 11598..11726, 11827..11908, 16604..16765, 18222..18296, 33601..33732, 34721..34822, 36249..36380
1001..1008, 2518..2779, 9638..9846, 11598..11726, 11827..11908, 16604..16765, 18222..18296, 33601..33732, 34721..34822, 36249..36377
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved