Microcebus_murinus Locus C17orf45
snOPY snoRNA Orthological Gene Database
Microcebus_murinus C17orf45
Microcebus_murinus
C17orf45
GeneScaffold_3484
SNORD49
1346..1416
5654
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAGTCCAGCTACTCGGGAGGCTGAGCAGAGATCGCTGAGCCAGAGTTTGAGTGCGT
GAGCTAGCTGACATCACGACCCTAGCTGGCACACAGGAAAACAAAGCCCGCGCTCAAACT
CGCGCAGCGCTCTGGAACCATCGCGCGCCTCGTGACCCAGAATTCCCCGGGCCGTGGGCG
AGACCACAGGCTCAGGAGGAGGGGGGACTCCTGGTGAGCGTTTACTATCTCCCTCCCTCC
TGTGAGGAATGAGATGTTCCGACTCCTTAAGGGGCTGGGGCCGCACACACGCGGCCTTTC
CGCTGGAGTTGTGCGATGGAGGTGAGTCGTCTTTGCGCCCCGGGCCAGCTACTGGCGGCA
GGGGCAAATAAAGAGCTAGAGCCCCTCTGACCTCCGGAGAGGGGTCCGGGGAAGCCTAGC
TGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGGTCTCGCGCCTGCGCTCACGTGGGCTGCG
GGGCCTGCGCCACGGCGGGCGCTCGGCCGTCTCGCGGCGGGGACCCCGCTGCTGTGGGCC
GAGGCTCACGGCGCGCGTGCTTTTCCGGCAGGGTCACCGCAGTAGCCTGAGATCCGCGAA
GGCCGGGACCCGGTTACCCGGCCCGCCGTGGGAAGTGGGCAGACGTGAGAGCACTGGGTA
AGGGGGGTCTGCCTGCAGTTTGGGTGCCCGGAGGGTGCTCCACGTGGGTAGGGCCTTAGT
GGGCCTACGCGGAGGCCTGGCTCGACTGTCCTGATGATACTGGAAATAGGAAGTGCCGTC
AGAGACGATAACTGACGACGTTTATGCTTGTCTGACCGCAGTCCCTGAAACCTCCACGGT
TTAGTTGGACGTAACTGCCAGAATCTGCCCTAAATTCTTGGCCTTATTCCGTTTCAGATG
GTGTGCGCACTGCAGAGTGAAGACAGGGTAACTATGAGGTGAGAGCTCCGTCTGGATAAG
GTTTAATATGTAACCTAGTTGTAATTTTATCTTCAACGAGCTGGAATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCAGTCTGTCTGA
GTGCGTGTGCCTTCTCTTATTCCCCCAGGTTTTGAGAACTGAGTGCTGGAATGTACAGGT
TCAGAGCTGGCAGCCACAGCAGCTCAGCCCAGGAGGAGGAGGTAAGCATTGATCTGGGCA
ATGACCCTGTGGTAGAATGAATAAACAGCTGGTTTTGTTAAAATTGATTTGAAGAAAAGG
ATATCATATGATGAAATCACCCAAAATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGA
GCCTATGGTTTTCTGAAGATATCTTTTGTCCTGTGAGTGGCTGTTGGTTAGAGCAGAAAG
TGAAATTGAAATTTAGTTTCTTTGCAGGCTGTGTCCCCAGAGGATGGATGTCAGTCTGAA
GTGAAGGACCAGTGGCTGTTATCAACTTGGATTCTGAAAACCTAACTGGCTTCAACAACA
TTGGTGTAGAAACATACTTGCCTTGTGTAAGCAAGGACATTCTCAAGCCAAGCAATGTAT
TGGGCAACTTTTTTCTAGAACAGGCACATTTGGTATCATTAAGTTTTCTAGCACTGTCCT
TTGCTAGCCTGCCCAGTAGGAGCTTCTATACCTTTTTAACAAACATACTTGGCCAGGCAT
GGTGGCTCACGCTTGTAATCCTAGCACTCTGGGAGCTGAGGCAGAGTTCGAATCCAGCCT
GAGCAAGAGCGAGACCCCATCTCTACTAAAAAATAGAAAGAACTTTAGCTGAACAACTAA
AAAAAAATTACATATATATATATATACACACACACACACATACACATATATTGGCCAGGC
ATGGTGGCATATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGATCGTTTGAGCC
CAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGATGCCATGGTACTCTAGCCCGGGCAACAG
AGTGAGACTGTCTCAAAAAAAACCCAAAATACTAATTGGTTGTTATATTGGGGGGCAAGT
TCTTTAAGATGAAAATTGTTAATTCCTCCTGAAAGTAATGTTTTCATTCATTTACCATGA
ACTAATACTATAATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1006..1032, 1035..1055, 1058..1096, 1099..1116, 1119..1121, 1124..1136, 1138..1156, 1159..1186, 1190..1232, 1234..1244, 1248..1256, 1497..1537, 3253..3321, 4648..4654
1001..1003, 1006..1032, 1035..1055, 1058..1096, 1099..1116, 1119..1121, 1124..1136, 1138..1156, 1159..1186, 1190..1232, 1234..1244, 1248..1256, 1497..1537, 3253..3321, 4648..4651
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved