Microcebus_murinus Locus AQR
snOPY snoRNA Orthological Gene Database
Microcebus_murinus AQR
Microcebus_murinus
AQR
GeneScaffold_2897
SNORA30
106810..106938
126216
GAAAGCTGGCAGTTTCTTAAAAAGTTAAAAATACACCCAATCATTCCATATAGGAACAA
TCATTCCGCTCTTAGATATTTAAGAGACCCAAGTATATGACCCAATCATTCTGCTCCTAG
ATATTTAAGAGAAAAGAAAATATGTGTCCACATAAAGATGTATACAAAAATGCTCATATC
AGCCTTATTTGTAATAACCAAGAGTTTGGAACAACTCAAATGCCCATCAACAGATGACTA
GATTAACAAACTGGCATATCCTTAAGATGGAATGTGTACTACTAAGCAATGAAAAAAAGG
AATGAACCGATACATGCAACAACATGGATGAATCTCAAAATCATTTTGCTGAGTGTAAGA
AGAAACAAAAGGTGCATTCTGTATTGTTTCACTTATATAAAATTCCATTAAAAGCAAACT
ATAGTGACAGGAAGCAGATCAGTGGTTGCCTGAAAATGGGTGGGTGGGAGGTATGAAAGG
GATAGATTAAAAGTACACGAGGATTTTAGGGGCTTTAGATATGCTCACTGTAATGACTTT
GGTGATGGTTTCACAGATGTATGACTATGTCAAAACGTATCAATTTTATAGGTGCAGTTT
ATTGTATGTCAATTTATACCTCCATAAAGCTGTTAAAACGAAGCCCCAAATTCCCAGTCT
TTTTTTTTTACTACAGCTTTCTTTAGGGTTGAAAGAAAACCAAGGTTCCTAGTCCTCCCA
CCTCCCCGCCCCCAGCCGTCACTAACCAGGAGAACCCCCCACCCACCACCATCCACCTGG
CCCCTTCCTGTGATCCCAATCCCTGCTGGATGTTTTCTCTCTGCCGCCCGCTAGGGGGCG
CATACTGAGGAGGTCGAAGCCCTCGGCTCTCTAGCTCAGATCCAACGACTGCATGAACTT
CCGGCCCCGCTCTGTTCCGCTTCCCGGGAACGCAGTGCCTGCTCTGTACAGCTTCCCCGT
GGTACTGCAGTGCTGTGGATTTCCGGGCCGGCGCGTTTTTGCATCGCGGGGTTAGACGCG
GCAGCAGTCGCTTAGGAGAAGTGGACCGGGCTTACCGCTGCCCGCGGCTTGTCCTTCCGT
TTCCACCAGAGTGGAGGGAGAGTGCTGCCATGGCGGCCCCTGCACAGCCCAAGAAAATCG
TAGCTCCTACGGTGTCCCAGATCAACGCGGAGTTCGTGACCCAGGTAAGCTCAGGCGAGT
TTGCTGTGCGTGAGTGGGTAAGGACGTTAAGGCCCCAAGACCTGGGCGTGGGATTTTCTT
TGGGTCTGGGAGCACCCAGGGAGGCATTCATTCCCCAGTTCTTTCACTGCAGTCTTTTTA
CTATCTGGTGTGTGCCGGCCACTAAGTTAGGTGCTGGGGATATCGTGGCGAGAGAAGCTG
CCCCTCCCGGAGAAGTTCACGGCCCAGGGAAGACAGACACATAAAAAGAAAACTACTGTG
TGAGTTTGCTGTATTGGACTTTGTGGCAGGAGCAATGGATTAGAGAGGAAGGAACTGCCC
ACTTTATCTGAGACTGGCAAGAAGGCTTCTCAGCAGAGTGATGCCAGAGTGACTCTTGAG
AGGGGAGTAGGCTTTTCCCTGGCCGTAGAGTAACCTAAGTTTTTGAGCGGAGTGATGAGA
ATCTGAGAAGACTCTCCAAGTATACCATCTATGAAGAGAGTGATCCTGTCGTTTGATAGC
GTTCATTTAGAACTTGTTTACAGTCTTGCATTGTGAGTCTCTGTTGGCTTTGGATAGGAA
AACACAATTGTGTAGTTGTCAGTAACTTTTCTACTCTTCATTAGTTACTTGGAAATTGAA
TAAGAGTGTAAGTAGCTCAATGAAGGTGTTATGCCCATCCTCCTCTTCTTCTTCTTCTTC
TTCTTCTTTTTTTTTTTTTGAGACAAAGTCTCATCCTGTTGCCCAGGCTAGGGTGCCGTG
GCATCAGCCTAGCTCACAGCAATCTCAAACTCCTGGGCTCAAGCAATCCTCCTGCCTCAG
CCTCCCGAGTAGCTGGGACTACAGGCATGTGCCACCATGCCCAGCTAATTTTTATATATA
TATTTTAGTTGTCCAATTAATTTCTTTCTATTTTTAGTAGAGATGGGGGTCTCACTCTTG
TTCAGGCTGGTTTTGGACTCCTGACCTTGAGCGATCTTCCCGCCTCAGCCTCCCAGAGTG
CTAGGATTACAGGCATGAGCCACTGCGCCCGGCCCCATCTGCTTCTTTATTCTCTGTTCC
TTATCTCATCACATTTGCCAGGGAAGAAGCCTAGAAGTCATTTTGAGTCCTCCATTTTCC
TTAACTCGTACATTCTAAATATCTTTTAAATCTGCTTTTCTATACCTCTGTCACCTTAAG
TCAGACTGCCATTGTTTTCTGCCTGGACCAGAGTATCCTAATCTGTCAATGTAGTCTTCC
CTCTTGCTCCTCCAGCCATTCTTCATGTTGTTGTCAGAGTGGTTTTGTACAAGTGCAAAT
CTGATCCTATCACTTGCCTTCTTAAAAATTTTAAAGAGTTCTAATTGCCCTTAGGATAAT
GCCTGGAGTCTTTCAAAGTATTGTGTGCCATGTTGCGCAGGCTGGTCTCAAACTCCTGGC
CTCAAGTGATCCTGCCACCTCGGCCTCCCATAGTTCTAGGGTTGCAGGTGTGAGCCACTG
TGCCTGGCCAGTGGCCTGTGCTTATATCGCTTTCTTCTCCCTTTCTAACTCTGCCTTAGC
CATACTGAACTGTGTTAATTTGAATGTGCTGTGTTGTCTTTCATCTCCTGGCTTTTCAAC
ATTGTTCCTTCTGCTTGAATCATTTTTTCCCACCCTCCCTTTTTCATTGTTATCCTACTG
TACTAATTTAGAGAGGCTTTTCCTGACAACTTAACCTAGATGAGAGCACTATTTCCCCAT
ATACCTGCATTTTTGCAGTAAAAGTCTTAGTTTCCTGCTGTTGTGGAGCTTACATTTTAG
AGAGAAGAGCCAAACAGATGAACAGTATAGTTTCAGACATTGATAAATGCCATGAAGAAA
ATGAAACATGGTTTTGGGACACTGATGGGTGTGGGGTATAGGAAAGGCAGTCAAGAAAAG
TCCTTTCTGAAGTGACATTTGAGCTAACACCTGAATGCAAAGAAGAAGCCAGTTTGGGGA
GAGCAAGGAAACAATACAGGGAATAGAAATGCAAATGCTTTAAGATATGAATGTAAAGAC
GGCCAGAGTGGCTCGAACATGAGAATGGTATGAGATGAGGACACAGCAATGTGTCAGGGA
CCAGATCATATGTGGTTGTAGAGGCTGAGGTAAGAAGTTTGAATTTTATTTTAAATACAG
TGGATTTTAATTGCAGTTTGTGAATACTATTTTAGAAATATTGCTCTAGGTGAAGTGTGG
AAATTGGTTGGGGATGAAAGAGCAAAAGTAGTAATAGGGATACCAGTTAGTCCAGGTATA
GATGATGGTGGCTTCTACTAGTAAAGATTGAAGTAGACTGAATATATTCGGAAGCTAGAG
GCAGTAGGACTTGATGATTACTTTTGGAGAGGTGGAGGAAAGGAACAAATTGAGAATAGT
TTGAACAATTAGGTGAATGGTTTGGACATTTACTGAGATGGAGAAGACTAGGAAAAGATA
AGGCTTAGTGGAAAATGTCAGATTCTAATTTCGCCACATTAAGTGTGAGATGCACAGTAG
ACATTCAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAAATGTGGCAGGGCATAGATGTAGTGGAGAAATGAAGATTCTTGGCAGTCTTG
GGCTATGATAGCAAACATTAATGTCTAATATTTGCCAAATACTGTTTGAACTCTTCTAGG
CTGCAAAGAAAGGTGATCCTTGTCTTCAAGGAGTTCATAGTATGTGGAAGGAGACTTTAG
AGACTTAAAAATCTCAACATAGTTTAATGTGAGAAATACCAGAATAGAGATGTGGGGAAA
GTGCTTTGAGAACAGTTTAAAATGATTACATTTGTCTAAGGAAAGAATTTCCAGGAAGAA
TTTTCTCATTGAGAAAGTGCCATTTGAGATAGACTTTGAGGTGTAGAGCTAGGAAAGTAG
AAGAATTGGACATCTGGGTTTAGGTGTTTCTTCTTTTTTAAAAAATTTAATTTCTGAGCA
TCTGGCACACCTGGCCAGAGAAGATGCTTTTAAATTAATTTCTTGAATGAAGTAAAGAGG
TTAAAATTTAGTTTTAAGAAGATCAGAGATCTGAACTTTATGATCTCATTTTTTTAATGC
TACAGTCTTTCAGTAAGGTTATTTTGAACAATCTATGTTGTCAGAGCTGTACTAAGTGGG
AAATGGAAAGTTTTTATTTAATGTGAGACTAGAGAGTTTGGGGAAGGGCAGTATGTTCTT
AGAGATAGTGATGTCTTAAAGATCACGAGTTAGACCCCAAGGAAAAGGAGAAACTCAGAG
AGAGAAAAGAAGCATGATAGGTGCTTAATGTTTTCTGGATCTTTAAAGTACCGAAGTACA
ATCAGCAATTTAGATCAGAAGATAGGAATTATGTTTTTATTTGTAATTCCCTGAATGCAT
CAGAACAGATTAGACTTAGTTCTCTGAAGGGCGTGATGTAAGAAGAAACTGAGTTTGTGT
GATGCTTACGTGGGGAGTAGAATGAGGAAGTGAGAATACCACAGAATAATTGGGCCTCAG
GAGAGAATTTTCTATTGGGCCAGAGAGTGATTGGTAATTTGGGGAAAAGTGTCATTTAAG
TAGGCAGGTACTGTAATGTTTTTAGAGGCTTTTCCTTAGAGCCAGTTGCATGGGAGTCTT
TTCAAGTGTGTCAACTGTATTAAGTGCTGAGTTGTTATAAAAAAGCAAAGAAGATACAGG
TCCCATCTCTTTAAATGTTCAGATTAAACAAAGAAGAAAGGTGGATAAGCTATCAGATAA
TTACTCTACAGAAAGATAAGACTATAATAGAGTTATTTACAAAATAAAGAGAAGGAAAAA
GCAATTATCACCATCAAATAGTGTTGGGGAAACTGTCAGAGAAGTAACATTTCAAATCTT
ACTTCATTTGTCCATCTATTCATTCATCAAACATTATTTAAGTGCCTCTAATATGCCAGA
CACTTTGCAGAGTCACTTTTTAATAAATAGTTGAGACTTTGTGCTTGATAGATTTTTAAG
AGATTGTAGTGTAGTTTAAAACAAAATCAATAAGACCAGGTTGTTTCTTGAATATTATAC
AATCCATCTAAGTATCTGGAGAGATTGTATATATGTATTTAAATTTCACAATTTCCAGGT
AAAGCCTAATCTACTGAAATGTAACATACCAACTGATTTATTCTCTGTAATAACCAGCTA
ATAGACTATAGTTTTTTTAGTCCTGGGTATGTACTAATCATTTAAAGGTTTACTATTTTA
CAAATTGACATTCATTAAGATTTTTAATCTAGTTTTTAATAGTTGCTCAACTATTAACTA
ACTGTAATCCTGGGCAGATCACTTATTTTTTTCTAGACCAGGGTTTCCTTATCACAATGC
TGAAGGTGTTTGACTGCATGGTTATTAACTGGGCTGTATTGTTTCCATAGGGTTGGTTAG
AGAGGTATGGTTTGGTTTTTTTAAATTGCAATGGCAGGTTGCAGGTGCAAAGCACTATTG
GCACTTAGTGGATTGGGGCCAAGGATGCTAACTGGCCTGCATGCCTATGTAGTCACTTCA
GAATTACTCTGTCCCCCAATGCCAGTAGTGCCTTGTTAAAAAACAGATTCTTACTGAATG
CTTTCAGTCTTCTAGCTCGACAATGGCATGAATATATGACTTACTGCTTATACTCTTTAC
TTTTGCAGTTAGCATGTAAATACTGGGCTCCCCACATCAAGAAAAAATCACCTTTTGATA
TAAAGGTAAGTATTTTTGGTTTGCAAGATATTTTAAAAAAATATTATACTCTTTGTATCT
CTTTTTTAAGGGTTAATTCAACAAAAGCTCTCCAGAATTTTTCTGAAAGTTAAAAATACA
GTTTTTTGATTATCAAACTAGTAATTACTCATGTTAGAAAATTTGGATAATACAGAAATT
ACATGTAAGAAAATAAAAATCACTACCCAGAGATAACTTGTCTTATCATTTTGTTGTATT
TCCATTAAGCTTTTGCAGAAATGCATGTGTATATAATTTTATTTAACCATTTTTTCTATT
TTATAAATTCTTAAGCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGGTTCAATTGAAGCAATTTAAAAAAATTAAAGGAAAAATTCCTA
AATGTAGAGTTAATTCTCATTGGAATAGGTTCTTAAAGAGAGGTCTTTAAATGAAATAGG
TGTGACATATTACATATCATTCAACAAATAATGAAGAGTCAGTTTAAGTTCTGCCCTTAT
AAATTAAATTGTGATACTTTAGATACCCTTGTTAAAAATGAACTTTTTAACCCAAAATTT
CTTACATTTTTTGAGCTTAAATCCTTATAAATATATTTTTGTTCTGTCAGTAATCCTACT
TTATTCCCTAGAAGGATATTCATAAACATGGCATTCATTAATTACTCTTAATTATCAGCA
GCATTACTTTATATTACTATATGCTGTTTATTTTTGTGTTTGTGTTGGAGCTGAGGGTCT
CTAGGATAATTTTTCATTAATAACAAAAATATTCTAATGGCACTGCTACATTGAGTTGAA
TCTAATTAGGTTAAGATTTTTTAGAGATTAAACTCATATCCCGATCATTTTAGTTTTTAC
TAGATAATTGTAGATGAAATTATATGTGCCTCTTCAGAAAAACTTTATTACAGGTTGGTA
TTTAAAGATAGCGATGTCTTCATTTTATTATTTAATTTAAATTTTATTAAAAGAAAAGCA
ATAACAATTTCTTCTAGATTGAATGAGGCTTGCTTTCCTCATCATCTCCCTCCCTCTTCC
ACCCACAAGCATTTATTTCACAAATGTACTTAGAGCAGTTAAAAGATATTATAGTTACCA
TATAATAATATTATATTATACCATGTTAAAGAACTTCATAATTGTACAGGATTTTTTTTT
TACTACTATTAATACTAATACTACTATTAACTTCTATTGCTACCGATAACTATTATCGAA
GGCTCACTATGTGCCATGATTTGTACTAATTCTTTATATGCCCTGTCTTATTTTATTTAC
AGCAACTCTATATAGTAGTTTGTATTATTATATCCATTTTGTGGATAAGGAAACTGAGGC
TTAGATAGGTCAGGAACCGCTTGCTGTAGGATCCCAGCCATCAGTAGTGAAGGTGGATGT
TTTGAACCAGGCTTCTAACTCCAGAGCCTGAATTCTTAAGTATTTTTTACCATTCTGCTC
AGTCTAATTCAAATGAATGGAAATTCTAAGGCCTTATCATGGTCATTTGGATAACCGGAT
ATAACGATTAGCATTAGTTTCTATTATATCTTCACACTTTTACTTTCTGCCTGGCTTTTG
GAAGCACATTGTTAGGACTCTTAAATGGAGTCTGATAACAATTAAAACTTTAAAATTAAG
TTTTTAAAAATATCCTGACTTTGTAAATTTTTATTTTCTCTAGAAATGTTATTAATATAA
ATCATCTTAATGAATCCTGAGCTAGATATATCTTTTTATACTTTGCTTTCTGTTATTTCA
CATTTTGAGAAATGTAATGTCATTATTTAAAAAATTTATTAAGTGTTATTTCATTAGCAG
TAGAATTTTTTTCTTTTTTTTTAAGAGACAGGGTCTTCCTTTGTTGCCCAGGGCTGGAAT
GCAGTGGTGCAATCATAGTTCACTGCAACTTTGAAATCCTGGGCTCAAATGATCCTCCTG
CTCAGCTGCCTGAGTAGCTAGGAAAGACTTCAGGCATGCACCATGCCTGCCTAACTTTTT
TATTTTTGTTGAGACAGAGTCTCAGTACATTGCCAGGCTGATCTCAAACTCCTGGCCTGA
ATAGATCCTCCCGCTTTGACCTCCCAAAGTGCTGGGGGATTATGGGTGTGAGCCAGCCAC
CACACCAGGCCAATAGTAGTAACATTTGATAGCTTTCCTAAACCAGTTTATTATGTATAA
TCTCACCAATTGAAAACTATCAATTTAGGATCTTTAAAAAAGTTGTTTGAGATATTAAAC
ATTTTATGTTTTTGATAACAGGTGATTGAAGATATATATGAGAAAGAAATTGTCAAATCA
AGGTAGGAATGAGTTTAAATTTTATACATTGGCATTAGGGGTGGACCACGTTGGATATTG
TCTGAACTTCTGTGATCATAACTTGGAACTTTTATTTATTTTTTGATTTGCTCAGGGAGA
TGGTGCCTAGAAAAACTTTGTATTTTGGTGCTGAAGAGTGATAAATTATTTCTTTGCCTT
CTAATTTTTGGCTCAGATTGGAGGAATTAAATCCTATAGAGTTTGTCTTTAGAAGGAAGA
TGAGAGAGAGTAAAAGCTAAATATTTTATTTCAATTCAACTAATTTTCTTATCATTTCTG
ACTAGTCTTTTAAAAAATATTCTTAAAATATTATAAAAGTAAAACATGTACAGTAATAAA
TTCAAAATAATATATTTTATGCATTTATATAATATATAATATACATTTATATAATATATA
CATAATATATAAAATATATAATAAAATTTGAAAAAAAGAATTATTTTTGAACAATATATA
GAAAAGGATGTTTCAATATTCTTCCCTGCCTTTTAACCCCTGATTTATTTCCTATGTATA
TATCTATTCTGTTTCCCAGCCCCTCCTCCCACATTTTTCCAAACAAGAAAGGGTTTATAC
TCTACATGATTCTCCATCATGCTATTTTTTTTAATTTAACAGTATATCATGAGCATCTTT
CCATGTATGCACCTGTAGACATGTATGACCAGTGAATATTTTAAAAGGGTATTTGATGAA
AGGTTTTAATATGAAATGGAAACATTTATATTATGAATGCTACAGATTTTATAAAATCTT
GTATTTGATATTTTTCATATGTTTGTATCTTAGGAAGTAAATTTGGCTAAATATTGTGAA
GAGAAGTCTATGGCAGTGTCAAACTCAGAGGCTAGTTATTTTGATTTTTTTGTTATAATG
ATTGATTCATGAGCCTATAGAGGTAGGCAGAGTCAAAGGTCATGTTAAGGATTTTGTTCT
TTATTTGAAAAGCAATAGGAAGCTTTTCAATGAAGAGTTGTAAGCACAATGGTGATATTA
GTAAAAGGGAATTTGGATTTGAAGGGGTAAGAGGCAGGGAATTACTTAAGTGTGTATTGA
ATTAGTCAGCTTCAGAGTAATGATGGGTTGGACTTGTGTGAAAAGTTGAGAAGGAGAGAA
ATTGTCTATTTGAGAAAGAAGTGAAGAGACTTGATGGTTGGATATGGTAGATGAGGGAAA
GGGAAGAATCAAAGATGACCCCAGAATTTTTTGCTTAAGTTGCTGGGTGTTAATGGTACT
ATTACTGACTTTTGCTATTGTTAGGGGTAGGACTAGGTGGATCTTTAGTTCACATTTGGA
TATCTTGAATTCTAGATAATTAAGAGCCATGGAGTTGGAGATGTAGAATAAGTAGTTGGG
TATGTAGGTATATAGTTCAGAAGAGACTGGGTTGAGCCTACTTTGTATCAACCACCATTT
TGATGCTAAAGATACAACAGTGAACAAGGTAGATAGAGGTCCTACTTTCATGGAGCTTAC
ATTCTAGTGAGGATGACAGACAGGAAACATACAGATGTGATGTAATGTCAGGTAATAGTA
AGTGCAATGAATTAAAGTGTGGGTAGGGGATAGTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATTTA
AACCCTTGCTGTTAACATTTTTCTTTAAAGATAATTTTTTATAACAGAATAACAAAAAGC
TTCCAGTGATTTTTAAGCCATGTAGACTTGGCTACGTTGTTTTTAATTGCTGAAAGAAGT
GTCATTAGCAGGGCTTGCTAAGAGTATCATGGCACATTTAATAACTATTTTGTCATCTTG
TACAGATTTTTGAACACTAAAAGCACTTCTATAACACATAAACTGTAATTGTATTTAAAA
ATTTAAATGACCAATTTTCTAGACTAGTGTTTGAGGGAATTATTTTGCTGAGCTGTGCGC
TCATGGTATCTTCAGTATTGGAGGAATGGTTTGGTAATATTTATTAAGTTGTTTGTAGGT
TATCAAAATATTCAGTTTATAACCATAAGATACTCTTAATGTTATACATTAAGGTACTCA
TAATATTCATTTTTTGTACATCAACCCTATTTTTCCAGGAGGCATCTGGGAAATAACCAT
TTCTTATTATTACATATAAATAAATAATCACTTCTCATATCTCAAAATTACCTCTTAAAA
GGTCATATTACCCAGTCACTGTATAGTGTATGGTATATTACACAATTGATTCATTTTTGC
AATTCTTGCCATTGTCAGATTTAGTAAGCTTGTCTTAATATATTTTCATCTAATTTCATT
TTAAAATATTTTTAAAATAATAATTGTTATTTGTTAAGTATTTACTATGTGCCAGAGTCT
GTTCTAAGCACCTTGCATATAGGAGCTCATTTATTCCACAGCCCTGTGACACTATTATTA
TCCTCATTTTATGGGTGAGGAAACCAAGGAATAGAGAGGTTAAGTAACTTGCCCAAGATG
TTTCCCAGTAGTTAGAGGCACAGCCAAGTACTAAATCCTGGTTCCCGGGCTCTTAATCAA
TACTCTGTTCTTAAATAACAGTCCATTGGCCTCTAGAAATCTCTTAGCTGTTACCCTTTG
GTGTGATTATTAATCCTGTTATGAATCCATCTAAGTAGTTTTTGTGCTTAAAAAAAAGGA
GGTGACTTATAGAGAGCAATTTAGTTTTGCCCAAGTATATTTATTTTTGTTTGAAATGTG
TAAACCCTTTTATTATAAAATACAACACAGAAAAGGGCATGAAACAGACATATATAGCCT
TATTAATTATAATAATAATTCATAACCACCACCTAGTTAAAAAGAAAAACAAAACAGAAC
ATTGTCAGCGACTCAGAACCTCCCTGCTTGTTCCTTTTTTTTAACATTATATGTAAGCAT
TCAAACACAAACACTATAATTTTGCTTCTTTTTGAACTCAAATGGAAACACACAGTATAT
ATTCTTTTGTGGCTGATTTTTTTTGTTCACTATTTATTTATTTTTTTAATAATCTATTTG
ACAAATCTGGAAGTAGGTAGTTCAGAAGTTCATAATGTCAATGCCCTTGTCAGTCTCTTA
AAAAAAAATTTTTTTTTTTTGGCTTTTCCTGTGTGGTTAAAAAGGTTGCCACAGCTCCAG
ACCTCATGTTTTCACACAATCATATCCCAAGAGAGGAAACGGGGCAATTATAGCTGTGGA
GGAGCTCACCTTTTCATACTCCCTCTTTTTTCCTTATCAGGTTGAATAATATAGTTAACA
GACCCAGTTTGTTGTACATAATTTATCCAACTTTGGGAGTATTTAATGAAATGCATTTTA
AGTCGTTGGGACAGTGTCAGGCACGATACATGATGCTCTCAGTAAATATTGATATATTTA
CTTGGCTGCACTACTTCTTTTATCCATGAGGAAACTGAGTCCCAGAATGTTTGAAAGACA
CTGCCAAGGTAACACTGAGTCATAACTAGAATATTGGTCTTTTTTCTCATGAGCCAGGAT
TTTCTCTCTTTTATAATGAGGTCCTATGTGTAGCTGAAGAAATTAATTGTGGAGTTCTGT
GTATAGTGGACACTGAGTAAATTCTGTTGTCTAACATGCAATTCAAGAGAAATGTCTGCA
GGTGGAGATCTAGAGTATGTCACTCAGGAAGTTTTTGTGCTTTCACATAAAGTAAAGACC
TTCATTCCATTCTCACTGAAGTTCTGTGACATTGCTTGCTCAGTGAAACTATTTAAGAGA
TCAGAAATCAGTGAAATAGGATTTTGACAGGATGATGGTCTCTTGTGGTATTATAAATTC
ATAATACATGTACATTTAATTTTCACAGCCAAGAATTATCTAGCAGTATTCTGGTCTGTC
TACTTTATTTCCATATTACAAAATGATAAAACTAAATTAGTGACCTTTTGAATCTGCCCT
TGGAGAAATACCCTATGACAATAGCATTGTTTATTCATATAAAACAAAATATTTCTGTTA
AAAAAAGAGCATAATAAAGAGAGATATGAATATCTGATATTTCCTCCACAATATTCTGAT
ATTTTGGGCTCACTGTGAACACTAAGAAGCACAGGAAACATCTGATTTCCACATTTGCAA
TATAGATACTTATATGCTGTATGCTTTTAGGAGGATGTGACTTTTTTTTTTTTTTTAAGA
CAGTCTCGCTTTGTTGCCCAGGCTAGAGTGAGTGCTGTGGCATCAGCCTAGCTCACACAG
CAACCTCAAACTCCTGAGCTCAAACGATCCTACTGCCTCAGCCTCCTGAGTAAGCTGGGA
CTACAGGCATGTGCCACCATGCCCAGCTGATTTTTTCTATATATATTAGTTGGCCAATTA
ATTTCTTTCTATTTATAATAGAGACAGGGTCTCGCTCTTTGTTCAGGCTGGTTTTGAACT
CCTGACCTTGAGCGATCCACCCACCTCGGCCTCCCAGAGTGCTAGGATTACAGGGCGTGA
GCCACCTTTGTCCCGGAATAGGAAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTTGTTCAAGATAATGCAATTAAGTAATTGGAAGAGCTTGGATGCCAGTATCTGATG
CCAAAGCTCATGGTTTTTCACCTTTTCTATACTTCCTTGAGATCTGGTCTGCATTATAAG
TCAGAACCTCTGTATTAATAACTGTCTCCCTACATAAACTAATTTGATCTTTAGCCCTCC
ACCCCCCCCAAAAAAAGCATGGAGTAGGTGAAGTAGGTCTTACCATTTTTATAGAGCAAA
ATTGATATTTATAGTTATGAATTAGCTAGCTAGTAAATTAAGTATCTCCTGTATCCTAAG
ACTATATTGTTATAATGTTTAATCCTCACAATAATACCAGTAAGATCTTATTTTATAGAG
GAGAAAACTGAGGCTAGAAATTGTACTCCTCTGGCCATTAGATGAATATGCCTTTTTTAC
GATATCATGTCTCCTTTCAGGATGACAGATAAAAATCAAGAGGATAGTGATATGCAATTA
GCATTAACCAGAATTCTAGAGTCCAGAAACCAGGAGAATTGCAGCAGCTGAAGTGGAAAG
CAACGAAACAGATCAAAAGCATCAATGACAATGAAAAATTTTTAATAACTAAAAAAGTGG
GTTCTTAACTTTCAGGAACTTTTGTGTGATTTTGATACACGAATGTAATCTTCTCTGGGT
CAACTTCCAGATATAAACAGTCTAAAGTTTGTAATAGAGAGTAATTGATTGTCTTTTGCT
AGAGTGGAAAATGAGATGTCATGGAAAGGTAGCTGGGTACAGAAAAGTGAACTGAGAAAA
GAAGAGGGGGTTTTGTTGGTAAAAGTCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAAAATGAGATGTCATGGAAAAGGTAGCTGGGTACAGAAAAGTGAACTGAG
AAAAGAAGAGGGGTTTTGTTGGTAAAAGTCATTGGAATGAGGTATTATTATATATCAGTT
ACATTTGCTGCAATTACTGAAATAGAATTAGGGAGTTGTTAAACTACTCCTTAAGTTTGG
AGAACAGATACGTACTTTGGAGTAAGAACTATACCTGTATCATAGGCAAATCAGTGACCT
CATTGCCTCAATTTCCTCATCTAAAAAAAATGTAAAGAATAGATTTGGAGTTTGCTGTGT
AGTCAGATAATACCCAAGACAAGACATTGCTATTAAAATCTGTAGCAAGCCAATGATATC
CTAGGGCATCTGACAGAAACAAATATAAAGATACTCTGGAAGAATGTGTATTTCAACTAT
ACTGCAAAAAATTTCTGTATATAAAACTCTGATAAAGGTAAGTTCATACTCCCAAATACA
GAGCATATTAGGATAATAATCCAGTGTAATAATCCAGAGATGATTGTCAAGAATTTTCTA
GAGTTGATGAACAATATGAGTCTTTTAGATTCTAGAAGTACTATAATAAGTCCTGAACAG
AGCAACAAAGACAGAATGAAGATCTTAAAATCTGCTGAAGGGAAAAGACAGATTACTCAA
AGAGGAGGAAGGACAAATAGATTGTAGACTTTTCAATTATAGTAATAGAGAAGATAATGG
AATGAGACATTTCATTCCATTATCTTAAATAGAAAAAAATCACTTTCAACCTAGAATTAT
ACACCCAGCTAAACTGTCACGAAATAAATGTTAGACAAAGATAAATATTATTGCTGACAG
AAATTCTAAAGGATTATAATTCAGAAAAAAAGAAAAGAATGAAATGAAGCTTCACTTATT
TTATTTGTGAAATAATCTAATCTTTCACTTGGATCCTTTTGATCATTATTTTTGGTAAAA
ACTTACCCAGTTTCCTTAGGTTTTTGCAAATTAAGCAAAAAGAATTGATTGCTGAAAAAC
TCAGAATCCTTAAAGCATAAGAGAAAGTAGAAAAACTGTAGTGCTATAGCAGAATCTAAA
ACACTTAACAGTGCGTGGGTGTGTGTGAAAAATTGTACACATTTAGTGATTTAAAGCAGA
AGCAAGAACTCCTGCTTTTTTCCATTAGTGCTTGAGAGTATTTTATAGCCCAGTGTCATA
ATTAATGTTTATAACTATCTTGAGTGGCAACAAATGGCTATGTGTTATTTGAGAAATCAG
AAATACTTAAATTTGTGTAGGAATATTTCCACCAAGGTCTTTAAATAAGAATTATGGCAT
GTAGAGGGGAAAATTTCAGTTACCTTGAAAACTGACTTATGTTGAATACCTCATAAATTA
AATATTACAAAGCCTCTTTTTAATTGTTAATTCTCTTCCTTTTTTCTGAAAGTGATTTCA
AGTCTTGATATGAGTAAGTGTTAATGTCTCAGATACTTTTGTCAGTAAGAGTGTCCGTCA
TATAATCTTGTTTTAGAGCTGACAATTTGTCAAGTATTTTTGTTTTTTACTTCATGAAGA
GGCTTAGATAAGGGAATATCCAGTGATCTGATGGTGATAAGTATGCATGTTGTAACCTTG
GATGTCTTATTACTTGAAAGTATATAACTGTCTTTCTCCAAGGCCAAATTTTCTACATAT
AAGTTTGTAGCAGGTAGCAGTGACCTAGATTACTGATAAATTTGTGAAGGATTCTTCAAA
TCATAAATATAGATTTTCAAAATGTTTTCAGAAAGTTATAAATAATACAGCTTTCCAGGT
GAGTGATATATTCCAATGAGTCATGGTAACTAATGAAATATTCTATGACTTTTTACTCTT
TACAGCCAGTATCTTGAAAATTACCTCTGGATGAATTATTCTCCAGAGGTGTCCAGCAAG
GCCTATTTAATGTCAATCTGCTGTATGGTGAATGAGAAGTTCAGAGAAAATGTCCCTGCA
TGGGAGGTAACAGATTTAAATTACTTTATAGCTTTCATTCTGTGCCCACTTAGGTCATTC
CAAAGGAATGAACTTTTTAGTGATGAACTTTTTATTGATGTAATAATAAATAGTGCAGAA
CTTTTTATTGATCTAATAATAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGACAAAA
AGAATGTGAAAGATACCAGTTTTCTTTCAGTTTCATATTTTCTTCAAATTAATTTATTAT
GAATTGAAAAATTACAAATGTGGAATTATTTTTCTGCTTTGTGCTTAAAACAAAGAATGG
CATGTATGATGAAGACTTACATCAGGAGCTGGCAAAGAGAAAGTTACATTTATAAAGTAC
AAATAGATAAATGTTCAAATGAGATAATATTTTTCAGTGTCTTGTTTCACAACAGGGGGT
ATATACTTGTTTGAATAAAGAAGCATTTTCAAAGTCAAGACAGATGTTTACATTGTAATT
TCAGTTTTCTTTTTGTCCCTGATTTGGGATCTGTTTTTCCTTTTTGAAATTTTTCATGAA
CTGATGTTTTATTTTTGTGCTGGTGCAACAGAGGCTTGGTCAGTAGCAGTCCAAAATCCA
GGTTTTCTTTGCCCACTGTAAAATAGTTACCTTACCAAAAGAGTTTCTTCTCTTCCAGTC
AGACTTTTTAAATAAAGAAACGGCATGAATTCTTTTCATCTCTTTTGAGAGAATGATCTC
CAAAATGAGAAGGTGTTAGAGTCATTAAGATAAAACAAACCATGGGCAGTTCTCTCAAAT
ATTCATTGACTGCCATCTTGGGGCACATTAGAGCTCAAAGTGAGTGTGAGTCTTATGTCT
TATTGAGGGATCTGAGATATTGATTGCCTTAAGCTATTATAGAAAGGAAGAGGGAAAATT
TTTTGAGCCAGGGAATAACATGATCAGTTTGCATGTTTTAAAAACCACTTTGGTGATTAG
GGCTTGAAATACAGAGGTGACAACACAGACTTTGAAGACAAACACAGATTTAGAAAGAAT
AATTGATTAGATTTGATAATTAATTGAAGTGGCATTTGAAAAGGTTTTGTTTTCAATAAC
CTTCTAGGCTTAGGCAACTGATGAGTATAATAGATGATGATACCATTTACCAAGATAGGT
AATAGAGGATGATGAATACTTTGGAGGATACAAAACTATTGAATTGAGTTTTGGACTTAC
TTAGTTTAAACTGCTTTTGGAATACCTAGATGAAATTGTCTAGTAAACTGAGGGATCTAA
GGTTATAGAGCTAAAAAGAGAAATCTGGACTGTTGATGTGTATTTGGAATCATTAGCATG
TGGTAGTTAAAGTAATGGAGGTGGGGGAGAATAAGGCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACAACTAGTATAGACCATGCATTTGGAGTACTTGTCCAGGGC
AGTAAGTACAAGGAGGTAGATCAAAGAGGCTTGAGTATATTTACCTTCTATATTTACATT
ATATTTACATGTTAAGAGTAAGGAGCTAATATAAAGCAGGAGAGGCTGTCTTGAGATTAA
TTACAGTGTGAAAACTATAATTTTTGCTAAAGATACAGTTTCTTTTGCCTAAATCAGAAG
AATTAAAATACTTCAGATCTTTAATAAGAAAACAAAACCTAACTGTAGAAGAAAAACTAA
AGGAATTAAGACCGTTATTTTATTAGCTAAAGGTTCATGCAACTCTCTCATTGTCCAGTC
AGAAACCTATATTTGACTTGATACCGTTAATTATAAGTAAGCATGTAATGCTCCTGATAC
ACATACAAATAATCTTTTTGTAATGTTTTGGTTTTGTTAATAGACTCCTAAACAGCCTAC
CAGTGCTTCTTTAAGGGGGAAAAACAGGTGAGCAAGCCAATTCAAAATAAATTTATACTC
TTTTCTTTTCAGACTTTCAAGAAGAAGCCAGACCACTTCCCATTCTTTTTTAAGCACATC
TTAAAAGCGGCATTAGCTGAAACTGATGGTGAATTTTCACTCCATGAACAGACAGTCTTA
CTACTTTTTCTTGATCATTGCTTCAATAGTTTGGTAATTTTTATACTTTGGGGAAATTTT
CAAGTTTTCTTGTTTTTTTTAAGGTTGAGTTTAGATAAGATTACATCTGTAGCCAAATCT
TCATCCACAGTAGCAGGGAATAAGAGTAATGGTAAAAGCTTAATTTCAGCCTCTTAACAA
TAAACCATTTTGTAAGATATGTTCATTTTTTAATAGATTTGGGCTTGATTTCTCCTTTTT
TCTATTGACTCTAAGAAAAATGATAAAGAAATTGAAACTACAAAGGAAGAACACAAAAAT
GAGAAGCAACAAAGAGCCTAGTTAATAGGAAGTTTGAGTAAGGAGATCTGTGCTATAAGC
TGCATATAAAAATGTAGTTTCATTGCTTTTCAGTTATGCTTCATGCATAGGCTGAAGAGT
TGTATTTTTAGTTGACTGATTAAGGCCGATTGTGGATGATCTTTGAAAATGTGTTGTATG
GGATACATTTTCATCCTTTATAGGGATTATCTTCTAAAAATATTTTCAGTAATTAATATT
TTATTTGAGTTTCCTTACTGTGGTTATCTGAAGGTATATGCATATATATTCAAAGATAAG
TGCTTTAGAATTGATAATGCACTTAGACCCGTGCATGAGAATGATGATTCTTTCTTATGC
CAAGACTGATGTGATGATGATGTATACTAGTATGCATGTATGCTACTTGATCTCATAAAG
GCATTAAAAAAAAGATTATGATGCTCACAGTGGATAGCACTGTTACCTAAATTAACATTT
GTTAAAATAAATGGTGCAAATAGAAATATAAGTAAAAGTGATTCCTTATCAGAAATTGAA
CAAAAAGAAGATTTAATTAGTATTAGTAGTTTGGTGCTAGATTTAACCGACTTAAAACTA
GTTTATTATTGAAATGCTTTGTCTTTATTAATTTGCAGTTAATTCTTGTTACTTGAGGTA
GTTATGTTCATTTTTGACTTAGCTGATACTGAACCATTGCTCATTGGAGAATATAAGGTT
AGGTTCCTGTATGCTTTTGTTACAATGTTTTTGTCAACTTATCAATACATAACCTTATTT
TATGTGTGTTTCTGTTTAAAGACAACTTATTTTAATATGTATTGTTGATTCAGTGACTGT
GAATTTACCACCAACAGCACTATAACTTGTGCCTAAACGAAGTTTATCTAACACACATGT
TTTCTCCATAAGGCACATCACGGCCTTTTTGTACCCACAAACATTATACAGCTTATACAG
CACGTTAGCCTTGTGCTCAGGACCATTTTAAACAGTGAATCACCAACAAAAAGCACAAAC
ATATGAGAAAAAGTAGCACTAAATAGACTACAAAAAGGATACTTGTTTATTATGAGAGGC
TGAAAGAGAAGCAGAGTGTCAGTTCAGTCTCAACCGTGAATGTGTGTATCAAGTAACTCA
AAATTTTTTGCCACTTTCTGCTGTGAATGACTGTTAAAGTGCAGAGAGTATTGCTTTTGG
AGGTAAAATACATTTTTGTTAGTAGGTGAATTTGAAAATATGAAATCTGTGAATAATGAG
GATCGATTTTTTAAAAAAGTATTGAACCTCTTAATATTCAAATATCATCAATTTGTAAGT
GTTTATGGCATGTTTTCCCCAAAAGACTTAAAAAGGCAGTGTACTCTTTATGTAAGGACT
TATGTAGAAATGCTCTTATATTTCTAAACTTGTTTTCTCCATGCATTAAACAGGAAGTAG
ACTTGATACGGAGTCAAGTACAGCAGCTTATCTCCCTTCCAATGTGGATGGGCTTACAGC
CTGTAAGTATCTAATTTCAGAATCTTATGCATGTACGTTTAAGTGGAATGCAGTTTTAGA
CTGTGTACCTTTAACATGGATATAAAAGTGGTAGCTAAACATCCCCTTTTCTTGCTTAGA
AAGGTTATTGTGCATTAACTTATTACAGTTTTAAAGTTTTTATGTGCAATCTAATATGTG
TTTCACCTAATTTCAGTATTGTGAGGTGAAATAAGGTAGTATCCATTGAGCTTGTAGGGA
AAGGAGGTTAATTTAGCAAAGTATGGTTATTATTCTGATGTATGACTTTGGATGAGACTA
CACATAGACTTGAATTTTTTATTTCCCTTGACTGGAATGTATATACAACTGTAGGAATGG
GTCTGGGTCATGTTTAATATTAAAGACTTCCATTTTTTCATCAAATCTTTATTAGATAAT
ATGTGCAAGTGTCAAAGCGAAACTAATACATTTTAGGGAGTTAAAACTGTCATATTTCAG
TGTAATACCTTATTCAAAATTCCATTTTCCTGCACATGGGTGATTCTGTATATACACAGA
TATGCAGGCTCATTTGTAGGCACCATCTGATGGGGATGAAAGCATAGGCATATATAGATA
ATTAGTACTAAGTTAAAAAGAGACAAGTGCTGTAAGAGAGAATATGCCCTGATGTGGACT
TTTCCTTGTTTACTTGTGATAGCTGTTTTTTGTTCCTTGTTTCAGACTTATATAACTTCA
ATGATTATGCTCATAAGTGTTAATGTTTATATTTTTCAGATTTAAATCCTTAATTTAGAA
ATTAAAAAAATTTTGTTGATTATTGAGCTTAAAAATCTTGGCTAGAAAAGGTACTTTGTT
TTGTTATATTTTTAGTAACAGGCATTAGAATTGAATAATTTTTAAAAATATTCATTTCTT
AGTTTTCAGGGTTTGTCATGTGCTTTCAGGATTTATCATATTGCTCTATATCATATCCAT
ATATTAGAAAAGTACCTGATAGTTGATATAATCCTTATCCTTGTAAACTTTTAGGTTACT
GGTGATTGAATATCACATCTTTCTTTCAGGCACGATTAGAATTAGAATTAAAAAAAACAC
CTAAGCTAAGAAAATTCTGGAACTTGATTAAAAAGAATGATGAAAAGATGGATCCAGGAG
CAAGAGAACAGTATGTTGGCAAAGCTTTGTTCCATATTAGCTTATTGTACTGGGTTATGG
GTCTTAGATGATTTGTCTGGTTTATTGCTTCCTTTTATATAGTACTGAGCCCAAATACAT
TATTAGTAAGTGCTTTTACTTAGACTGTCATAGGAATATTTTTCAGAAAGATCTAAAGGG
GAAGCCACAACATCACCGTGCTTTTTTTCTTTTCTCTTTGCCAGTGATAAGTATTATATA
GAGTTACTCACTGTTCTTCTTGCTACTTGTTGTCTCAGATCATCCTCATGGATGGTTCTC
AATTTTCTTGGTAATCTTCAGGCTGTTAATCCAACTTCTCTTTCTTTTTCTTACATCTTC
ACTCTTTTTTTTTTTTTTTTCTGAGATAGAGTGTCACTTTGTTGCCCAAGCTAGAGTGAG
TGCCATGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTCCT
GCCTCAGCCTCCCACATAGCTGGGACTACAGGCATGTGCCTCCATTCCTGGCTAATTTTT
TCTATATATTAGAAATTAATTTCTTTCTATTTTAGTAGAGACAGGATCTCACTCTTGCTC
AGGCCAGTTCCTTGAGTGATCCACCCACCTCGGCCTCCCAGAGTACTGGGATTACAGGCG
TGAGCCACCGTGCCCGGCCTCACCTTCCCTCTTCACAATGACTTTTACACACTCCAACTA
TCATTCATTTATTCAACAAATATTGAGTGTTCATTTTGCCAGGTACTGTTATAGGAGATA
CAGCAGTTTTATTAATTACATACTATCTTGTGTTACTAATTATGTTTGTATCATATGACT
TGTCGTTTCAAGTAGATTTTAGTCATTCCTCCCTTTGTATTTCCAGCAGGACGATTACAG
TCATTTGCAGTTACGCAACACCTAAAAAGTGTTTGTTGATGAGTTAGTGTATCTTAAATT
AGTAATGAGTAGAAAATTGTTTTTTAAATTAACATTTAATCTTTAGCCATTGTAATACTT
TATTATTCTTAATAAAGTATGAAATTGTTCCTCTCATTTTAACTACCTTAAATGTTAGAT
TTTTAATGTTAAGGGCAGACTATAAATGAAATTTTGAGAACTCCTTTCTAGTTCTGACCC
TGAAGTCACAGTGAAAACTTCTACAATGAGAGAAAGTGGTGCTTGCTTAGCTGGATTATT
AGGCCAGTAATGTGGCTCTCCTTTTCTTTATACAATACTGTATTTATATATAGATAAGCA
GCAGTGTGTTTAAATTATGGCCCCAATTTTAGAAATGGAACATGTGAACAATTTAGGAAG
AGGTCAGCATTCAAACTTCACTTTTAAATAACTATTTTTCAAAAATAATTGTTTAATATT
CTTTCTGATTTTAGGGCCTATCAAGAAAGAAGATTTCTTTCACAACTCATCCAGAAGTTT
ATCTCTGTGCTGAAATCAGTACCACTTTCTGGTAACTATCTTCTTTTACTGAGCACATTT
GTAAAGTTATCGTTTAGATGTTCCTATGGTATTCACTCATCTCTAATCTAAAAACTGCTT
TTGGAATAATTTTAAATTGTAATGATAAATTGTATGTCCTCTACTTTTCAAGTATATACC
AGTCTAAGCATTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCATTTCGGAAAAG
CAAATAGAATATTATTTACTTATAAAGGGTATATGTTATGTTAGATGACATGTTTATGAT
ATTTTATTTTTTTAAGTGGAAGTATAGTCTAAGAGCAGTTCTATAAGTGTACCATATTTA
TATTTTTGCATCAGAGATTGTAGCTTTGTTTAAACTAAATACAATGAAATTACACTGACC
CTCTAAGTAATGTTTTACAACTGAAAATCATAGCTATACTTTAGTGAGGAGTAGATATTA
ATACTATAAATCAATTGTGTCTGATTTGGGGCATAATACTACTACCAGCATCAGTATAAA
GAAAAAGTTGTCATATACTTATAATCTAAGTTACTTAATATTAGTATATTTCAATCTTTC
CTTAATGGAAAGACACTTAATGTGTCTTAAACCTGGAAAGAGGACTAAGATTGGGTTTTC
TTGGTACAAATAGTAACGAGTGTTTTGAACTACTAATGTCTGTAATAACTAGGGTCATAA
AAATTGATGTCTCTAACTGTGGAATATTTGTCTAGTTCATCTAGGTTTGAAAGACAAGAA
GTGCCTGTAGCAATTTTAATAGCCTGTAAACCACTAGCTGTTGCCACTGTTGTTTATATA
TTGTCAGAAAACAAAATTTCTTAATCTTGAGCTTTAATCACAGTTTGTCAACTTGCTGGT
AAAGGAACCAGCAAGATGATGAAAATGTGCCAGTTTTGAGAGGGTATGAAGATGTATGGA
TTACATAGCCTGGAAATAGAAAGCTAATTTTTAAAAGGGTTTAAGAAGGATTATAGTTTC
GTTTGATAGGGTCATAAAACAACACACTGATAACACTTGTTGGAAATCTGTGTAGGATGG
CCTGAAATGTTAGGACTGCTGTCAGAGGAAGGGGAAAAAAACTATAGTATATCTAAGAGA
CAAATGACAAGGATATATTTGTGTCTGTAATGGAAATAGCAAGGTTTCTATACTGAGCGT
TATACCCAGGAAAGTCAACTAACATAAAAACATGCAACNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNATTTCCAGTTAACATTTCGAAATATTAGTCACAAAAGTATTC
ACATTTATTTCTTCACATAATGCCTTCTGTTTTCCTGTATATTATAAATCAATTAAATAA
ATAGATTTTTATTTAAGTATTTAGAGGATACCTTCTATAAATCTGGCACTGGATTTGTCA
CTGCTGGGAGTCCTTAAACTAAGCAGCAACGGGGACCCTAAAATTATCTCCATTTACTTG
AAACCGTTTTGGCAGGATGGTTTTAGCTGGTTAAATTGTAGACTGTTTCCTGGCATTAGG
AAAAAAACTTGTACTCTGAAACTATTTCATGTCACAAGGTTGTAATTATTTAAAAACAAA
AATAAATGTTTATAAAAATAGTATATTATGCTCATGAATAGCATAAAATAAGATAATGAT
TTAAAAAATATTTTATTGCTCTGTGTGTCATTGGCATTTTAATATCAGAAATAATACATA
TAAGTATATATGTGTACACATACTTGTGTTTATACATATGAGAGAACTTTTAGAAGTTTA
GTATGTGTAGACAATAAGGAAAATGGAGCAAAAACTGATATAAAACTGCCTTCTGGGTTT
TTATATCTTCCAAGTTTTTTAAAATCTAATCATTAAGTAATCTTTGCAAACTTGAATTTT
AACACTCACTTCTGACCCAAGCTAGATTTTTCATTTCCTCATGTTTGTAGAGCTAAATTA
TCAGGGTACAGTCTACCTCTGCCTTTTAAAAAATATATATGTGATTTTTACTCTGAACCT
TAGCCCAATCCTGATGAATAAGGACATATGACTGTTTAAATTATNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCAGGGTACAGTCTACCTCTGCCTTTTAAAAAAATATATATGTGATTTTTACTCTG
AACCCTTAGCCCAATCCTGATGAATAAGGGACATATGACTGTTTAAATTATTAAATAACT
GCCAATTTTAAGAAATATCATGCAAATGGCCTAACATGTTTTCTCTCTCATGTCTAGAAC
CTGTTACCATGGACAAAGTTCATTACTGTGAAAGATTTATTGAACTTATGATTGATCTAG
AGGTAAGAAATCTACAGTGACCTTTCTGCTATATAATCATTAAGGGTCTAAGATTAAGCA
TATGACTATATATGAAATATTTCTTTTCCAAACTGGCCTTTGTTTGTACCTGTTTCGAGG
TGTCACATAGAGTAGAAAATCACAAGTAATTGGCCCTTGAGGTTTTCAAATGACTGACCC
ATCTAGCATGGACTGCTGTTCTTAGAGAAAAACAGTATAGTTATTAAACATGAGTCCAGT
AATGGCAATTTATTTTCTATTGTACTTTATTTTAATACTCCTTCATATGAAGTTTTCGCT
AATGGCTGAAGTCACGAGTTTATGACCATCTTTTTAGATAATCTCACTTTTCTAAATGTG
TCTAATATTGATGAAGAAAAATATAACTGCTATTTTCAATTTTTTAAATTAAGATTCTTA
AAAAAGAAGATTTCATACTTAGGTGCAGAATTTAATGGCAAGTTCAGATAAAGAATTGAT
ATAATTCAGATTGAATCCATTTCTTTTCCGTTCTCTCTTTAATGTGGAAAATTGAAAGAC
AACACATTTGTTCTTATCTGGAGATAAAGGATGTGTGGTTTCTTGAAATGAGTATTAGAG
TATTGGACTAACAGTCACTCATGATACTGTCATTCAAATTCTAGCTCTGAGTAATCAGTT
TATAGTCTCTGTGTATCTCAATAATCTCATCCATAAAATGAGGATATTTGATTAGATTAG
TAGTTTTCATGCTGTTTCTGGCTCAGTTTCTTGGCATTGTCTTTCTGACTGTCATAAGGG
AATGTAGGAAGAAGAAACAGAGACAGGAGTCTCCACTTTGGGGTCTGTACTCCACGTTTT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGTTCAAATT
CTCTTACGTAGTCAGTTCTGCTGTCTGTCAAGGAGTCTGTGATCTCCTGCTTCTTTCCTA
AGGTAGCTTCTGGATACATGGAGACGTTAAGATAGCCTTATTATTTTGGAAAAGGAAAGA
GCACAGATGTCTTTTCTTGGTTTTTTTTTTTTTTTTTTTTTAGAATATTAGTGTTTTTGT
TCTTCCGCTTCTGCTCTTCAAGTTACCACAGCTGCTGATTATTCCCAAGGAACTTGGCTG
TTTCCCCTGCCGAGGAGACCCCAACTTTGTTCTTGATGGTGCTGGCATTCTCCTGAGAGC
TGACTCTCATTCGTTTCCTGGCTTATGTGGCGCAAGCTCAGGCTTGGGTTTTAGGGTCAT
TTTGCCATTGTCTGCAATAATTCCATGACAGGCTCGCCCTTAACCTTGGCAGTCTTTATA
TTATTCACCATGGAGCACATGAAAACTTCTGGATCTTTTCTGTGCCACATCGACATCAAG
GGAGACTAGGGATATTATCTTAGCTACTCTGTTATCAAATCATCATAATGCTGCTATTTC
TATTTTCTTGCAACCCATGTTGTTTGAGCATATTACGCTGCAAGGTCCTCTCTTCCCAGC
ATACCAAACAAAAGCAGAGCAGAAGCACATGTTTTTGACCTCTCTTTCAAGTTATTTCTC
CAGTGGCAATTTCCCTTGGGATTTTATTTTAGTCTTGTTGGGCCAGTTCTTGATAATAAA
GTGTTTGTTTTTTTCTCTCTTCCTATCAGTAAGCTAGCCTTTGTGGCTATTTTCAAGTAC
AATATATTCAAAATCCAGTTTTAGAAATCAAAATCTCAACACTGGCATCGGGTGGCCCCA
GCAATCTCTGCACCTGGCTTCATCTTCTGCTTTTAAAAAAAAGAAAAAGAAAAAAACAGA
AAACTGAACATTGATTTTTTTGTTTTTGATATTCCTACTAGACCAATTCTACTTTTTTCC
CCATTGTATTGCTTCTGGCTGAATTAGGCAGAGGAGGTTACATATGAGAAGCAAAGAAGA
AAGAGAAGTGTATTAATATTTTCATTATATAGTAAATAAATTGTAGATGGTTGTATTAAT
ATGTAGATATTAATTATTGATATATTTGCTGTTCTTTTGTAGAGAGCTGCTTTTGCACAT
TTTCCTGAACTCTATGATTTTGCCCTTTCAAATGTGGCAGAAGTAGATACTCGGGAATCC
TTGGTCAAGTTTTTTGGACCTCTTAGGTAAAACAAAATGAAAGGAAAACTGTGTATTCTC
TTTTGGTGTCATGTTTCTTGAATTCTACTTTTCTTTGTTGCTTTTAATCATTTTTGTAAT
ACTTTAAGTAATATTGCTTATTATTTCACTCTTTATTGACATCTAGAACTGGTGCTTCTG
TCTAGTAGTTTGATAACTTTGAGTTACTTAACTATAATTATCCATTTTTTTGGTAAAATT
TATATTTTTTATGACTTACACAATTTTCCTAGATCTTAAATTTTTCTTAGGTTAGAACAC
AGAACTGTTCAATCCCATCAGTCATAAACAACATACAACAGAAACCAATAAAGATTTGTC
ATGTGTGATATTAGAGATGTGAGGAAAATTTTTGCATATTTAAAATTTATAGAATTAGTA
CTATTCTCTGGTACTTAGTATCTGCTAATATACTTTGTGGAAAATAGTAATAATAATAGC
AAACATTTACTATGTGATACACATTCTCTTAAATTGAGTAAATCTCAAAACATTCATGTT
AGTAGTACTTACCATTTTACATATAAGGTAATTGAGGCGTAAACCAGTTAAGTAATTTGC
CTAGGGTTACACAGCAAGTAAATAGCAGAGACAGGATGTAAACCTAGGTAGTCTGATTCC
TGACTCCTAAACACTGTGCTCTCTTATCTCTCCTTAAGTCTTGGGAAAAATTATGTTTAG
TTCATTGACTATTTAAAGTGAAACAAAGGTTGGTTTGGTTGTTCATTTTCATATGAGGAT
GTAAATTATAATAACACATAGATCTATTTCTTTTAAATAACTGCAGAGTTCCATTAAATG
GGACTACTATGCTACTTTTTAATTACTCTTCTATTGATGGATCTTTAAGTTTTAAATTTT
TGGCTATCATAAATAACTCTCTACAATAAGCATTTTTTTACTTTTATGTAAAAATTTTTG
GTACTGATTCCCAGGTGCAAAATGGCAGACTCAAAGGGTCATGTGTTTAAAATTCATTAT
ATGTTGCTAAATTTCCTTTAGCAAAGACTACCAATTTATACTTACCAACAGGGTATAAGG
ATATATTTTTCTCCCTACCAACACTAGGTAAATTAGTCTTTAATTTTTGCCAATCTAAGG
ACATTGTTTACTGTGCATTTCCTTGATTATATTGGGGAAACTGAATATCTTTCTATTTTT
TTCTTGGCTATTTATATTTCTCCTTTAATTTCTTCTTATCATCCTTTGCTATTTTGTATT
CCATTGCTTATTGTCTTACTGTTTTTATTTTTAAGGAACCTTTATATATTCCTTTATGTA
ATCCTTTGTCTAGTTTGTGCTGAATATATTTTCTTTTGGTTTAACTTTGTTTATGGTGTC
TTTTGTCATTACAAATATTTTTAGTTTTTAATCACATCTGTCAATCTTCTTTTTAATAGC
AATGTCAAGTGCTTTATGTAAAGGCATTCTTCACCAAAAATCCATAAAATATTGTCTTAC
ATTTTTAAAACACTTTTATAGATTTGGTTTTTTACATTCAATTTAGCTACATAATCCATC
TGGGGAATTTATTTTTGCCCACAGAACTCCTTTATACTCCTAAAAATTACTGAGGAGCCC
AGAGAACTTTTGTTTATGTGGATTATATTAATTATATTTACTACATTAGAAATAAAAAGT
GGAAGGTTTTAAATATTAATTCATTTCAAAAATCAGTTAAAATCCATTAGATGTTAATAT
ATGTATTGTCACTCCAAAATGAACAAAAAATGCATGATGGTAAGAGTGTCATTGTTTTAC
ATTTTTCTGAATCTCTTTAATGTCTGGTTTAATTTGAAGACAGTAGGATTTGCAGATCTA
TTAATACTTTTGGATTCATTTTGTTGTGAGATGTTTTGGTTGAAGTAAATGAAGAAAATC
TGGCCTTATGCAGAGGAAAGCATATTTTGATAGCTTTATCAAATAATTGGGGATATTCTT
TGATACTATATCAACATTTGACAAGTGGTAGTTTCTTTAAAAATTATTTTCAGAGTGGAA
TCAGAAACCATGTCAAAGAATTCTAAGCAATTAAAATGACTTAGTTTAAGAATTGGAGAG
ATCTGTCTTGCTCCTGGATCAGAGGACTTAGTTAAGATGTGAATCTTCAAGTTGATCTAT
AGATAAAATTTAATTCCAGTCAAAATCGTAGCAGGATATTTTATGGAAATTGATAGACTT
CATCTAAAAATGATATGGAAAGGCGAAGGAACTAGAAATCCCAAACCATTTTGAAACAGA
ATGAAGTTAGAGGATTTCTACTACCTTTTTTCAATGCTTACTATAATATAAAGCTACAGT
GATCAAGATACTATGTTATTGAAAAATGGATAGGCATATAGATCATTGGAATAAAATAGA
GAGTCCAGAAATAGACCATACATATATAGTTAGTTGAGTTTTGACTAATGTGCCAAGGCA
ACTCAATGGAGAAAGGATATTCTTTTCAACAATGGTGCTGGAACAATTTGACATCTACGT
GCAAAGTATAAAGCTTGTCCCGTACCTCGCATCATATATATAAATTAACTCAAAATGAAT
CATAGACCTAAATGTCAAAACTAAAACTTCTAGGAAATATAGGAAAAAAAATGTTTGGGA
TTGTAGTTTGTGCAATGATTTGGATAGACACCAAAACACAATCCGTATTGGGAAAAAATT
GAACTTTATCAAAAGTTAAAAACTTCTCTTTGAAAGACATTGTTAAGAGAATGAAAAGTC
AAGCCACAAACTGGGAGACAATATTGGCTAAACAGATATCTATCTGATGAAGGAATAGTA
TCCAGAAGTCTGGGAACTCAGTCTCATAGTCTCCCCTTATCTGCAGGGAATATATTCCAA
GACCAATGGATGCCTGAAACTGCAGATAGTACCAAACCCTGTATATACTATGTTTTTGTC
TATGTGTAGATACTTCTGATAAAGTTTAACTTATAAATTAGGCACAGTAAGAGATTAATA
ACAATAGTTAATAATACTTTAAAACATTTATAACAGTATACTGTACTAAAAGTTATGTGG
CTAGGTGCAATGGCCCATGCTTGCAAGAAGAAGAGAAAGGCCCATTTGAAGAAGAGTGCA
GATACACTTTGGGGGATTCAAAAAGAGCTGCAATTTTAAAGTCTTCAAATGCCACGCCAC
TTCACTGTCTAGGCTACAACAGGATTTTAGTTGGAGGTTGTGCATATTGTCCTTTTTATC
TGATCTGGGATTAAAGCAGTAATACTAAGATAGCCTGGGAAAAACATCAATGTCCTAAAG
TTAGAAATGAGAATGGTTCGTAAAACCTTACAGCTGTATCCTGATACTGGATGGTCCTTA
CTCTTTGTAGTCCTAAACCAGTTGGTGTAAAATAGTTCCACCATTGCTAAGGCACCACTG
CCAATGCTGCATATGCTGCAGTTGCTCTTCGAACCAGATGTGTGTTTACTGTGTGTTATG
TAACTTATGATTCCTTTACCCAACATGCCTAGTCCAGCTTGACTAGGACTAGAACAGTGA
AAAAAAAAAGCACTTTGGAAGGCTCAGGCAGGAGGATTGCTTGAGGCCAGGAGTTCAATA
CCAGCCTGGGCAACATAGTGAGACCCCCATCTCTACAAAAAAATAGAAAAAATTATCCAA
GCATGGTGGCTCACACCTATAGTCCCAGCTGCTTAGGAGGCTGAGGCAGGAGGATCGCTT
GAGTCCAGAAGCTCAAGGCTGCAATGAGCTATAATCATGCCACTGCACTCCAGCTTGGCC
AGTAGAGCAAGACCCTATCTCTATAAACGGAAATTTATGTGAATGTGATCTCGCTCTTTT
TCTCTTTCAAAATATCTTACTTTACTCACCTATTTTCAGACCATGGGTAACTAAAATTAT
GGAAAGCAAAACTACACATAAGGGAGGGGGGCTACTTTAATAAGAAGACAGTAAAAAAAT
GGCAAAAGATTTGAACAACCACTTCACCAAAGTAGATATTAATAGATAGATGCCAATAGG
CCCATGGAAAAATGCTTAACATCTTAGTCATAGGGGAAATACAAATTTAAATCATAATGA
GATACCATTACATATCTATTAGAATTGTTTAAATAAAACAAAGTAATGACTCTTCACAAG
GTTGTGGAACGACTGAAATTTTCATACATTGCTGATGCGAATTCAAAATGGATAGCCACT
TTGGAAAAATTTTACAGTTTCTTGTAAAGTTAAACATCCACTTATATATGCATGTTGCAT
TCCCCACTTACAGATATACCCAAGAGAGATGAAAACTTATATTCACACAAAAATCTGTAC
AAAAATGTACTAATAGCTTTATTCATAATTGTCAAAGACTAGAATACATAAATATCCTTT
GGCTGATGAATGAATGAACTCACTGCTACATCTTATAATTGAATACTGCTCAGCAATATA
AAGAAATCATCTGCAGATACTGCAGTGTGAGTGAATTAATGCATTATGCTAAGCAAAAGC
AATTGTTGTCAGAAGCCTACCTAATGTATGATTCTATTTATTTTACCTTCTGGAAAAGGC
AAAATTATTGAAATTGAAAACAGATTAGTGGTTGCCAGGGCTGGGATGGAGAGGAGGGTT
TAATTTAAAGTGGCATGAGAGAATGTAGGGGGATGATGAAACTATTTATGTACTAGAAAG
CTGTGGAGCTCACAGTGGCGATTGCAAATTTTCACTTGGGAATGCAAATTTAAATTTACT
GTAGCAACAAATACTGGTGGCTGTTTTTCTTGAAGCTACAGGCTTATTTCATTCACATTT
GAAAAAAAATCTTGCCATTTATTTAAGACCAAATAAGCATAGTTTGTCAGTCATTCTTTG
AAGTAAAAATTGTGTACAAAATATGTACTTCCCATTTTGTCACACAGAATTCTTAAAAAG
TGGATACTCAAGAGCCCAAATTTAATAGCATTAATAATTATTTACTGCTTCATCAAAGAC
ATTCTTAAATAAAACTGGCTTTTTCTTTTTTTAAAAAAAACTGCATGTGTAAGTGAGGAA
TGCTATGACTACTTGTAGTAGAGGTTGGTGCCACTGCCTAGGTCCATGCCAGCAGTTTTA
CACATCATTGCTTTTGCACTGGCAGTGCATACATAAAGGCGTGGGAAAAAAGCCAATGTC
TTAGTATTAATATTTTTAAAATGTTGTCCTAGTGGACCATGAGAGGTTTGCAGAAAACAC
TTTGAGAACCCTACATCAAAGGTTTAATTTTCATTGCTAGTTGTTACTTGCTGTTAGTCT
CATGGCATTGTATTTACTTTTTAAGCTATCTGTGGAAATACTCGTTTCAAAAGTGAAGTA
AAGTTACTGTGAATGAAGTATTCTAAACATTCTTTATTCTGCAGTTCAAACACGCTCCAC
CAGGTGGCATCATACCTCTGCTTGTTGCCAACACTCCCCAACAACGAAGACACAACTTTG
GATAAAGAATTTCTTCTAGAATTGCTGGTAAGTATTAGTGTGCTCTGAATTTTGCATGTG
ATTTTCCCTGCCTTTTAAAAGCATTCATCAAGATAGGGGTTCATATAGGTTTCTTGTTGG
CTAAAGATTATGTAGATAATTTCCATCTGTTTTGGGAATTCTGGTTTTGTCAGAAGTTAT
TTTTTATCATTTGAATTTCTTTTCTCAAGTCTTTTATCTCTTAAAACTGCTTTGTGGCAT
GAATTCATTCTATTGGCAAGCATTTATGAGCAGCTTCTGTGTCAGATACTCTATTTTGGT
GTCAGTGCTACATATGACACATAACAGCTGACACCATTCCTGCCTCTGAGGAGGTCACGG
TTACTTACACACACACACACCACAAATATTTGAATAGACATATTCCTATATATTTATTTT
AAAAGTGATCATTTAAACATAGTATATTGAATATTAAGTCATACATTTATCAGTAGAAAA
CCTTGGGAGTGTTTAGAAATAGTGTAAATTATCACTAAGTGGCTTAAGAATTCTAGGGGA
TTTCTCAGTCACTTTTGGAAATTACTTTTTTTAAAAAGTGATTTTGTAAAGCATTTTTGT
ATTTTTAAATTAAATTAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATCTTCTTTCATAATTCACATTGCTGATTCTCTTCTTCATAAAAT
TTAATTATCTGTTCTCACAGAGATAAAATTTTGGCTAACACCTATCCCTATGAAATGCAC
TTTAGAATGATACGGCAAATCCAAACTGAATATTTCATCATTCAACTTTAGCATGTTATG
TTACTGACAATGCTGTGTTACATTTGCATGGAATATAGTTAAAAATACTTATAACTTGTT
CCAAAGTGTCACTTAAATTGGTAGCTTTAGCACAGAGATTTTGCTGATGCAAGATAAAAT
GAAAAGAAATGAGAGCATCTAGATCTCTTAATACTTTTTTTATCTGTGCAATAAACCCTT
CATGTTTTCTTGTCATGGAAGGTGTACCATGTATACATACACTCACTAAATTTACTGAAT
TCAGTCTAGCTTCACAACATTTATCTTGAAAGTTGATAACTATTCCCATATTCTGTTCTC
AAGAGTGCCCAAAGAGAGTAACTTTTCATAGCAAAGAAAATATGATGACCTGAATGAAGT
ATAAAACTTGTACTGAGTCAGTAGTATCAGTTAATTCATCCAAAGCAATTGAATAATATA
TATATTTTCCTTTTGAAGTATTGTATGAAGTTGAAGTATTGCATTGCATGTTCTGTTAGG
TTGAAGCCTAGTTCATGCTGCCCATCAGTTATGTTTCTCCTTTGAAAGAGGCAGTTGTTT
GTGCTTTGAAACATTATCAGGGTCTAAGCATCCTACAACTTCGACAATGCATTCCTTCAC
AATTTCTGCATCACAGAATGGCTTCCCTTTTTGAACTCTTAGTAAGTTGCTTCGGTGGCA
TTATTTCCAGGTCTTTTTGCTGCTTAAAAGAATTCTTTGTTTTTGCTTTTCATCTTTTAA
CTTCTGCAATACAACCTTTTGCACCTCTCCCTCTAATTAAAAATATTTGTCATCCTTAGG
AGTGTTATAATGCTGATGAGCATTGAATTTCTTTAATGTTGATATTGCAGTGTCACAAGG
CAAGAAAATCATCTTATCGTTAGCAGGAACAGTAGCTCAATTCCCAATCCTCATTTAAAA
AATCTATTTGCTTTCTTCAGTGTTCTCTTGGTCTTCATTGACATCATGGGCTGTTAAGCA
GACAGATTGAAATACTGTCGAGCTGTGCACTATTCACAAGTTTTACTTCAAACAGAAAAC
AGTGCACGGCTTTCAAAAGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNACATCCACACCACACACCACACATCTCACACCACATACACACCACACATCACACACC
ACATACACACCACATATCACACATCACACACACACCACACACCACACCACACCACACACA
ACATACACACCACACATCACACACATACACCCCACCACACCCCACATACACCACACACTA
CATCACACACCGTACACACCACACACACACACCCCAGGAGACATCTGTCCTGGTGGGTGA
GCCAGAGAGAAGCTTCTGGAAGAACGGACCTCGAGACAGAGGGGCCTGAGGCCGTGCCCT
GCTCTGAGCCGGGTTCCCAGGGAACGAAGGAGCTCCGGGGCCTTCTCCGCACCCCTGGCG
CTGCCACCCTGAACTCACCTGTGTGTCCCAGGAGCGCTTTGCACTCCTCCTTGCTGGCTC
AACCCCTCCTGCCCCCACACTGGCAGCTCTCCGTCCACTCCGCCACCTGTGCATGCGAGC
GTGAGCTCAAGGCTCTCCTGCCGGCACCTTCTGTGGGCCAGGCCGTGCCAAGGACCCCTG
AGGGGATCGCGCTCAGCTGTCCTCTGCAGAAGCCCTCCAGGTGGGGGGAGACAGGTGTGC
CTGGTTCTGCAGGTGGGCTGTGGGGGAGGGGTGGCCAACATCACCCTAGGGCAGGTGATA
TTAAAGCTTCATTCCAGAGGGTCAGTTGGGATCCATCAAAAAATCTTTCCTGGCTGGGCA
TGGTGGCTCACGCCTATAATCTTAGCACTCTGGGAGGCCGAGGTGGGCGGATTGCTCGAG
GTCAGGAGTTCGAAACCAGCCTGATAAAGAGCGAGACCCCGTCTCTACTAAAAATAGAAA
GAAATTAATTGACCACCTAAAAATATATATACAAAAAATTAGCCGGGCATGGTGGCACAT
GCCTATAGTCCCAGCTACTCAGGAGGCTGAGGCAGCAGAATCACTTGAGCCGAGGAGTTT
GAGGTTGCTGTGAGAGAGGCTGATGCCACGGCACTCACTCTAGTCTGGGCAACAAAGTGA
GACTGTCTCAAAAAAAAACAACAAACCTGGTTTTATCTGTAGAGTTTCCCACAGTCTTGA
TTTTTCCGATTGAATATGCATGGCATGGTGCAGCAAATTCCTCTGGCCTTTATTTTTCTT
GCAAATTGGCACCTGGTTAAAGAAGCTTGATCAAGCTAAGGTTCTCCTTTGGCAAGATTC
TTTGTGGTGGTTTATTCTTTCATCAGGAAGCACATACTGTCTACTTGTCTTTCTTGCCAT
TGATACTTAACACTTAGATTTTTTAATTCAGTGAAGGCTGCAAATTGGTGACATTTTAAT
TTTTTTTTTTAAATAAAAATGTGCTATCAAAAGAGATACCTTCCCTCAGCATCTGGCCTG
AAAGAAATTGAGTCAAATTATAAGTCAGGGTTTACTGACATAAGTGATGTGAAATTTATA
CACATCATTGTTTATTGCCTTAAGTTTATTATTGCTTTGATAGTATGGATAAAGGTGATG
AAAATATGATTTGTCAGTAAAATGTGTTTGGGGGTTCTTTTTCTTTTAACTTTTTTGATA
TTGCTACTTAGTGCTTGGTCACTTATTGTCCAAGAGAAATAGTTTGAAGTGAGGGTAATA
AAACGAATAGTGTTTGTTAATAAATAATAAAAGTCAGAGAAGGGGAAATCTGGAATAAAA
TAACAAGCAATAAGCAATACTTTGTCCTTAAGTTCAACTAAAAGGCAAGTTCAGAGCACA
TTAGTGATCATTGGAAATCAGTTTATGTAATACAACATACTAATTTTATTTTCATGCTAA
ATTTTGACATGGGCTAAGTTTATGGTAGCTTTATTCACTTCAAGATTTGCCAGATATAAA
TTAGGTGGTAAAGGAAGAGTTTTAAACTACTTGAGACTGCATTATTAGTATTAAGCATCT
TTAAATTCTTTTAAGAAGTACTGTTGGCATATGAATCACCGATATGCTAATTACATGTAT
TAATAAGACTTATTCTTCATCTCCATTTCTTTTTTGTTTGTTTGTTTTTGAGACAGAGTC
TTACTCTGTTGCCCAGGCTAGAGTGAATGCCGTGGCGTCAGCCTAGCTCACAGTAACCTC
AAACTCCTGGGCTCAAGCAATCCTACTGCCTCAGCCTCCCGAGTAGCTGGGACTACAAGC
ATGCGCCACCATGCCCAGTTAATTTTTTCTATATATTTTTAGTTGTCCATCTAATTTCTA
TTTTTATAGTAGAGATGGGGTCTTGCTCTTACTCAGGTTGGTCTAGAACTCCAGAGCTCA
AGTGATCCACCCACCTGGGCTTCCCAGAGTGCTAGGATTACAGGGGCAAGCTACCACGCT
CTGCCCATCCCCATTGCCTTTTTTTTTTTTTTTTTTTTGCGTGTGTTTTTTTTTTTTGAG
ACAGAGTCTCACTTTGTTGCCCAGGCTAGAGTGAGTGCCGTGGCATCAGCCTAGCTCACA
GCAACCTCAAACTCCTGAGCTCAAGCAATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGTA
CTACAGGCATGCACCACCATGCCCGGCTAATTTTTTCTATATATATTAGTTGGCCAATTA
ATTTCTTTCTATTTATAATAGAGACGGGTCTCGCTCTTGCTCAGGCTGGTTTTGAACTCC
TGACCTCGAGCAATCCGCCCGCCTCGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCC
ACCGCGCCCAGCTCCCATTTCTTAATAGACAATATTTCTTAATCTGGTTAAAATATCTGT
GTGAAAATAAAGATAAGGCATTATCACATATGCTGCATTTCAGATGTCATTAGATTCTTA
TCAAATTTTTGGCACCATGTTAAATATATGGCACAAATGTCTGATTAAAAGATTACTTCA
AATGTGGCTATTATTTTCCTTTTCAGGTTGTCTTGCTCTTCCCAAGTTGAATCTACAGTT
TTTGACTCTTCATGACTACCTGTTAAGGAACTTTAATCTCTTCCGCTTAGAATCAACTTA
TGAAATTAGGCAGGACATCGAAGATAGTGTCAGCAGAATGAAGCCATGGTTAGTAAATTG
GTTCCACTTATAATGGAGATATGCAAAAACAGTGACTAATACGTGTCAGAAACCTCATAA
GTATATTTAAAAATAATATACCTGGTACAAAAATGCCCTCCAAAATAGGGGATATTTACT
CTTTGAGAAATTTTTCACTGTGACTTCAAATATATCGAAAGTGCTAAAATAGAAAGTGTA
TCTGTGTCCTTGGGTATGGGGGCTGAGGGATGGTGAGGGGGGCGGGGGGAGAAGGCATCA
TGCTCTGGGAGAGAAGGGAGAGATGTAGAGGAGAGTAGGCTGGACATTAGTAAGCAAGTG
AATAGGGAAGGGCAGGAGTTGGCCATCAGGCCTGTGCTAGGGCAGGATAGTTTAAGTCCC
GGTGGAAGCAGATGGTAAAGGGGTATTCCACTAACCTAGCTGCTCGTGTGACTGTTGCCA
GTAGTCACAGTCAGCCTCTCTAAGGGAATTGGCAGGGGGTGAGGGCTGTTGCTGACACTG
CATGAAGTGGTACATTGAAAAGTCTTCTCTGGCCCTCCATCCACAGATTCCCTCAAAGAG
ACCAATAGGTCTAGTTATTTGAGGAATGTTTGTGTATAAACTCAACTTGCTACTTCCAAG
CTCATGTCTGGAATTCCTTTAGCCAAGAAAAGTCTGTCCTAATTATTGTAGCAGCTCTGT
TACAAGATTTGCAAAAGTTAATTTTGGTTTTTTAGACTTGACTGACTTTGGGTAAATGCT
TTTACTTCACTATTTCATTCTAAGTATGAAATTGAAGGATATGTTTCATATCACAAGTAA
TTATAAATGAGTAAAATTCTGTGAAATGAGTTTTTATTACATTATAGTCACACCATGTTG
ACATATACAATTATACCATATATGAAAAGCTTAATAATTTTTGTTGTTGTTTTTTGAGAC
CGAGTCTTGCTCTGTTGTCCCGACTAGAATGCAGTGGCGTGGTCATAGCTCACAGCAACC
TCAAACTCCTGGGCTCAAGTGATCTTCCTGCCTCAGCCCCCTGAGTAACTAAGACTATAG
GCATGCGCCACCACATCTGGAAAATTAGACATTTTTCCATTTTTTTGTAGAGGCAGGTCT
TGCCCTTGCTCAAGTTGGTCTCGAACTCCTGACCTCAGGTGATCCTCCCACCTCAGCCTC
CCAGAGTGCTAGGATTCTTAATAGCTTTTGAATGTGAACTGATTCAGGTATTTTTCAGGC
TTCTCTCCTTACTAATTATAGAGAGCTACCATGGACATTGTGATTATGATCTATTTTTTT
CACGTCTATGTTTTATATGCAGTTCTATTTTTTTTAATTATTATGTGAAAAGTTATTCTG
GGTGAGACTATAAAATACTACACAAAGAATTTTTGACTTAATAATAAGTTGAGTCAGTAG
GCAGACGAGCACTGTGAAATTTGTATGCCCACTGGTTGCTCGTCCCTGCCCACAGCTTTG
CTGAAATTACTGCCCATTGTTTGGACCCTGGGGAGTGCTTGATCCGAAAACTTCCTTACA
ATTTATGGTTACCTTGAGTTTATATGCTCAGATTCTGGGCCTAATTTTGGCCATTTTGCA
AGCTAGGGCTTTTATTAAATAGCAGTTCAACAAATAGAGTTCTCTTATTTTTTATTTAAA
TGCCAAGTACCACACAATTACTTAGAGTAATTTGGTCTCTTAGTAGAAGAAATTTTTTTT
AATTACATCATTTTCTGGTAGGGGAAGAAAATACCACTTTGGGGAGTTAATTTAGTCACA
TTTGCAATAATAAATTTTTCTGAATTTACATTCCTAATGTCCATAATTGAAAACTGTTGA
AAATGATGAGATCTTAAAAGGGACCTGGCTTGCTTCTCTTCCATGTATCCTGAAGGTGGA
AATGTGGCAGAGGCATTTTTACTCATTACATGGTTCTAATGATTATATTTTCAGTTGGCT
AAAACCACCAAGCAGCAGTAAATAATAAAGGATGTGCTTATAAGGGGCAGAAGTCTATAC
TTTGTAATACTTCACCTTTCAAGTAGACTTTATAAGAAGAAAAAGGAGTAAGGGGAGTAG
ATAAGTGGTTGCCTCAGAGTGGGAACAGGGATGGACTGCAGTTGGACAAGAGGGATTTTT
TTTTAGGGATGATAGAGTTGTTCTGCAATTGGATTGTGGGGATGGATGCACAACTCTGTT
AACTGTATGTTTACAATGAATGAATTTCGTGGTATGTAAACTACTATAATAAAGCTGTAA
AAAATGGAAGAGATAATAGAAAGTTATTTCACAAGGGTTTAGATACAAGATAATGCCTTT
TAGAAATTGTCCTAGTACTAACCAAGTCACTGGATTGCAGAGCTTTATTTTTAATTAATT
TCTGTCTTTGATGTCCTATAATTTTTTGTCATGACACAAAACCTTTACATAGGATATAGT
TTATCTTTGTAAGCATGTCATTTTTTGCCAGTGCTTTCCAATTTTGGAGTGATGGTATAG
TTTTTATGTTGCAGATTTCCCAAATACACTATTTAATGTAAAAACTAAAGCACTAGAGTA
AAATAAGAAGAAAGAATGGATATTTGAATGTTAATGGTTCTAGTTATTACAACTGGCTTG
ATTATTTTTTCCTCCAATTCATTGCAGCATCATTTAAATGATTTAAATATTATACTGTAA
AGGAGGCATTTGCATAGAAATTATTATTTGTTTACTTGTTTTTAATTTTTAAAATTATGC
CTTACTCTAAAATGTATTTGAAGCTGCTTATAGAAATACTTAAAATACAGAAGATAAAAT
ATTAATTGAGACCATCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTA
CAAAGCTATATAATAAAAACAGTGTGGTACTGGCATAAAAACAGACACATAGACATGGAA
GGAAATAGAAAGCTCTGAAATAAACCCACACATGTCTGATCAACTAATCTTTGATGCATG
TACCAAGAATACACAAAGGAGAAAGGAGAGTCACTTCAATAAATGGTGTTGGAAAAACTG
GATATCCACATGCAAAAAAGGGAAATTGGATCTCTTACACCTTACACAAAAATAAACTGC
AAATAGATTAAAGATTTAACCTAAGATCTGAACCTATGAAACTCCTAGAAGAAAGCATAG
GAGAAAAACTCTGTGAAATTGGTCTTGGCAGTGATTTTTTGGATATGACACCAAAAGCAT
AGGCAACAAAAGCAAAAATAAACAAGTAAGGACTACATCAAACTAAAAAGCTTCTGCACA
GCAAATGAAACAATCAACAAAATGAAAAGGCAACCGAATGGAATGGGAGAAAATATTTGC
AAACCATGCATCTGATAAGGATACTTTTTTATATGTGTGTGTATGTGTATATATATATAT
ATGTATGTGTATATATGTACATGTGTGTATATATATCTTCAAAATGAAACTGAATAATAT
AACCCAATAGCAAAAAACCAAATAGCCCAATTACAAATGGGGAAAGGACCTTGAAAAACA
TTTTTTCAAAGAAGACATATAAGTGACAAATAGGTAAATGAAAAGGAATTCAACATTATT
AATCATTGGGGAATATAAATCCAAGCCAGGAATGGGTGTTATCAAAAAGTCAGAAGATAA
CAATGTTGGCAAGGATATGGAGAAAAGGGAATCCTGTTGGTGGGAATGTAAATTAGTACT
GCCATTATGGAAAATAGTATGGAGGTTCCTCAAAAAATTAAGAATAGAATTGCCATATGA
TCCAGCAATCCCACTTCTGAGTATTTATTTATCCAAAGGAAGTAAAATCAGTGTCCCAAA
GAGATACCTGTCTGCTCCTGTTCATTGCAGCAGCATTCACAATAACCAAGATATGGAAAC
AAGTGAACTGTCCATCGAGGGATAAATGGGATAGTGAAAATGTGATGTATCTATATACAC
ACAATGGAACATTATTCAGCCCTTAAAATGAAGGAAATCCTGCTCTTTTTGACAATATGG
GTAAACCTGGAGTATGTTATTCTAAATGAAATAAGCCTGATACAGAAAGATAAATACTGA
CGATCTCACTTTACATATGGAATCTAAAAACGTTGAACTTAGAAACAGAGTAGAAGGGTA
TTATCAGGGATTGAGGGTTGGAGAAATGGGGAGATGTTGGAAGGGGTACAGACTTTTCAT
TTATAAGGTGCATAAGTTCTGGATACCTAATGCAAAGTATAGTAACTATAGTTAATGTGT
TATGTACTTGAAATTTGTCAGGACAGTAGATATTAAGTATTTTCACCACACACAAAAAAA
TAGTAACTGTGTGATGATGGATATGTTAATTAGGTTGATTCTGGTAATGATTTCACAATG
TATGAATATCTTACTAGTTTTACTTGTTTAAAAGTTGGAGGAAAGTTATTTTTTGTTTGA
CTAATCATCTGTATCTTTGGTTTTCAGGCAATCTGAATATGGCGGTGTAGTGTATTGGAG
GTTGGGCACGAATGGCCCAGCCCATTGTGGCATTACTGTAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTATAG
AATGGAAAATTTCTTTGCCTTTTTTCCTTTTGGCTTCTTAAGTAATATTTTTTAACTGTT
TCACATACTAAATTAACACAGGATTTTGTATAAAATATGTGTAGGGTACTTATTATGCAG
TTTTGGAAATAGATAATGTAATATGGTTTCAAAATTTCTGTTACATATTGGAAAGGATAG
GATCTTTTGAAATCATCTTTATTCAAAGCTTTGCCTGCTTTTTCCATTTTAAGTTTTACT
GTTTTGATTCATCATAGCAGTAGTTCTCGATTGGGCACAATAGTGTCCTGCATTTGGAAA
TGCATGGGTGATATTTAGGTTGTCAGATGACTGGCATAGGGCTGGGTGGTGGCAAGCTAT
TGGCATTTGGTGTATTAAGGCCAGGAATGCTAAGCATCTAAACAGAACTGTCTTATAGAA
GGAATTGCCCTGCCTAAGATGCCAGCTTTACCCCATTTGAAAACACTGCTTTCCAGCATT
AGTCAGCTCTTTGATTCTTATGCTTGCACTGATTATCTCTTTGAAATTTTTTCTTTTATT
GTCCTGACTGCCTTTATATTAGGTTACTAAATATGAAATGTCTGATTTTTGAATCAGAAG
TGTAGTTTATTATATCTTAAACAAGAAGCAGTACAATTAATCAAAGTATGGGCCTAAACT
ATCAACACAGTTTTGCTATCTTAAGGGTAGCTTATTTATGCCAGCAGCAAAGAAGCCTGG
AGAGCAAGTGGCAATGAAATCACAAAAGGCATTTTTCACAGCTAGTTGAAACCTGAATAT
TTTTCTTTGCAAAAAGTCATCCAAAGCCTGGAAGAAGTGGTAATCAGTCGGTGCAAGGTC
TGGTGAATACAGTGGATGACAGAGTTTCCGAGTCCAGCCTCTATAGTTTGAACAGCCTTG
TTTGTGCAACATGGTTGAGCATTGTCTTACAAGAGGATTGGCCTGTCTCTATTGACTATT
CTCAGTTGCTTTATTGCAAGTATCCTCATCATTTCATCCAGTTGGTTGCAGCAGACATCT
GCTATCATTGATCGATTCAGGTTTCATAAAGCAGTAGTGGATAATATCAGGCTGGACCAC
CAAACACACCATTAGATTTTTTAGGTTTTTTTCTTGAGACAAGAGTCTCACTCTGTTGTC
TGGGCTAGAGTGCCATGGCATCAGCCTAGTTCACAGCAACCTCTAACTCCTGGGCTCAAG
CAATCCTTCTGCTTCAGTCTACCAAGCAGCCAGGGGACTATAGGCATGCGCCACCATGCC
CAGCTAATTTTTTTCCATATATTTTTAGTTGTCCAGCTAATTTCTTTCTATATTTTTAGT
AGAGATGGGATCTTGCACTTGCTAAGGCTGGTCTCGAACTCCTGAGCTCAAACGATCCAC
CTGCCTTGGCCTCCCAGAGTGCTAGGATTACAGGTGTGAGCCACTGCACCTGGCCAGATC
ATTAGGTTTTTTTGATGAATATTCAGTTTTGGACTGTGTTTTGGCACTTCATCTTTATCC
AACCATTGTGCCAAATGCTTGAGATTGTTAAGAAGAATCCATTTTTCATCACATGTAACA
ATATAATGTAGAAATAGTTTGCCTTTATGTAGTGACAGCAAAGAAAGGTAAGCTTCAAGA
TGATTTCTCTTCCAACGCTCATTTAATTCATGTGGAATCCATCTATTAATATACAGCTTC
TTTACCTTTCCTATTTGTTTCAAATGGCCCAATATTGTTGGAATAGTAACATCAAACCTT
GCTGCTAGTTCACAGGTAGGTTGAGATGGATTCACTTCCACTACAACTTTCAGCTCATCA
TTATCCACCTTGATCTCAGGTTGCCCATGTGTCTCATTTTCAAGATTAACATCACCAGGA
TAGAACTTCTCAAACCACTGACATACTGTGCATTCATTAGCCATATTCTTCCCAGACACT
TCATTGATATTTCAAGCTGTTTGTGCTCCATTGGTTCCACAATGAAACTCATATTTGAAA
ATAACATGAATTTTTGACTTACCTATGGTTTTACAAAAACTACTCTAAAAAAAATTTGAA
AGATAATCACAAGCCAAACTGTGTGTTTGAAAGACTAAGGATGTACCTTTACAATAAAAA
TAAAACAAGAAGTGTCAAAGTGAAATGTCAGTTTTATCAGCTGTCAAACTTAGTACTTAA
GGAAATCAGACATTTCATACTTAATAGCATAGTAATATTTGTTATTAAATTATAACCACA
TGCATGTCTAGTGTTTATTTTATGATTTGGTTGCTAAATTTCCTTCGAAACTTGAATCAG
TTTCTCCCATCTGTGATTTTGAGATTGTGCCATTGCCAAACTGCTGATGATTAAGCTATT
CATCTCTGGAGTAAAAGAAAATAGGTAGAAAGGAATGGAAGAGGGGTTGGATAAACATAA
GACCACATAAAGTGACCAAAGTTGGAGGTCTAAGACCCCCAAAAGAGGAGAGAGAAGGCC
AAGGGGAAGGAAACGCTCTGGGCTTTAGTATCCCATATTTCTGTATATGTGAAATTTTCT
TTCATGCTGGTGATACTAGGTATGGAATGTGGAAGGGTGAGAAGAGTGATCAACCTCTCT
CAAATTAAGGAATGGGAAAACTGTGCCTGAAATCCTAAAATACATATATTTCTTTAATCA
GAAAATATTTGTTGAGTACTTACTATATATAAGGAAGTAGTAGGAGCTGTAAGTAATGGA
CAAAAGGAAAGATAAGTTCTTTGATTTCTGAGAACTCCTATTTTAGTTGAGGGCAAGTAC
AAATATTTGCAGTTCATAGCATTACATCATAAACATCACATGACTGTGTGGGAAGAAATA
ATAAGAATTTAGAAAAAGAAAATACTTTCAGCTTCTTGAAATTTGAAATGGACGAGTAGA
GGGCATTCTAGTCAGGAGAGAGAATGGTTAGAGTTAAGTCTGGACGGTTTACCCATCAGT
TGTAGAAAAGAAATACTGTTGACTTACTTTGATATTGGAAAAATATATATTTAACAAACT
TGTTTAAAATGTCTAGGACCTGAACCCAGACCCAATCTTAGAGGAGAGTCAAGGACATTT
AGAGTGTTTTTGGATCCAAACCAGTATCAACAAGATATGACCAATACCATACAAAATGGA
GCAGAAGATGTGTATGATACTTTCAATATAATAATGCGGAGAAAACCAAAGGAAAATAAC
TTCAAGGTAATTTGGGGGCTATGTAATTAAAAGTACTATGTGGTGACTTAAGTAACTTTT
AAAACATAAATACATAGATGTTGGGTAAGAAAAAGATTTGTTAAAAAAAGTCACTGCTTT
TATTTTGATTCTGAATAATCTTCTTAGATTCTTCACATATAAATTAAATAAAAATTTAAG
GAAATTCATTTGCTAAATCCTTTTTGTCTTTTGGGGACTTAAAAAACTTAAATAAATCCA
GGTGTTATTCTAAAGGTCAGCCTCCTTCTTTCCTTTTTGTATATTAGGTACTCAGGTTAT
GCCCTAGTATAAGGTGAAGAAAACTTGTTTACTTATTTATTGGGACTCCTTTGTTAAAAG
TAAATGTACTTTCATTTCACTTTAAGTGTACAGTTGTGAAATCTCAAGGCTCTGAATCAC
TGTGTGATCTAATATATTTATACTTTACTCATAAGTGGAAAAGGGAGATTTACGGACTAT
AGAGTTCTACTTTTATAATAACTGTGAGGAGAACAGTTTTAGTAAAGGACAGTTTTCTAA
AACTATTATTTGAGACTATATTATAAAACTTAAACATTGAGCAATTCTAGCATTTGATAA
CATCTAGTTTTTGCAGGAAGAATGCCAGAATGCCTTCTTTTCTCTGTCCTCCAAAGTGCA
AGTCTTCTTACACATTCCTATCACTGTATTACCTTTTTCCCCCCATCCTTGTAATGTACA
AAAGAAAACTCTTCAAAAGAACTTGTTCTTCATCTCCCCCTGTTGTTGAACACAAAAACA
AAGGAGATACCCTTGATTTCTTTTGTCTCACACTCTACATCCTGTGCATCAATAAGTCTA
ATTAGGTCACCACTTCCACTGATGCCATGTCCAAGACACCTCACATCCCTGCTTCCATTC
TTGTCTGCTCCTCCCCTTACACTATCTCCAAATAACTTCAATATTCTTTAATGGTTTCCC
ATCACATTAGAAAGTTCTTATCATAATCTAAGAGGCCATGCCATTATCTGTCATCTGGCT
ACCTCTCTAGCATCATTTTCTAAGATATTTATTTTCTCTATGCCAGCCACATTGACCTTT
TTGCTATTCTTTAATAAGCCAAAACATTGCAGGTGGTGTTCCTTCTACCTAGACATGGTA
TTTAAATACTCCCAAGTATTTAAATGGTTCATTCCCTCACCTGACATGGGCAACTCATTT
TAAACGTCACCTCGTATGAGAAGCTTTCCCTGGCAACTTTACCTAAAGTAGCCTCTTCCC
TCATCATTCTCTACCCTACTATCTTTATATCTTTATCGAGCTACTAGCTATATGATTATG
TATTTGTTATTTATCTGAATTCCTTATTGGAATGCAAGTCTATGAGGACAGGGTCTTTGT
TTTGTCTGTCATCATAACCCTAACACTTAGAACTGTGCCTGGTATATAATATGGCCTTAA
TAAATATTTACTCAGGGAATGAAGATGGGGAAGTCTCCAAGAGTTTCCAAGTTTTACAGT
ACCTAAGACTATCTCACATTTGGTCAGTTTTCAGCCAATAAATCTCAGTCACTTCACTAA
AAACTAAAAAGAAAAAAATTCCTTTCTTATGTTCATTTACTTGAGCATTTTATTTAGTGC
CTACTGTGTGGCTAATATTTTGCTAAGACGAAGCTTATAAAGATGAACCAGTCACAGTTT
ATATCTTTAGGGAGCTTAGACTACTAATAAGGGAAATTAGAAATAGAAACAAATGACTAC
CATGAACTGGTTAGAAGGTGCCAAAAGCCATAGGATGCAGGTAACAGTGTCATGGTAGTT
GAAAGGGGGCAATCAGGCTCTAATCTAGGAAAGAGATGGAATGATTAACCTGCCTGTGTT
TGGGAAAGGAAGAATGATCTTTTGGTATTATTGGTGTTTCATTATGTACCTGGGCAGTAG
TCCTCTTGTATTGCCCTGTCTTGTCCAGTTTGTACAGCCCATCCTAATCTGGATACTTTA
TTTTCTGCCTGGACAGTTGCAATAGCCTCCTCTTTCTCTACCCTAGTCTCCTCATAGTCA
GCCAGCTGTTTTTCATACATTTCCTCCTACTTTATAATACTTACCATTTTATTCTGCTTC
TCAAAAACATTTCTGTGACTTTCCATTCATGATGAAATAAATCAAAACTCCTTTACAGAT
CCTTTCCTGGAGCCAAATTAAACTGCCACTTTCCTCCATGAAACCTTTCCTAAAGATAAA
AGTCTCCCCCTGCATTCATCTCATCTACTGAGAGCTGTGTTATCATTGTATTTTGTAATA
TTCTTCACTGTTTGCCACATTCTGCTGCTTTGTATCATGGTTAAGTACTTATTTTATCTT
CCTACTAGAATTACAATTTCCTTAAAGGGTGGAGCCTTCATCTTATTCATCATTGTTAAG
TGAACATACTCATTTATCTACCCATCCATTCACACATTCCTTATTTAAACTATTCTAGAC
ACCTGTTCTTATAGAAATTTTAGTGGGGATTAAACAAATGATAAATACGTAACCAAGTTT
GAACAAGAGAATTTCAGGCAATGATAAGTACAAGAATATAAAACAAGTCATTGTGATTAA
GGATATAATTAACATAATATCCTATTATTGCATGATTAAAAATGGTTAGTTGTGTTATTT
TATTCTTTGAAATTAATAGCCTAGCCTCCTAATTTCTGTGAAGGATAGATTACTTTGTTT
TTGTTTGTTTGTTTGTTTGTTTTTGATTTTTTTTATTTTAGCATATTATGAGGGTACAAG
TGTTGTTGCCCATGCCTCCCTTCCCCCTCGAGTAAGAGCTTCAAGTGTGTCCATGCCCCA
AATGTTGCACGTTGTACTTGTTGTGGTTATATATACCCATCCCCTCCACCACCCTCCCGA
CACCCGATAAATGTTACTCCTATATGTCCATTTAGGTGTTGAAGGTCACTTTGCCAAAAT
GACTTTTGGGAAGTCTAAGAATTTGCCTTGGCTTTTCGATAATTACTTTTGACCATGTAT
GTGTTAACTACTATAATGACTTTTTATTATAGTCCTGATTCTTTATTCTGAAATTTTATT
TGACATTTCCTTCATCTTTATCATTTTGTTCACTTTTTAAATTTTTTCTCACAATACTAA
CTTTATTATTTCTAAACTGTGATATATTTCATAGTCGAGGTATACATTAATGTGCTTCTG
GTCGTGTGTGATTTTAGCATTGAAAAGCTATGGATTATAAAGAGGGAAAAACTCCAGGAA
TTTCTAAGAGGAAGCATTTTCTTTAAGGGTTTGTTCTATAATATTTTATTGCTCTTGATG
AGAGTCTGATATTCATCCTACTCAATAGGAGTCAGGTGGTAAATGTCATTCTGTCTAAAT
GAACTCTTAAAGGATAAACTGTTCTTACTAAGTTTGGTCTTTTGTTTAACTCAGTGTATG
GTATCAGCTGAAAATATAGCTGTTGATTCAGTCTAGCCAAGCACCTGTCAGCAGAAAATA
GCTTCTTGCCCTGAAACACTCAGGAATTCTGGATTAGTGCAGCCAGCTTTGCGTTCCAGT
GAAGTGCAAATGTTTGAGATGTCTTATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCC
AGCTCTACAGATACCCCCTTTCAGGTAAAGTCAGAACCGAGTTTACTCCTTTCAAGCATT
CTGTAGTCCATCAGAGTTAGGCCATCAGGACTGTTAGCGAAAGTGAGTTTTGAGTATTAT
ATGTGGATTTTGTTTTGGTACTCCCTACCTTTGCTGTATAATCACTGGGATAAGTTTGTT
ATTTTTGAATCTAAGACCACAATAAAAGTAGCTTCATACCTTCTAAGAGATCAGTAAATA
CTTATTATCTGAAGAGAACTATATAAATATATTTATAGAATTTGACTGAAGAAATACCTA
TGCATAGTCTGGCATATTTCCTAAGTAATACAGCAATGTGATGTTGAACTGTCTTTTGTT
TTTAGAAACAAAATTTTTTTTTCTTTTAACCTTGCTTGTTTTCACAAATTTTAAATATTC
ACAATATATATTTAAATGAAGTAAGCTTTTAAAATTTGAGTGGAAATAGAACAAAGTAGC
TGAAGCAATCGATTGCTGTTTCCTGAATTCCTTCCTATGGATTAGAGGTAAAACAATCAG
TATACCTATGGATGATAGCCCAGGACTTGCTTTTGTTGCTGGAAATTAGAACACACAAGG
CCAGGTGCAATGGCTCACACCTGTAGTCCTAGCACTCTGGGAGACCAAGACAGGAGAATT
GCTTGAGCTCAGGAGTTGGAGACCAGCCTAAGCAAGAGCAAGACCCCATCTCTCCTAAAA
ATAGAAAAAATTAGCTGAGTGTGGTGGTGTGTGCCTCTCTCCCAGCTACTCAGGAGGCTG
AGGCCAGGAGGGTTGCTTGAGCCCAGGAGATTGGGATTGCTGTGAGCTAGGCTGACACCA
TGGCACTCTAGCTTGGGCAACAGAACAAGACTGTCTCAAAAAAACCAAAAACATATCCTT
TATAACATTTAAACCCAGGCTTCCTCCATATTTTCCTAATACTATTATGGCAAAATCATT
TTTCTAATTCCTTCATTTTGGAATCTTAGTATTAGTTTTGAATATTTTTACTCCCATATC
TCATAGATTCTGCCTTAAGTATAGTTTTTCATGTGCCATTCCTACTGCTGCCACCTCTCT
GGGCCATCACCAGTCTTAATAAAGACTGACAATGCCTTTCCTCGCCCTTTTTCCTCACTT
GAATCCACTACACACCCTGTTATTAGAGCCACTTACTCCCTAGCTAAAAAGCTGATTGCT
CCTGTTGCTTACCAGTGTGAGGGCTCACCTCTTAGCCTCTTATATTCTTAGCATTTTTTG
GTATTATATATCCTTTTATAATGTGAAGGAAGACTGGAAAAAGTACACATAGAGAATTAA
TATTTTGTTTAATTTTAGGGAGTTCATTGGTTTCCCTCAAGTATCTATGGGGAGTCACCT
AACTCCAGACTAAGAATCTTTGCCTTAAAGCTTGATATTCCAGAGACGTCATAACAGGGT
TTCTATTGTGCTCCACACTCAAGCAATATTAGGCTGCTTGTACTTGGTCTCTGCTATTGC
TTCTTTTTTCCAGTAATGTCTTTTCTTCCCATCTTTGAATGTCTGACTTCTTTAAGACTC
ATCTTAGATGCCACCTGTCTCATGAAGTCTTTTCTGATTAAATGAAGGACCATGAGTAAA
GCACTTTACAATGCATGTGACATAAGTATTTAATGTTTCTTTAAATTCTCCCTTAATTGA
ATGGCTTTTTCCAATCAGAACACCCTTAACACCCATTTTAAGTGCTTATAAATTTGCTTT
TTTCAGAGTTTATGTGTAGATAGGGAGTTCCTTTAGGCCAGAAATAATTTCTTACTCATC
TGGTTATCCTGCATTCAGTGTCGTGCACAAGATAGTTAGTAAATCCTGTGTGAAAATTAA
CAAAAGTTTTGGTCTTGTAGGATAACGTTTCCAGTAAGAAGTGGAAAAGGGAAGAAAAGA
AAAGATGCAGATGGAGAAGATGAAGGCACTGATGAGGCAAAAACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGATCTTGCTGCTCATTTCAATATTCATAA
ATAAAGTTTTATTGGGACATGACTATACCCATTTGTTTTTTTGGTTTTGTTTTTATTTTC
CTAATTTTTAAAAGCTTTATTTTGTATTTCCTGTGGCTAATTTTGTGCTACAACAGCAGA
GGTAAGTATTTGTAACAGAGATTGTATGGCCTGCAAAGCCTACAATGTGTACTCTCTGGC
TCTTTGCAGAAAAAGTCTGCTGACAGCTGATTTAGAAGTGTGTTTAATTTTGAAGTAATT
GGAGATTCTCCTGTTACCTTCCTGTTACTGATTTCTGGTCTAAGTCCATTATGGTCAGAG
AATATACTGTGTATGATTTTAATTTTTTGTTTTTTTTTCTTTTTTAGTTTGTTGAGATTT
GTTTTATGGCCTAGGATATGATCTATTCTGGTAGAACACAAGACGAAGAAGATAGTCCCT
TATGTTTACCATTTATCTTTCATTCTAAATCTTCCAAGTTTTCTCTGGTACCATTTCCTT
TCTGTCTGAAGAACTTTTTTTTTTTTTTTTTAATCACTTTTTAGAACAGTTCTGTAAGCA
GTGAGTTATCTTTGTTTTCCCTTAATGTGAGAATAGCTCAAATTCACCTTCATTCTTGAA
ACATATTTTCCCTGGACAAAGAATTCTGGGTTGATAATTTTTTTTTCCTTTCAGCACTTT
TGAAATGTTATTCTACTTTCTTCTGCATCCATGTTTTCTGATGAGAAGTCCACAGTCATT
CGAAACATCCTTTCAATATTTGTGATATATTAGTTTCTCTGATTGCTGTAAAGATTTTTT
TCTTTGTCTTAGTTTTCAGCCATTTAATTGTGGTGTATCTGGGCTTAGATTTTTTTTGTG
GTTATTCTATTGGGGTTTCAGTGAGCTCAGATCTGAAGATTTATGTCTTTTGCCATATTG
GGGAAATTTTCAGCCATTATTTTTCAAATATTTTTATCTATCCTGTACTCTTTGAGTCTC
CTTCTTGGAATTTACTGATGTGAATGTTAGACCTTTTGGAGTTCTCCCATAAATTCATGA
GTCTCTTTATTTTTTTCAATCTTTTTTCCTGTTGTTAGGGGTGGGAAATTACTGATCTGT
CTTCAGGTTCACTGATTCTTCCTCTATCCTGTCCATTCTGTTATTGAGCTCATAAAGTGA
ATTTTTTAATTTGTTATTTTATTTTTCAGTTGTAGACGTTCTACTTTTTAACAATGTGAT
AACTTAGTAGTTTGCTATGTGTTTATCTTATTTTTAGGTTGTGGGCCCACCTGGTACAGG
AAAAACTGATGTGGCAGTCCAAATCATATCCAACATCTACCACAATTTCCCAGAGCAGAG
GACTCTAATTGTTACTCATTCCAATCAGGTAAATGACTGTGTGTGTGTTTGTATGTATAT
ACGATAACAATTATGAGGATTTAAGGGAACCGTAAATATGAATATTTCATAAGTAAAAAG
GAATGACTTCTAAATTGCTTTCATCAGAATAGTTTGTGATAAATAAGTGCTCTGTTCATT
GTTGTATAGAGAACATTACACTTTTTAGCCTAAGATTTGAATAATGCACTTTACCTTTCC
ACCCTCTGGTCCTCTAAATGTAATTTACCTACACATTCACTGCTTCTTACTGTCCTTCTT
CAACTGCAAAAAATTTTTCAGTTCTCTGCAACCCGTGGAAATGGTGTTGAATGAGATGAA
ACTCAGTATGGTTGCTGATTATTTTAGGAATTCTTACAAGTTGGGGGGGGGAATAGCATC
TGAGCCAATACCTTTCTCTTTTCATTAATTAGAAGCACAGATTTAATGGGTAGATGGTTT
TCAGTTATTCATTTGGCCAAGTATACATAGATGTCAATATCAGAAAACAATAAAAATACT
ATCTTTTCAAAATTATCAGTGAACTAACATGAGACCTATTTCCTTCTGTGTTTCAAGTTT
GATTCTTATCTGGGTGATGCTCATCTCTTTTATCCTTCTAAATATTAGTTTTTGTTATAT
ATAAAGGTGCCTGCTGATTCTTTGAAACTCACCATCCTCCTTTTTGCTTTATTCTTCAGG
CCCTGAACCAGTTGTTTGAGAAAATTATGGCTTTAGACATTGATGAACGCCACTTATTGC
GTCTTGGTCATGGAGAAGAAGAGCTGGAGACAGAGAAAGATTTCAGCAGGTGAGCAGATG
GGGTGAGTTTTTAAACAGCATACAAAAGAACTTTTAACTTTGTCTTCCTTTCTTTATTAA
AGAAACACCAGGAGAAGAGGGCAATGAATATCCAAACTTAATTCTGAAAGGTTCTAGTGT
AATATAGCTGGACTATATATATTGACCTACAATTCTGGTTATGATCTCCCTCAGTTTCAA
TTTTGTGTGATTATGCCATTTTTTTCCTCAAGTATTCGGTTACTTCAATGAAGAGGATTA
TCTCTTTCATTTTTTAAAAATTGAAGATTGCCATTTGCTTTGTATTTATTGAGGTTATTT
TTAATATTGCCAATTCAGAACTGTACAACTTTAAGTGATTCTTTTTTCACATTTCATTCA
GACATTTAATTTACATATATTCTGGGTACCAGTTATGAGGCTAATTTATTTAGTGAAATA
AAAATTAATAATTAATGATAGTATAAGCTTTAGGATTATAAATATAATTCCTGATACTTA
TTGCCAGTTTAGCTGGGACTTTATGTTTCATATTGCATATTGTTAATTGACTGAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTAATTTTTTTCTTTAAGGTGC
TTTATAATCATTTATGTTTAAATCCATTTTTAAAGTCCAATTTCAGACAATAAGCATAAT
TAGTAGCTAGACATATTTAATATAGCCTTTGGCTATTAAACATGATCTTTGACTAAATTG
ATCATAGACATTAAACAAGTTTTAAATTATTATGTTGCATCTATTTTGAGTTACTGTACT
ATAGAGCTCACCAAAAACTTATCTTCTAAAAAAGACATTATGCGGCAGAGGGCAAAGTAC
AACATGCCATAAGTTATTTGCGGCTCTAGATTCTTAATTTTGGATCAGCCAATGATACTT
CTGAATTCTTCCTATAGATATTTCCTCATGTTAAATCTAACTTACAAAGATGGGTTAGAC
TCTAAAATCTAATAATTCAGAATTCAGTGATTATAAAGGTGATAATGGAATACTTAATAT
AATTACAATTATATTACAGTAGAATTTATAGTGTTTAAAGAATATTATAATAGAACAGAA
GTAGAATTTTTTTTGTTGTTTTAGAGATAGGCTTTCTCTGTTACCCACGCTGGAGTACAG
TGGCATGATCATAGCTTAATATAGCCTTGAACTCCTAGGTTCAAGCTATCCTCCTGCCTT
AGCCTCCCATGTAGCTAGGACTACAGGCAGGAACCATCACGCTTGCCTAATTTTTTTTTA
TTTTTTGTAGAAATGAGGTCTCACTATATTGCCCAGGCTGGTCTTCTTAAACTCCTGGGA
TCAAGCAATCCTCCTGCCTCAGCCTCCTAAAGTGGTAGGATTATAGGCATGAGTCACCAC
ACCTGGGCGAGAAGTAGAATTTTTAAAATGATTTCATATACAACTAATTTCTGGGGGAAA
AAAAGACTTTTTGCCATCTTAGTATGTGTATATTCATTCAATGGACATATTCTTTCATTT
GTCATAATTAAAAAGAAAAATAATGACTATTGTTTCACAATAAAAGTAATATAACTCCCT
GTAAGAAAAAAATTTAGCATCTAGTGAAATCGTGGAGAGGGAATGATCATCCATAATTCC
ACAACTCCCAAACTTTTTGTTAATCTTTTTCTTTAATCAGGCTATTATTTTTAGTTTTAT
ATATTGCTTTTTAAAAATAATAAACTTTATTTTTTAAGTATAATATACTAATTTAACAGA
TTGTATATAGAGTTCTGTTGTAGTATACATTGCTTTTTTTAAAATATTTTTTATTATTTT
TTATTTTAGCATATTATGGGGGTACATGTGTTAAGGTTACATATATTGCCCATGTCCCCC
TCCCCCCTCGAGTAAGAGCTTCAAGCATGTCCATCCCCCAAATTACATTGCTTTTTAAAT
TTAGCATTATGTCACAAAAATGTTGGCATTATATTGCAAAGTCTTTATAAGCATTTCTAA
TTTTTTTCTCATCATCAAAGTATTCATTGTAGTTATAGTTTTAAATTATAGGTAAGCAAG
ATAAAAAAAGGTACCTCCCATAATGTTTATGTCCAAGTTGAAAAATTCTTCAAAATATAG
ACTATGTCTTACATTTCTTTTTTACTCTTGATCATTTCTTACTGCCTCAGAGGTGAATCT
CTGAACCATGAAACAGCTAGGAGCAAGACTTCTTGCTTTGTCAAATCTTTAAGCAAGTGA
ACAGCAGTGATTAAACCATTTTAGTCTTATTTTAAACATTAAAGGGTTATAGGATGCGCT
TTGTTATTATGGAAAGAGTGTGTATAGACTTTGGCATCTCATTCTTGTTCTACTACTTTC
TTTCCTAACTATGTATTTTTGGACAAGGCACTCTCCACACTTCAGTTTTCTTACTCATTG
AGCATATATTTATGAACCTGCTAGGTTTGGGTGCCAATAGTGTAAAATAGTGCTATTCAG
ATCAGCCAATCTGTAAACTATATGTTCTTGGTCTGTGATGAGATAAACTAGCACCAGAAT
TCATTGTACTCTGTCCTACTTTGTGAAAGTCTTGTTATAAAAAAAATAGTAGCTGAATTA
AATGGTATATTTAGTGACATAGTTGGTTTTCCCTCACAGACCAGTGATACACTTGCAGAT
CAGCACTGGTCCACAGGGTACACCTCAAATAGCTTTGGTATAAAGTAACCCAAGAACTAT
GACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
TTCTTGTGAAGCAGGGAAGACATGCATCATCTTACAATGCAGTCTACGTTAGATTCGGAC
TTTTTAGAACTTTGAATAATGGACTAAAGAGCATGTTTAAAATGCATATTTGATACAAAA
ATCACTTGACTCTAAAACTACTACTAAAAAACTACTTGTAAAAGTAGGAGAAACAATCTG
TAAATTGTGTAGGCTTACATAATAAATTTGGGAAAAATTAACTACAGGCTTCACCGTGTA
GATCAGCATGTAAGAATCAAATTGGGAAAGGTTTTCAAAAGGTCAACTTCCCCAGCCTTG
TTCCCAGAGATTCTCACTCAATAGGGATGGATCAAGGAGTCAACAAAAATGTAGTTCCTC
AGATATTCTGCCTAAAGACTATCCTTTGAGAAACACAGAGATGATAACAGAAAAAGATTT
GAGAGAATTATAAAAATCGAGGTTAAGTAAGAACTAGCTGGTAGAAGCATAGCATCGTAC
ACAGACATATTTGAGCTATATCACAAGAGTCATGAGGTGTGCTTTCAAATATATACTCAA
TCAGAAGATCTTTATAAATGTTCTAAAGAGATTGGAAAAATTATAAAGGTCTGGGAGAAG
GGTTAACAGGTGCCAAATAGATTAAAAATCTGCTAAAGCTGAACTTACCATATAGAGAGA
AACTGAGATAATGAAAAAAAATGAGAAGTTTCTTTGTCCAGAGAGCTTTCTTTTCTTTGC
TTTTTTAAAAAAAGCATTGGTAATAAACTATCTTGAATATGCATGGGAAATCTCAATATC
TGGGGCAGAGTCTTCTTGGAATGACCTTGAGATTATTTCCAGTTTCTACATTTGTTATTA
AAGAGCCATTTTTCTTCAATCACAAAGTTATTTTTATTAAAGAACAATCTATCAGTGACT
TGGATGAGGAGTAGTTATATTGGGTCAAAGATTGCTTTGATCCAAAAAAAGATTTCTTTT
CCTTTTTTCTTAACCTACCAGATCTTATTTTCACTAGATTTCTTTTTATTTTACCACTTC
AAACATAATGATTAGCTGGCAAAGTTAACTTTGAATCCTTTTTCCTACAGGTAATGTCTC
GTTGGGAAGAGTATATCAGCAAAGTGAAAAATAAAGGTAGTACATTGCCAGATGTTACGG
AAGTCTCCACTTTCTTCCCTTTCCATGAATACTTTGCAAATGCTCCTCAACCCATTTTTA
AAGGCAGATCTTATGAAGAAGACATGGAAATTGCTGAAGGATGTTTCAGGCATATTAAGA
AAATCTTTACTCAGCTTGAGGTAAGGATTCTTCAGCGTTTTGAACCTTTTTTTTTTTTTA
AACAGTTTTTAGTTTAGTTTGTTTTGGTTTTTTTTTTTTTTTTTTTTAGAAGTAAGTGTC
GAATTTTCAAATCTTGAATTGGATTGTTACTTTTAAGTAAGATTACTGGAAACATATTAA
TAGTTTTAATTCAAGAAATAAGTATAAATTAAGGTATGAATTGGATCCCTCTTCTGGCTT
TTCTGGTGTAAAGGTCTTAGTATTTAAGAAAGGAATGCTTCCACCAGGAAATTCAGTAAT
GGATCTTTGCATTGGACTTTGAGACTGCCTCATGCCATTCTAAGTTCCTCATGCCTCTTG
ATCAGTAGGCAAAAGGCGAGGTTGCTGTACCAGCTAGGATGATTAATACTGGTTATTAAA
GTCAAATAAGAGTCATAGCTGCACAAGGGGAACAGAGACTATGTCTGGAACCCAGGGATC
TCCTAGTTTTTGTAGGAGTTTTTGCTGTCTTATAGCAAACATCATTGAAAAACTATAGTC
CTGTAAAGGGATCACATTCAGTGTAGATGCCTCAGTAGTAAGAAGATTTAGGATTACTCC
AGGTAAAAAGAGCAGGGACTTTGTCTCTTTTGTCTTTGTGTCTTTTAGATATGATTATGT
TCCCACTTCCTAGAACAGTATCTTGGTGGTTGGTAGGTACAGAATAATAAATATAAAGTA
TGACAATAACAAAATTCTAAAACCTGCAAAACAGAATTATGTTTATAATTATACATAGTA
AAAAACACAAAGTAAAAGGATAAAAATGTACTTAATTTATAATAGTAGCTGCCTTGGGAG
AGGGTGGGGAGAAGGATATATAAAATAACTTACCTGTATCTGTACTGTTTTAATTATTTA
AAAAACAAAATAAAAGTGTTAAAAAGGTTTGAAATAAGTATGGATAATGTTTGGATTTGA
TAAAACTTCATACTGGATACTCTGCTTGGGCCTGTTTGCCCCTCACATCCATCTATTGCC
CATTCCCTATTTCCATGGGGGATCCTCTGCCGTGGTTGATGTTCCGGTTGATCCTTGCAG
GTTTAATTTCCCAGCCTCCTGTGTCAGCTAACTTCTGGTTGAGTTTAGCCAATGAGAGAT
TTGGCAGAAGTTGAAGGAGAGAATGCAGGGTATTTCTCCACCAGTTCCCTTTGTCTTGGG
TTTCATCTCTTCCATGACTCCAGTTTCTGCTGGACTGGCCAGCAACTTGTTTTGTGTCCC
TTGGCTCTAAAACACCACTCCCTCCATTTATCCTTTCTAGCCTAGGAACAGTAATGACTG
CCTGCGTCACTAATCTCTGGGTTACTTCACCATTCCCTGGTTGGCTTTTTAGCTCCTCTG
TCACCTGTGTAACCAGTTCCTTGCTTAAATTCCCTTTGATATGAATACTTAACAGTTTCT
GCTTTCCTGGAGAAACCTTGAGTAATACAAGTATAGTGGTAATTGAGATTGTATTCATAT
CCGTGTTTATATTGTAAAAATTTTACCTTATATAAAACTCAGTCCAAATTGTAGCTTTTA
TATCAACTATTATTTGAACAATAATGAACAGAATTACGATTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT
TTTTCTAAATGTAGTTATTGGAAACATGCCCCTTCAGTAACATTATTACCATTATATATT
TGGTTGTCTGACCAAATTCTTGTACTTATTAAGGTATTATGTATGCTAAGTATCACATAC
TGAAAAATATCCAAACAGAACTAAAAGCTATAAAAATAGCATTTCACAATGGTTTTCACC
TATTAGACATCTGTATGCTTGCATTGTCCATATATTAATCATACAATTAGTCCCAGTTAT
TCGTTTAGTTAGTAAATGAAAAGCCTTCCATATGAGATTTTGGAATACTATTATTTGAAC
TGTAAAGTGAGATATTAAAATGACTTCATCATATGATAAATACAGAGGGAAAGCATGATA
GCCCATTAGGCTGTGACTCATTTACAGTGGAATATAATGATTGAGCAGTAAGTTTGAATT
TGCAAACTCTTTGTGACTTTGCTAGTGATACATTCCTAAACTCTGATTTTATACAAATTA
TTTAGTTCCTGTGCAACTGGTTTATCTCTTGTGTAAAATAAGGTTTGTGTGCTGGTTTGA
ATTCAAAATTAGCAGTTTCATTTGTTGTTGAAAGTAACTGACAATTTTAAAATGGTATGA
GCTCACTGAAAGGTGCTAATAAATTCAAGGTGATAGAATTATTATCTTGGATGAAAGGTT
CCTCAGCTGCAAGGTAAGACAAATACGATAATTATTAAAAGATTGTGTGAATTTACCCAA
GTGGTGTGAACTTATCCTTTTATAAATTATTGTGAGAACTTTTCACCTAAATATTTTGTT
CTTGGGACTGACATATAAAATATACTTTGAATTCGATATTAAATCATATCAATCTAATAA
CAAGGGGAAATAATATAATCATAATTAGCATTTTTGCTTTTATGTAGCTTTTCACATGTA
TTCTAAAAAATATTACCTGAGGCTTATCAAATTTTCATTAATCATTTTCTATACTTAAAT
CATGCTATATACATCTAAAGGTAGTTAGAGTGCTCATAGTTTTTTTTATATTTTTGATTT
TGAAGTTTTATTTTTATCAAATTTAAGAGTTTTAAAAACCTTCTAGATCTACTTAACATA
ATAAAGGACAGTCCCCACTCACCTGATCTTCCCGTTATCCAGTCCTTCAACTCTTTTAGT
ATTTCTTCTGTCCTTTTCATCTTTATCAGTAAAGAATGTTAAATTTCCATTTTAGGCATT
GTCTTTTAGGCAATGACTCTGTCATTTTCAAGGACACACACACACACCTTCATGCGTACA
CTTTGCCTTCCTTAATACTCCCAATGTAGTTATATCATATTTGGATTGCATCAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTTCAGTTGAGATTG
CATCCATTCTAAGCCTTTGCCTTTGCATAAGTCAGATTCTCTGTTTCCTGCATTCCATGT
CTTTCTCTTCTCTACTTTAGTGGAGCACATCTTCCAGTATTCTTCATGTGAAAGGATGGA
TAGGAAGTAATATTTTTAAGACTTTCCATGTCTAAAGAACGTCTTTAGTCTACCCTCACA
TTTTATTAACATGGCTAAGTATAGATTTATAGATTGGAAATAATTTTCCTTCAGAATTTT
GAGGAATTGTTCCACTTTTCTCCAGTTCCAGTGTGGCTATTGAGAAGCTCAAAGCCATTC
TGATTGTTTGTGTTTTATTTCACTCTTTTCTTGTTTCGGAAAGTTTTACAATCCTTTCTT
TGTCCCTAGAGTTCCGAAATTTCACAGTGGTATGTCTGGGGGAAACAGAGGAGGAAGTAA
GATCTGTTTTGACTCATATTTCCTGGCTCCCATGAATACAGACTTTGACATAATTCCCAT
TTTCTGTAAGGTACTCCTTTCTGATCCCACTGTCTTACTCTGCCTGCTTCTTCCAAGTCC
CCAAATTCTCTCCAGACACTCTGTCTTCTGTTGGGAGTGAGAGGAGGGACATTCACTTGG
TTCCTTGAAGTGCGGAAGTCTAACTGCTTCTTTAGACCAATCCTATATCATGTCCAGTGT
TATTTTAGGGAGTTACCAGAGGTAGTGGCAATCATTATGAGTTCAGCTCATCACCTTTTA
GCAGAAGTCTGTCACTTTTATTTGAATTTCTATCTTCTTAAATTCCAATTTATTTCTAAC
ACAAAGTTAATTATTAGTTCTGATTTGTATGTCTGTGTTCTGGGATTAAAAGTATGATTT
TGATCATCTTAAACCCATTTTGAGTTGTAGAAATTGTAGAAGGAAATGTATTAGAATAAT
CATCAAAACAACAGCAATAATAGCTATCCTTTGTTGAATGTCAGCTATGTATCAAGTCCT
GTGTACACTAGGCTCTTTATAATATTTCTTTTCTTTACAACTAGATTTTCATATGCGATG
TCATCTCCATTTTATAGCTGAGAAAGTATGACTCAAGAGAGACGACAGAGTCACAGGTAG
TCAGTTATAGAACTAGGATTAAAACATGGTTTTCCAAGAATCCAAAGTCTATTGTGCTTT
TCCTCTTAAACCACCCTAACCTTATCCCAGTAGCTATATTCCACTAAAGAATGATAGAGC
TGTGGTAACAGTGGCCACAGAATTCAGGAATCTCTAAAAGGTTATAGTGAACTAGCTCCT
ACCTAGCCTGGTCCCTAGCATAGAACATCAAGTGCCAACCCAGCATTTAGCTTCTTAGGA
GGGATTAGTAAGGGTTAAAAGAATGAATGATCTAGTGATAGAATACTTGGAAGAACTAGC
TAAAGTGCTGATAATTTTGCTTTGGAATTAAAATCTCCTTTTCAAAAGGCAAAATCTATA
AATATGTTTTCATAAGTTAAATTGCATTGGATTTTCAGAGTTGTTTTCAGAAAGCAAGCC
CTTTAGGCTGTCTTCTTTTGAGCTGCTTCTACAGTGTTTTGCACGTAGTATCTATTATCT
TGAGAGTCCATACAGGGACTTCTTGGAAATTATGGCTCTTTGAACTCCTTCTCTTCAGCT
CCCACCAAAATGACTTAATCATTGTAACAGAGAAATTCAGCATCATATAGAGCTAGAGCA
GAGACCCATCACATGCCTAAACCTTCAGGTAGTTAATGTCAAGTGGGATCCAGCCCAGCT
ACCAATCCTGGACAGACACGGATACAAGCATCTTTTAGTAAATATGAGTAGCACAGAAAT
TATAGTGTACGGCCATACCACCCTCAACGTGCCCAATTTTGTTTGATCTCGGAAGCTAAG
CAAGGTTGGGACTGCTTAGTACTTGGATGGGAGAAAGTACAGGATATATAAATATTAGTT
TAAAAGAGGAGAGTTAATCAGGCATTTAAAGTAAATATGCTCCTGTTACCCTCTGCTTCT
CTAGAAAATAAAATAAGGGGAGAAAACTTTAAAAACAAAAAACAAAGAAACTTTAATGTG
TATTTGGTGAGATTCATGAAGAAGATACTGTTGTACCAATAAAATAAGAAATAGAATGTT
ATACTAAGTAGCAATCAGAAGTGAAAAGAAAAGACAAAGCATGTTGAAAACAGATCTAAA
AGAGGGCAGATAGAAGAGCATTAATTATCAAGGAAAGAATGAAATTTCCTTGTTTTGAGA
AAGACTTCATTTTTCATTGCGTAGTACCTAACGTTACTGGACCAAGGAGAGGATATAGGC
ATTAAGTAAATATGAAGATACAATTACAAAAGGAAAAAAATGACAGATAAAGTAGAAAAG
TCAGGGACCAAATTGGATATAAGCCCTTGTTAATACATCCCTGCAAGCAATGTTAAGGGA
TTTTTTTTCCCCTAAGACAATGGGATACCAGTGAAGGGTTTGAAACCAGCAGGTGATATG
ATCCCTATGACTGTTGTATCTGTGACTTAAAGTCATCAAGACAGGAAAGGAAGGAACTAG
GAGGGAAACTGCTGGCAGTAGTCATAGTGGTGGCTTGGACTTTTAGAGTGGTAGTACTGG
TGGGAATAAAGAAAAGTGAGTAGACTTGAGGGAGTTTTGAAGCTAAAATCAACATGTTTT
GGTGATGTATTAAATGCCCAGGGGTGAGACAGAAGTGGATTGATGTGATGGATAGGCTCC
ATAAGGAAAAAAATTACCCCCAGTACTACCCAGGGTAAAAGTACCAATGGGAATGACCTC
ATGTATAATTATAAATTGATTGTTGCTGATACAGAATTTAAAGAGCTAAATCAATATTGC
AATCCAAGAAATGATATATGATATTGCCTCAGTGTAGAGTAGTATATTTAGAGGGCTTTC
CTGAGGATTAAAGACTTGAATTGGAGATCATTTAATGATGAATGAGATCATGAACTTCCT
GTTTGAACAATTTGTATGTTGTTATTTTTATCTGAAATTATTTGGAGGTTTGGGGGATGG
TTGTTACAGTTGTAGTGGTAGTCGTTTGACTTTAAGCTGTGTTTTTGACAACCTTCTGCT
TTTTCTCTTTCTTAGTATGACAACATTTTAATGGAAGAGGCTGCTCAGATTCTAGAGATA
GAAACTTTTATACCTCTTCTCCTACAGGTAAGAAATTAAAATCTAGACAAAGAAAATACA
GTTTTAAGAATTTGGGGGAACAGCATCAGAAAGCTATACTGTTTGGGGTTGCTTGCTTAT
TTCCACAATTATATATTTTCCTTAACTTCATTATGTTTGATATTCTATTTCAAGCCTGTA
AACTTCCTTTCATCTATTCACTTATTGTTTCTAGGAGTACTATTTAAAACTTCATAGTTT
ATTTCTATAAAGTAGTTTTGAAAAGACTTAGTCTTTTTAATCAAGAAAATTACGTTGTTA
CGCAGTTTGGAGGGAAGATAAGCTGTTTCTTCATTTCTTTTGTTATAAATATTTCTGGAA
TTGTTTTTTATGTTCACTGAGTACATTGCTTTTCTTTATGCCTAAGTTTTTAACTAAATG
GTGATATTTAAGAATGTTTTTTACTGTACAATATTTTTTACTATTGAAGCATTAAAAACA
AATGTGGAATTCCCAATTTAAGAATAAAGAATGCTCTAATACACAGATAAATTGAGTTCC
AAAAGTTGTTTTTATAAACCAAATTATTTGCAACTTGGAATGTGTTTTATCAGGATATAT
TTCAAGGAACAAGGAAACACATAGAGTAGGAAATTAACGAGTAGTGTAGAAAATTAAAGA
AGGTACAATTGTTACTGCCATGGTGGGTTCAAAACTGGTCCTCAGCATAATTGTGAAACA
AGGTGTTTACTTTGCATTTTTCTATTTCTTTTCTTGGGCTTCTATTTCCTTCTGTGTACT
CTTTGCCTAGTGCTGACCTCAGCCTTCCAGACGTCTTTGGATTACTCTGCCTGTTAGAGT
AGAGTAATTCTATGCTTGACTGCCCAATCCCTCCACCCTCCCTCACCTACTATCAACCAA
GAGCAATGGAATCCATACCTGATACATGAGTTGTTCTATAAATTTGGCAGACTCTTCTGT
GTGGAAGTGGTAAAGATTGAGAATCTGTAAGTTAAGGAAGCCATTTGATGAAGAGCGAGT
CTTTTGTGTAATAAGTTAGAGACTAACAGGATAATATATTGATTATTTTGCCATTTTCTC
ACTTTCATTTCTAGAATCCTCAGGATGGATTTAGCCGGCTGAAACGATGGATTATGATTG
GTGATCATCACCAGTTACCTCCAGTCATTAAGAACATGGCCTTTCAGAAGTATTCAAACA
TGGAACAGTCTCTCTTCACTCGCTTTGTCCGTGTTGGAGTTCCTACTGTGGATCTTGATG
CTCAAGGGAGAGCCAGAGCAAGGTAAAGGAGACAGAAAAAAAAATCACTCCTATTTAAGG
ACATTAATTCCATGATCAAAGTATTTGTAAACATCTTTTATATAGATTTTAGCACTCCCT
ACTTTCCTGGAACTTGCCATCTATAAATCTGAAAGTACCTTTATTGCTTTCTGCATGAGA
TATGAATTGACCAAATAAGTAATTTCCTTCATTTTAGTCATTGAAGTTAATTTATGTGAC
TTATAATCTAAAGGCTTCTTTTCACTGTCCCTTGCCCTTTCTTCGTGTCCCCAAAAGATA
AAGTAATATACTAGCACTTTCACAGGTCCTCCCCGAGGTAGTGGGGCCAGGATTTGGTAG
CTGGTGCTGAGAGAAAACCCTTGATTACATCCTTGCCCTGGGACTGTACCAGTGGCAACT
ATCACTCAGTGGTACAGAGACCATTCTATGACATCTTATTCAACTTTCTGCCTTTCTCCT
GTTACTCTAACCTTAGGTCCCCTTTCCCCCTTTTTTTCTTGACCATACAGAAAAAAGAAA
AGATTAAAAAAAAAAGATATAGGGTACAGGCCCCATCTCATAGTTACTCCTAAATTATTT
TCAATTTACAGAGTCTTCCAATAATTTTTTAATTTAAGGAATTAAAGACAGCATTCACCT
TAGGGAGTATAGTAGAGCTATATCATTTTTATAATATCTGCAGTCTTCTGACCCTTGGTT
CATTGAAGTAGGAAGGGTAAGGTTGAAAGCATTATGGCTTAAAATGTGAGCAAAAATGAG
TAACATGAAAATTAAAAGGAAGCACAGTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCTCCTGATGTATATAAAAAGGAATTTTACATCACTAATATTTTTCTG
TGTTGGGGGGGGATTTGTCTTTGAAAAGCTTGTGTAATCTCTACAACTGGCGATACAAAA
ATCTGGGAAACTTGCCCCACGTGCAGCTCCTGCCTGAGTTTAGTACAGCAAATGCAGGCT
TGCTGTATGACTTCCAGCTCATCAATGTTGAAGATTTTCAGGGAGTAGGGGAGTCTGAGC
CTAATCCTTACTTTTATCAGGTAAGAAAAAACATGAAGCTTTTAAGCTTATTTTGCATTT
ATCTGACTGAAGTACTACCTAAATCAGTGATATTGAACCATTTGGCTAAGCCTTGAGAAA
AGGAAAGTTAGAGCCCCAGCTTATACACAACACACACACAAAAATCAATTTCAGATAGAT
CGAAGATATATACACTAAAGAAAAGAAACTTACTGTAAACATACTAGAAACTACTAGAAG
AAAATATTGATGAATATGTAGTGTTGAGATGAGAAAGGTCTTCCTAAGTTTGTTACCAAA
GCAGAAATCATAAAGAAAAATATTGATTGATTTGAGAGAAAATTTATTTTCCATATTTAA
CAAATAATAAGTTGAATTCTGAATATATATTTATATAGAACTCCTACAAATTACTTTTTA
GAAAAATCAGTCCCCCAACACAAAAATGCAATAAGGGTAAGAATATGCAGTTCACACATA
CAGAAAGATTTATAATAAGTATAAATTACTAGATCATATTTTCACCTCTTTGAAAATACT
CAGTGTTATGGTAGGTTTGGGGAAATTCTATATTCATACAATGTTAGTAGGAAAATATTT
TAGGGGACAATTTGTTAGTATGTATTAACAGCAATGTTTTCACTTCTACGAATTTATCTT
TAAAAAATAAAATTGGGCGAGTTTGCAAAAACACAGGTTTAATGTTCATGACTGTGAATT
ATTTTTGAAATGAGAAACAACCTAAATATCTATCGGTAGGGATCAATTATATTATTACCT
ATTCCATATAAGAGAAATACTGAATAGCTACTAAGAAGGATGACATTATAAGTGTTTACT
AACAGGAAAAATGTTTATGCTATGTTAAATTTTAAAAAGCAAGTTGCAAAATATATCTAT
AGTGTCTCATTTTGTTTTTAAAAGGGAACAGCAAAACATGAATATAGAAATATGTACAGA
TAATCTTTATAAAAAGATCTGGCAACACATACATCAAAAGATAGCATTCTTTGAGTGGTA
GCATTTAGGGTTCTTTAAAAAATTGTCCCAGGCTGGGTGCGGTGGCTTACGCCTGTAAAT
CCTAGCACTCTAGGAGGCTGAGGTGGGGGGATTGCTTAAGGTCAGGAGTTCGAGACCAGC
CTGAGCAAGAGCGAGACCCTGTCTCTACTAAAAATAGAAAGAAATTAATTGGCTAACTAA
AAATACATAGAAAAAATTAGCCCAGCATGGTGGTGCATGCCTGTAGTCCCAGCTACTAAG
GAGGCTGAGGCAGAAGGATCGCTTGAGCCCAGGAGTTTGAGGTTGCTGCGAGCTAGGCTG
ACACCACAGCACTCTAGCCTGGCAACAGAGTGAGATTCTGTCTCAAAAAAGAAAAAAAGA
AAAAAATTCCCCTTTACAGCAAAATGTCTAATATATTTTGTTAACTAAATTAGAGATCTT
GAATTATTCATGAAAAAGCATCCTATATCACTGGCTTAAATGTATATGTGTAGATGTAAC
TCCAAAAGATCTTATTTTCCTTCCAAGTATTTGGTTATATTAAATCAAGTTACCCTGTGT
GTAGCTGTACTCATAGCCTGAGAACAGATGTCACGAACTTTAAATGATAACTTTAAATTA
TTAGCACCTAATTCAAGTAAGTGATATATTTCCTAATAGCCACTTTAGAAAGTGACTTAA
GTATTCTATCAGTATTCTACTGATGTTTTCATTGCATTATGGTTTTTGGAATTTCTCTTT
TGAGTAATTTCATTACCTGAGGTATACCGTAGTACTGATCTGAAACGTTATTATCCAGGC
TGGTTATCTGTTTTCTTATCATGAAGCCTAACTCTGGATAAGTTTTCAGTATTTCAAGAA
ATAAATTTTCAGATGATGATTTGCCACTATTAAATATATTTGGAATGAGTTCTAAAGTGT
TTGTGACACTATAACTCACATTGTTTTATTGTTAATGCTTTATGTCTGACCTTTGGGTAA
TGTGCCAAATTGGGGAATATTCATTTTTTACATGAATAGAGAAATGGGTTTTATTTGTTG
ATAGTTTATTGAATTGGTCTTGCCCAAAATATACATCTTGAAAACTGAATTGTGCTCTAG
TGTTTATTATGGCCATTTCCACAATTCGCAGTTTGTTCTTTTATCTATATTAGAGTTGTT
GTTTAGATAAATATAGTTTGCTACCAGTATAGAAAATAAAAAGATTTACATGGTCATGTG
GCTTCTTTTCCCTTCCATCTTCTGAAGAACTAAAAAATTTAAATGAAAAAGTTAACTCTG
GCTATGTGAATGTCACAGAGAACCAGAATATAAATGATATATCTTAAGGTCTTCCGATAA
TTTTTCTGTTGCCTTTGCAAGCAATCCAACTTCATATTTTTGGTTTTTGATTTGTGTGTT
GTATTTATAGTTTCACTTTTTTTCTTTCATCTAGTACTTTGAATTTAGGTTTGTATATGA
TTCCTCACGTTCATTTTAATACTCTTTTTCATAGCAGCCTAGGCCAATGATTCTTCACTT
TTATGTTCAATTATACCTTAGTCTTAAGCTCCTTCCCACCAATCTTTCACCAGTCTCTAA
CTTAGCAGTAAGCCAGACTGACTTGAGGCCACATCCTCTTCCCACCTAACATGGTCTAGT
AGAGGTGGCAATCATCAGTGAGAAAACAAAAACAAAACACAAAAAAATTAAGAAATTTGA
GGAAAAAGGAAAAACATTGTGCAAAAATTGAGCATCAACTATAATACTACTAGTTGTATT
TTTAATTAGACTGGATTTTGTACTGGCTTCTTAGATAGTTACTTTGTTCCATTATGTTAA
TTTTTTTCATAACTACAGTTGCAGTACACTGTATAGAATATTGATCTATATTGTGATTGT
TGTGGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTTATGAT
TGTTCCATATATTGCAAATATACTACAAATGGTAAAGTTTTTATTCATCAGTATTAACCT
AGGATAAGGTTACCTCTCAGTTTTGTAAAAGGTGTTCACTTATCCAAGTTATTAACTCTT
CACTTGTTGTGGTGTGCTAAGTGAACAAATTGTGCTAGATAAGCTATTTTTCTCTATAAA
ATTGACACAAAAAGAAATTAATGCTGAACCATGATTATGTTTGCATTACAGAATCTTGGA
GAGGCAGAATATGTCGTAGCACTTTTTATGTACATGTGTTTACTTGGTTACCCTGCTGAT
AGGATCAGTATTCTAACAACATATAATGGCCAAAAGCATCTTATTCGTGACATCATCAAT
AGACGATGTGGGAACAATCCATTGATTGGAAGACCAAATAAGGTAATTTTGTGAATGCAG
TATGTTCTGTTATTCATCGTTTTGGCAAGATGGAAAGGTTTGTATTTATTACGAGATATT
TATATTGTTCCACTTTGTGTCTTTGCTATCTCCTTTTTAAGATATTTGAGAAAATGAAAT
AAGAGGAACTATAAATAATTCTCTGGCAATCCTATCTGTTAATTTTACTGATTTTCTATG
AAGTTCTGTCTCATATCTCAACTACTACATTAAAGATTTTTTTGATAGTAATCAGAAATA
AAAGTTTCTGAAACTTTTTGTTGCTAAAATAATAGATAACAAAATTATATAATAATTATG
TACTATTACAGTAGAAATATGTTTATACCAAGCAGGCATAATTTGGACTGCTCTTTATTG
TATTGATTGGAGGCTGTCTTGGGGACAAGGAAAGATTGTAAAGTGTATTTGGACGTCAGG
AGGATTTAAAAAAATATTTTTTTATGTAATTAAAAAAATGGTTCAAATCCAATTTATAAT
GAAGCGTGATTCTTTTAGTATAAGAGTCAACTAAAATTAGAAAATAACAAACTCAATATA
TTTCTTAATGATAAGGTTTGCACTTCGGGTCGTCAACAAGGGCTATAGTGAAAAGCTCTG
TCACCTTTTTTTTGTAAAGCATCCCAAGGTGACCGAGGGAAAATGGGAGGGAAGAGGGGG
ATAAACTCCATTTTTAGTGAAATGGATACAGATCAGGTAACTAAAATCAGGACAAAAATA
TGGGAGAAAGAGAATTTAGGGGACCAATCTTGAAAGTGCCAGCAAAGACACTTTCTGAAG
ATGAGAGGCAAACCCTGAGTATAAGAGCCACATCCCTGTTATTCAATAATGGATGCAAGA
ATTGGAGTGAGCAAAAGCCCTACTGCCCCCAGATTGGCTCAGAGGAGCCTAGTGATGAGC
TATATTTGCAAAAAGTAGACTTTCTCAACAGTAGCAGGAAAGAAGAGGGCATTTGCTGTG
AAAACCATCCAGCCTTTAGAAAATAGCCTTGCTCACCCCAACTTAACCTTTTGCCTATAG
CTAATCTAAGAAACTTACTTATTCAGTGATGAATAGTGAAAAGGAAACTAGCACAGCTTC
AATTTATAGAAAAAAATGAGGAAAAGAGCATCAAAATATAGACAAGATACATGCTCTAGA
AATTATGTTGGCCTGGAACAAATGAAAATTTCAAATACACATTTTGCTATAAATTTAAAA
ATATTTAATGAAGTAGCCATTTCTATGAGGAAAAGCTACAAAGCAGAGAAATACAAGAAC
TCAAAAAGAGATAAAAAGTGAGTTGGAAGAAAATAAAACAAAATCAAAAAGAGTATAGGG
AAGAATAGACATTGCAGAATACGCCATAAGGAATATAGGGAGTAAAAATGAGAAACTAGT
AGCTTTGAAACATAGAAAGTTTAGCAGTAGAAGGACCTCAGTATCTGAATCCTTTTATTT
ATAAGTAACATAAAAACTTAAATAATAAGGGAAGTTACTATCTCTCATAACAAGAAGGTG
GATGTGGTAGTTTCAAGGTTGGATCACAGGGTGGCTCAGTGATACAAAGGAGCAGGGTTT
ATTTCATCCTTCTGCCCTGCTGGTGTCAGTACGTGAGCCTCATTCTCATACAAGTTCTCC
ACGTGGTCAGGATGGCAACAGAACATCCAGGTATAACATCCACACTATAACAACAAAGGA
GGTATATCTAGAATATATGAACTCCTATAAAAGTCATTATTAAATAAGACAACCCAATAC
AAAATGGGTGAAAGATTGAACAGACACTTCACACAAGACCTACAAGAGGCCAATAAGACA
TTAAAAAATGCTTATCATCATTAGTTGCCGGGGAAACATGTATATAAATTAAAACTACAG
TGATATACCACTACACACCCCAAAGAATGGGTAAAATGGCAAAGGTTGACATAATAAGGG
TTGGCAAGGATGTGGAGCCACTGTAACTCTGGAACTGGAACATCGCTGGCAAATGGGTAA
AGTGGTATAGCAACTTTGGAAGACAGTTTGACTGTTTCTAAGTTAAGAGTACACTAACTA
TAAAGCTCAGCAATTTCACTCCTAGATATTTGTTCAAGAGCAGCGAAAACATATGTCCAC
AAAAATATTCGTGCCTGAATATTCATGGCAGCGTTATTTAAAATATCCCCAAACTAGAAA
CATCCCAAATGTCCATGAACAGGTAAATGGATAAATAAATTGTGGTATATTAATTCAGTG
GAAAACTACTCAAAGTAAAAAGGTGTGAACTTCTAGTGTACACAGCACATTTATAAATCC
CAGAAACATAATGCTGAGTGAAAGAAACCAGACACAAAAGAGTGCATACTTTACAATTTT
ATTTTTATGGAATTCTAGAATTGGCAAAAAATAATCTATAGTGATAGAAAGTAGATCCTG
GGCCGGGGGGTGGGGGGTCCAGATTTACTACAGTGGGGCCTGAGGTGATGGAAATTTTTA
TTGTGGTCGTGGTTACCTCAGGATATATATTATCAAAATTCATGAAATTGTACATTTAAA
ATGAACACATTTTATTATATATAAAGTATATCTCTGTGAAGTTGACTTAAAAAAAGTGTT
TTGCAAATTTTCTAAAAGTAGAGGAACCATAAATTATGGTTTGTGCAGGGTAAGCAATAA
ACTTTTTCTTGAATTGATGGAAAAAAGATAAATGGAGCTGGGCATGGTGGCTCATGCCTG
TAATCCCAGCACTTTGTGAGACTGAGGCAGGAAGACCACTTTAGGCCAGGAGTTTGAGAT
TGGCCTGGGTAACATAGCAAGACCCTGTCTCTACAAAAAATAAATTAAAGAAAAAAAGAA
AGCTAAATACCTGAGTCCAGTATTAATGACTGAAGCCTTTCTGAACTTTCCTATTTGTAC
ATATATTTTCAAATTGAACAAAAAGTACTGTGAAGATTTTTTTTCATCTGACAGAGGAAT
GCTGTGGATAAATACTAGTAATATGTTAAATAATAAATGAGCAAACTAAGTTATATTGCT
GGACATCCAAATGGGATACCAGTTAATAAGCTTGACATAGTCCCTGGTTTCACAGAGTTT
GGCATTCTAGTCGGGGCGGGTAGGGGAAGACTGTTAATTCCAAAAATAGTGATTTAGTTA
TCAGCAAAGGTAAAAACAAATGCTGTAAGTGTGAATAAATGTAAACACATAGCTTAATCT
GGTTACTGTGTTTTATTTAATAGTGTTCATTAACTTGGTCTAGGAATTCCAAGCCCATGA
TTATATTTCTTTTGGGATGATTATTTGAAGTGTAAGATGTTTGCTTCTAGCACATTATTC
TTAGGATCTCTAAAGTCTTTTCATTGTGTTTTTGAAAATATACCACAATTCTCATTTTTT
CTTTTTAGGTGACAACTGTTGATAGATTCCAAGGCCAACAGAATGATTATATTCTTCTTT
CTCTAGTACGAACCAGGGCAGTGGGCCATCTGAGGTATGTAGGAAAAAACTTCCTTATAT
TATTGAACTTTACTGTCTATTTCAATTTTGAACTTCTGTGGGTAAGTAATTCTAAATATT
TTTAAGTTTAAATTATAATTAAAATTGAAATAAGAAAAATAAATAATAATTAATTGTTAT
GACAACTTCTGGTGCTTTTTGTTGGAATGTGGCATTATCAGAGTGCTTGTGTAGTTAACT
TGTATTGCCACTGAGTTTTTTTTACTCTTAAATGTCTTAATAGTTTTAAGATTTAACTCT
TCAATAACATTCAGAGCATTTTATTATAAAATCTTAATCCATTTTATATTTGTTGGAAAC
TTGATATCAGAAATTAAAGGAGGTAAAGTGGTAAAAAGTCTCTTCAGAATAAATTTACAT
TGCATAAGATTTCTGATTTTTTTTCCTACACACATCTTTTAGCTTAAATGTTAGAGGATA
AAGGAGCCATTTGTTCTCCTAGGATTAAGAATTGTCAAAACAAACAATAATCTATTTTTA
TCATTTATTGTGATGTATTTATGTGCTAGGGATATATGGGAATAATATCTTCTCAATACA
AAACAGCCATTTATTTTTATATAAACCTTCATCTGAAATGACTTACTAGCAAAACTATAA
GGAGAGTTTATATTATTATTTTATTGGGTGGATATAAAAAGAAAATTCTCCAGGCTCTCA
TAATGTTGTCATTAAGTCAAGATCTATTTGGAGCTTAACCCAGTGATCAGATTCCATTAG
ACTGATAACTTTTATGTAAGAGTAAGCAAAAATGTAATGTTTTAAGAATTTTTTCAAGAT
AGTAGCATCCTAAAATAGTTCATTTTTACTTGTTTATTTAAGTATCAACAAATTATTTAG
AGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTAACATTTCTGGAAACTTAAGAAAAAAAAGATTTTGATGATAAAATGC
TTATAAATGAAGAATTAAGAGAAAACTTTATTTTGGTATTATCTTGCTTGCATATCAAAA
TTTTCTAAGCAAAAATACCTTTATTCAAATAAACTTTTTTGTATTGGCCAAAAGTTCCTT
TTGAAAGTCCAACTTCTTCAGTGGGGGCGGGGAGTGAGTAGTGGTGGTGGTGGTATTAGT
GCATCAAGGGGATAATAAGTAGGAAAATACTTGTGTTTCAGGAGACCCAGGAAACCTACT
TCCTGCCATATTTCATTTTTCATTAGTAACTTTATTGAAATATAATTGACACACCATGCA
GTTCACCTATTTTAAGTGTATAATTCAGTGGTTTTTACTATATTCACAGAGTTATGTAAC
TATCCCCACAATCAATTTTAGAACATTTTCATCACCCCAGCAAGAAACCTTGTACTTATT
AGCAATCACTCCCCTCCCCTCACCCCCAAGCCCTTGGCAACCATTAATCTACTTGCTATT
TCTGTAGATTTGCCTAATCTTGACACTTAATATAAATGGAATCATACAGTATGTGGTTTT
GTGACTGGCTTGTTTCATTTAGTATAATATATTCAAGGTATATTGATGTAAGATGTATTA
GTATTCCAGTCCTTTTTATTGCTGAATAATATTCCATCATGTAAGTATATTCTATCACAT
TTTATTTATCCATTAATCAGTTGTTGGACATTAGATTTTCCCTTTATGACTGTTATGAAT
AGTGCTGCACTGAACATGTATATACAATTTTTTACATGAACACTTATTTTCCTTTCTCTT
GGGTACAGATCTAGGAGAGGAATTTCTGGGTCATATGGTAACTCTGTATTTAACCTTTTA
AGGAACACTTATGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATGTGGTAATAATCTAGCAGTCATGGTCGTCCCCAATGTGAAGTTTTAGAG
TCAGTGGAAGAAACATTAAAGTATATCAATGGAAGATACCTACCTTGAAATCTGCAGATT
TTAGTCCAAATATCCCTTGTATGATGGAGATCACAATTATAAAAGCCACTGTCCTGCACT
ACAGCACTGAAGGCTGGAGGGAAAAGTTTTCTCAGAGGGACCAACACAGTGGTCACTATA
ACAGTACTGTATCTGTGCTCTCTCTAGAGATAGAGCTTCTGAGTGTGGGGGGAGGACTGA
ACATAATACAGCGATTACCATGAAAACGCTTCCCTCCACCACCATCTCTCCCTTTTTCCC
CCCTGACAACATTAAGTTTTAACCATAATTTCCTTTATAATATGTGTGTGAAAACTCATG
CTAAGTATTTCTAGCAGTGTACATTCAGTTACGAGTTTGGGAACTGCCAACCTGTAGTGT
GAATCCTTGGGGTTCTAAGGAAATATGGAGAACATAATGAACAATTTGGCTTTCAGTCAC
ACAAGAACATAACTGATAAATTATGTATTGGTGTCACACAATACCTCCTGATAAGGGAAA
CTAGACACTTTTTAAGATCATAAAACATAGAAAATGAGGCTGAATTAGAGGTATTCCCAA
AATAACTACTTGTATTACACAGAGATAAAGAAAAACTATTAGATAAACATTCCAATTCCT
GGTTCTCTCTCTGGTTATTATATGATCTCTGTAACATTAGATTTCTGTAAAAATCTTCAA
CACTTTCAGGGATTAGAGGTGATTTATTATACTTTATTATTCTTCATGAAAGTCTTCTGT
TTTGTAGCGTACTAAAAAATGTAAATAGCCATATAAAAGCATCTCAAGAAAACAAACCAT
CTTCTGTATTTAAAGCCTTTGCTTTTTTTAGACAGAGTCTCGCTTTGTTGTCCAGGCTAG
AGTGAGTGCCGTGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCGAGTGAT
CCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGTGCCACCATGCCCAGCTA
ATTTTTTATATATATATCACTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACGGGA
TCTCGCTCTTGCTCAGGCTGGTTTTGAACTCCTGACCTTGAGCAATCCGCCCGCCTCGGC
CTCCCAAGAGCTAGGATTACAGGCGTGAGCCACAGCGCCCGGCCTAAGCAGTCTTTTTCA
TAAAACACATTCTAATAGTAAGGTGAAACTAGACTTAATGTATAGCCATCTTTTATAAAT
TTATTTGATTCAACCCTTTTTTTAAAAAAAATGTATATTCTTTTTAAAAAATAGATTAAA
GAAAACTGGTATCTTTCATCAAATAGCCATCTATATGTATATTTGAGTCATTGAATTGAA
CCATTTTTATTACTGTTCATATGAACATTGAGTACCTATTGTAGGCCAGGCATTGAATCT
AAGTATCAGAGTAAATACATGAATAAGACTCGACATTACAGGTTGAATAGCCCTTATTCG
AAACACCAGAGGTGTTTTAGATTTCCAGTTTTTTTTCAGTTTTGGAATATTTGCATATAT
AATACATAATGAGATATCTTGGAGATGGGACCCAAGTCTAAACACAAAATTCATTTATGT
TTCATGTATACCTTATAAGCATAGCCTGATAGTAACTGTATATTTCCCTTGGGAAAACTG
AGTAAACTGTGTTGTGTGACCCACATTTTCACTGTGACCCATCATGTGAGCTCAGGTGTG
GAATTTTCCACTTGTGGCATCATGTTGGTGCCCCAAAAGTTTCAGATTTTGGAGCATTTC
AGATTTTGGATTTTCAGATTAGGGTTGCTCAACCTGTAGTGTTATTTTTTTATCATTATA
TTTTTATATCATTTTTATATCACATATTTCCATATGTACTTATTATTATAAGTAAGTATA
AAATTATGTGGTAAGAGTTATCTAGTAAGTAAAATTTAACCTTAATGGAGCCTGGGAGTT
TAGTAGGTGAAGTGGAAGAAGAGCTGGTTCAGCTTGACTCAGTGGCAATGGTACAGTAAA
TTGGTGACTGTACCATAATACCAATATAATTACTTCGACCCTTTTGGATCAGTACATTGT
TTATATTGTGATCTCCCCCACAACTACAAATAAAACCAACAAGAGGTTAGTAATAAAGGC
ATCAACTTTTACCTGATTTATTAGTCACGTAACATTGATTAGCTTTATGTTTATTAAGTT
TTTAAGAAGCTTAACTTTTCATTGCCATGGCTGAAGAGGACTATTTAGTGGGATATGTAA
AACAAGAAAAAATCTGCATCAATATGTTATTAATCTTCAAGTGTGCTAATTATTTTGTTT
GTTTCCCAAAGGGATGTCCGTCGCTTAGTGGTGGCCATGTCTAGAGCCAGACTTGGACTT
TATATCTTCGCCAGAGTATCCCTCTTCCAAAACTGTTTTGAACTAACTCCAGCCTTCAGT
CAGCTCACAGCCCGCCCCCTTCATTTGCATATAATTCCAACAGAACCTTTCCCAACCACT
CGAAAGGTAGGACTTCTTTCTTCATTGTATAGAACAGCATTTCACTGAGTGGGATATTGG
GATTCTCTTATAGGTGACCCCATTAGCTAGGAACGTTATCATATAGATAATCTAGTCACT
GGTTTAAAGTGCTCCTTATACTAAAGAACTGAAATAGATTTTCTATGTAAAAATAATATC
AGCTAACATTTATTGAGTACTTACTATGTATCAGGCAATTTGCTCTTTACATACATCATC
TCATTTTATCTCTGTAACAGCTTTGTTTTGTTAGGTTTTCTTATAACTTCTTTTTACAGA
TGGGGAAACTGAGGGTCAGAGTAGTTAAGTAGTTTAGCCCATGCATCTAGTAGGTGGAGG
ATCTAAGATTTCAAAACCCAGGCAGCCTGACTCCAGAGTCCATGTTATTTATTATTGTAC
TATACTGCCTCTCTTTAGCTCTGTAAGGAGAACTTAACTATTTATTTGATAACAGAGTAA
AAAATAGTAGAGTTCTAAGAAGCTTAATGTTTTGGGGAAATGGGGGAGGGGAGAGCACAT
ACACTTAACAAAAAGATAGACTGAAAGAAGGGCTCTTCCCTCTAATCCTCCCTTTTTTTC
TCCTTTTTCTTACCACCCTCCCTCCATAGTGTCTCTAATTTCTGATATATCTTTATATCC
CTTTTGCACAAGGGAGTAGGAGAGGTAGTTCTTATTTTCTCTCTTACGTGAGGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTCTAAATTGTTCCTACATTAAGAGAGGG
TAAAACTTTAACCATTTTATTAATGACTAGAAATAGGGAAGTTGTTAATCTCTATCTAAG
GTGGTTTGGGATGAAGTACAAATTTTATATTTTCATTTGCTTTATTACTTTACCTACACT
AATAGAGCAGTGTTTCTCAGATTGTGGTTAGAAACTATTCGTAAGAATCACCTCATTCTA
CCCCAGACCTACTGAGTCTGAATCTCTGGGGTCTAGAGCCCAGCCATTGGCAATTTAACA
ATCCCTCTCAGATGATTCTGATAGACACCACGATTTTATTTTATTTTATTTATTTTATTT
TTATTTTTATTTTTGAGACAGAGTCTCACTTTGTTGCCCAGGCTAGAGCGAGGGCCGTGG
CGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCCTGCTGCCTCAGC
CTCCCGAGTAGCTGGGACTACAGGCATGTGCCACCATGCCCGGCTAATTTTTTCTATATA
TATTAGTGGGCCAATTAATTTATTTCTATTTATAGTAGAGACGGGGTCTCACTCTTGCTC
AGGCTGTTTTTGAACTCCTGACTTCGAGCAATCCGCCCGCCTGGGCCTCTCAGAGTGCTA
GGATTACAGGCGTGCCCCACCGTGCCCAGCCAACACCAGGATTTTAAAAAGAATGTTTGA
ATATTCACCTCCATAACTGATAGTCTATGTATTAAATAATAGTAAATGCTAACTATTTAT
TCTTTAGGAATATATAAATAGGAAGAATAGGTTTAATATTTTCTTTCTGAATTATCTCAT
GAACTCTCTTTGGAGCATATACAGTATTGAAAACTGCTACTTTGAACCATGTTTATTTTT
CTGTTTAAATGATTAACTTATCTCTTTTTTATTTTTCTACATGAGTTAGTAGACAAAAAC
CCATATTTTACTTACTAGCCCAAAATTGTATTAAAAGCTTGTGACTCTTAGTTGTCCTAG
ACTTTAGCTTTTCTCAATTTAAATGGACTTGCTACTCTTCATGAAGTCCTTATTGGACTC
TTACACTTGCATCTAATGGGCTTGTATTGAAATGTTAGCTTCTAGGATTTTTTCACTAAA
TACTTAAGTTTCTTTTTGCCTTCATTTAGAATGGAGAGAGACCATCTCATGAAGTACAGA
TAATAAAGAATATGCCCCAGATGGCAAACTTTGTATACAACATGTATATGCATTTAATAC
AGACTACACATCATTATCATCAGGTGAGTTTTCTTAAGATTGGCTGTTATTTTCCTTGCT
ATTAAAATAATGTCTTTTGCAGAATAAATCTTTAAAGTACCTAATTCCTCTTATGGGAAA
CCAATTTAAAGTAGATGGTTATTATTTATGTAACATTCATATTTTTTAAGCATCTTCACA
CAAATAGAATTTAACATACAATACACATGTTTAAGTATACAGTTTCATATGTTCTGACTT
AGGTATACACCTGGGAAGCTATCACCACAGTCAAGATAAACAGCATATCCATTTATCCCA
AAGAGTTTTTCTTATGCCCCTTGGTAATCCCTCCTTGCCTTTCATTAGTTCCCTTTTCAC
CTTCCCCAGGTAACCAGGGATCTGCTTCTGTCACTGTAGATTGGTCTCTATTTATATAAG
TGAAATCATACAATATGTTCTTTCTTTTTTCAGGCTATTACTCAGCATAATTATTTTGAG
ATTCATTGATGTTGTTGCGTTCTTTCTTTTTTATTGCTGAGTAGTAGTCCGTTGTTTGGA
TCTACCATGGTTTACTCATTCACATGTTGAGGGACATTTGAGTTGTTTCCAGTTTTGACT
ATTACAAATAAAGCCGCTATGAGCGTTCTCATACAAGTGTTTACACTTTCTCTTGGGTAA
ATACCTAAGAGTGGAAGAGCAGGATATGTTAAAGATGTGTTTAACTTTTTAAGAAACTAC
CAATCTGTTTTTCAAAGTGATTGTACCGCTTCAGCAGTATGAGAGTCCTAGTTGCTCCAC
ATCTTCACGCACACTTGATATAGTAGGTCCTTTTTTCATTTAGCTGTTGCTTTTTGTTGT
TGTTGTTGTTGTTGTTGTTTGAGACAGAGTCTTAGTCTGTTGCCCTGAGTAGAGTGCCGT
GGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCTATCCTCCTGCTTCA
GCCTCCTGAGTAGCTGGGACTATAGGCACATGCCACCACGCCAAGCTAAGTTTTCTATTT
TTAGTAGAGACGGGGTCTTGCTCTTGCTCAGGCTGGTCTTGAACTCCTGAGCTCAAGTAA
TCCTACCTCCTTGGTCTCCCAGAGTGAGGATTATAGATGTGAACCACCATGCCAGGCCCA
TATTTTGGCTGTTCTGATAGGCATATAGTGGTTTCAATGTGGTTTTAATTTTCATTTCCC
TAATAACTAATAATGAACATGTTTTCATGTGTTTATTTGCCATATGCATATGTTTTTGTT
CGTCTTTTTATTGAGTTGTATGTTTTACTGAGTTTTAAGAGGTTTTTATTTGTTCTCACT
ACTAGTCCTTTATCAGGTATGTGTTTTGCAAATATTTTCTTTTAGTCTGTGACTTTTTTC
ACCCATTTTTTAAGTGTTTTTCAAAGAGCAGAAGTTTTAAATTTTGTTGAAGTTCAATGT
ATCAAATTGTTCTTTTGTGATTTATACATTTTGTGTCCTAAAAATACCTAACCTAACTCA
GTTACAAAGTTTTTTTTCCTAGAAATTGTATACTTTTAGGTTTGGTATTTAGAGGTATCA
TTTTGAGTTAGTTTTTTCATATGGTACATGAGGTGAGTTTATTTATTTGCATGTGGATAT
CCAGTTATTTCAGCACCATTTCCTGAGTAGACTGTTCTTTCTCTGTTGGATAGCTTGTCA
TCTGAGTCAAGAAATCAATGGACCACATATATGAGCCTATTTCTGGGCTTTACATTCTGT
TTCATTTTCAGTGTATCTATCCCTTTGCCATTATCACACCTCCTTGATTATAGTAACTTT
ATAGTAAATCTTGATGTATAAATAATGTAAGTCCTTTAGCTTTGTTCTTCTTTTTCAAAA
TTGTTTTAGCTATTCTAGTTCCTTTGCTTTTTTATAGACATTTCAGAATCAGCTGGTTAG
TGCCTACCCCAGAAAGCATGCTGCAATTTTAAAAAGGATGTTTTGAGGAGTAAGATTATT
TAGAATCCATTTGGGAAGATTAACATCTTAACAATGTTTTTTTCCTTTTTTATGAATATC
TCTCTCCATTTATTTAGATCTTCATTGAAGTCTCTCATCAGTGTTTCATAGTTTTCAGCA
TATAGACCTCACACATATTTTGTTAGCATTTTTGATAAGTATTTTATATTTTTTGCTGCT
ATTGTGAATGGTACTTTAAAGTTTTTTTTTAATTTCCAGCAAGATAAACAGAGTCCCTGA
GGAGAAAAGCCCCTGGATTGCCATGGAGTGGAGGGAAGGCTAAACACACCGAGCTGCTCG
GGTTTTCTGGTTGAATGGGGCAGAAGCATGTGCCCCTCCCAGGGCTCCTTGACTGAAGTG
GCCCTTTCTTGTGTTGTTATTGTAATCAGTCCTACTCAGCCACTTCTTTTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGATTCTTGATTATTAATATGTGACAT
CTTTGTAGGTGTCAGCATAGCCTAGGCTGTTGTCATCAGAGGTGTTACATCTATAAAATG
GCCAGCAGTGTTTTGAAACACTCCAGAGTGAATAGCATCTTTTAAGAAGATGATATTAAG
GTGAGATCTTAGCTTTATAACCCACAGTGTTTTTCATTTGAGTTCATATTGGTGTTATCT
CTTTTTTTTTATTAGACTTTATTACAACTACCACCTGCTATGGTAGAAGAAGGTGAAGAA
GTTCCAAATCAAGAAACAGAATTGGAAACAGAAGAAGAGACCATGACTGCTCAAGCTGAC
ATCATACCCAGTCCAACAGATGCCAGCTCCAGCTCTAGTGAAGAAAGCCCGGACTTTCAG
TCTGTCGCCACCCCCAGTTATGCTGAGGCCACCACCAATGAGGCAGGAGCCAGTTCAGAT
CCAGACACCACCCCTGCTCCACCTGAGATCAGCACTACTGTGGCAGGACCTGTCACTGCA
CCAGCAGAGGCTGACACACCTCAAGATGCCACATCTGCCCCAGCGGAGACCAAGTAGTCG
AACTGTAGCCCTCTTAGGGAGGACATGGCATTCATAAAATCTAAGTAAAATTACGTTTTG
TATTTTATATTTGCTTCTGCCATTTTAATGGCACTAATTAATGTCAATCCTTATTTTTGT
TACCTGATTTCAGTGTCTTGGATATATTAAAAAAAATTGTATGTGTATGAACAACTCCAA
TTTCCTTTGTTTAGTCTGAAGGACAAATAACCATTCCTTTGATATTTGATCACTGAGTGC
ATGTATCTGTAATCTTGCCTACATTAACATAATTTTCTATAGAATACACAAGACATACTT
CACATTTTTAGTGAGTTTCTCTAAAGAGGAGGACAGAATGCCCTGAAGCAGTGTCCAAAT
GGGGAGGAAATTATTTCTCTATCATACTATCAGATGCTCAAGTTCTGTTTCCTTTTTTTC
TCACTTTTATTTACGTCTTCTTGATTTAAAGACATTAATAGCCATAAGATCTAGGTTTCT
CCAATCTGTCAAAAAGGTTACATGCATTTTCTTTTCCAAAATCTCAGGATGTATTAAAAT
CACCTAGGGTGTCTGTTTATACTTGGGGCCCACCTCAGACCTAATGAATGAGAATCTTGG
GGTTAAGGCCCTGGAATCTGTATTGTAACAGGTTCTCCACACCAGTTGTGTTTCACTTGT
TGGCAGAGTGGCATCAGACAAGGCTGGTGAGGCTGAGCCAGGATTTGTCATTCAGCTAAA
TAGGAAGAATCTGACAAATTGATCTGGGCAGGAAGCAGGATCCAGCTGGGCAACGAGAGT
CAGCAAACTTAACTCCTGTGTACAGGGTAGAATTTCCCCACTGCAGAGGTTCTGAATGTT
CTGCCCTGTTTAGTTTTATTGGTAGATAACCAATCACAAGGAGACCTCCAGGGGAAATGT
GCTCCAAATATGAGAGGACAGAAGTCTAGAACCTTGCTACTCAAGTGTGGTTAATGAGCC
AGCAACATCAATGTCCTATTAAGGTTTGTTAGAAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1070..1097, 1100..1183, 6008..6064, 8481..8521, 13617..13652, 16865..16985, 19332..19472, 21173..21241, 22289..22389, 23774..23850, 30417..30481, 32738..32854, 32955..33068, 35622..35725, 41084..41186, 52294..52414, 56726..56867, 61707..61732, 61734..61771, 61774..61778, 61881..61987, 62088..62255, 75796..75965, 79736..79948, 80155..80183, 82040..82186, 82772..82841, 84697..84807, 85499..85608, 89003..89138, 90830..91039, 96580..96717, 105195..105266, 106334..106521, 107488..107659, 110871..111041, 114428..114513, 119291..119465, 122069..122182, 124875..125057, 125079..125216
1001..1068, 1070..1097, 1100..1183, 6008..6064, 8481..8521, 13617..13652, 16865..16985, 19332..19472, 21173..21241, 22289..22389, 23774..23850, 30417..30481, 32738..32854, 32955..33068, 35622..35725, 41084..41186, 52294..52414, 56726..56867, 61707..61732, 61734..61771, 61774..61778, 61881..61987, 62088..62255, 75796..75965, 79736..79948, 80155..80183, 82040..82186, 82772..82841, 84697..84807, 85499..85608, 89003..89138, 90830..91039, 96580..96717, 105195..105266, 106334..106521, 107488..107659, 110871..111041, 114428..114513, 119291..119465, 122069..122182, 124875..125057, 125079..125213
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved