Microcebus_murinus Locus MPZ
snOPY snoRNA Orthological Gene Database
Microcebus_murinus MPZ
Microcebus_murinus
MPZ
GeneScaffold_2879
SNORA64
3147..3277
6026
TTCTAATTGCTCCCACCTCCACCTCCTGAAACTGGATTTTTTGTTAAGACAGAATCTCA
CTCTGTTGTCCTAGGTAGAGTACAGTGGCACAACCATAAATCACTGCAACCTCAAACTCC
CAGCCTCAAGCAATCCTCCTGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCC
ACCATGCCCAGCCTCCAAACTAGATTTTTAAACTCCTTATAGGAGGGACTTAATTTTTAT
TCCTCCTTCTATTACCTACATTCTCATACTTTACATATAGCTGGCACTCAATATAATTTT
ATCACCTTGCTCTAAATTAAAATGGACTTAAAACTGAAGCACAACACATTGAAGGAGTTC
CTGGCAAAGAGGGAAAGGTCAGGGGCTTCTTCCCTGGAAATATTCCAGTGAAGAAAAGCT
TCTATCTGGGAATAATCACCCAGGATGCAGGAAGATAGAGGAGGAAAAAAGACTCTCAAA
GGACCTGGTCATCTCAAGAAGTCTATAATGCAGCCCATGGTAGTCAAGATAACAAGGGAT
ATCCTATTTTTAGCATTCTCTAGGGGAAACCTGCCTCTAGTTCCTAGAGCTCTGAGGTAG
CTGCTCTCAGGCAAGAAGACTAAGGAGGAATCCCTTTTTATGGCTTTTGGAATGAGGTTT
CCTGCCTATCTATCCCTCAGAGAAGTGTGTCCGTGTCCCTTTTTCTGTCCCTCTCTCTCA
CCACCCCCCCAACATTCCACTGGGGCAGAGGGAGGCCAGTAGACACAAAGCCCTCTGTGT
ATGGGGTGGTATGTGTCCCCCACCCCTCTATCCAGACTATACAATGCCCCTTCTGCTCCC
TGCTCTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTCC
TGGCTCAGGACAGCCCCCTCATGCTGAGGAACCAGGGGATTTTAAGCAGGTTCCAGGAAC
CCCCGCTCAGTTCCTGGTCCCCCACTCTCTCAACCCCACAGACGCTCTGGGCCCCTGCCC
CTGCCCCAGCCATGGCTCCTGGGGCTCCCTCATCCAGCCCCAGCCCTATCCTGGCTGTGC
TGCTCTTCTCTTCTTTGGGTAAGTGGAGCCACCCCAGTCTGTGAGCCTTGGGACTCAGGT
TGTCTCTCAGCAACCTCCCCCTGCCTTCACTGAACTATCAAAGAGTAAGCAGGAGAAGGA
AGGTGACGTTATATTCAGAGAGAAAAAAAAAATGCATGTTTGGAAGGAGGCAGTAAAGGT
ATTCTGTAAAAGAAATGTTAAGAGAAAATGTGCAGAGAGCTTCCCTGTGTGGGCATGGCT
GGACCCAGGCTGGAAATCAGTAACATGCCCCCAGAGCCATGCTAAGAGTCTGGGAGGAAG
CAGTGTTCGAGCATGAGAAGGAGCAGGTCAATCACCTGGGTTCTGGTCCCCATTCATCAC
CTGGTAGTACAAGAGGAACCTAACCTCAGTTTCCCAGAAGAGAGAAGTCAGACAATGTGA
TCTAAGGAGGGAGCCTAAGGTTTGTGATCTTAGCTCCTCTGATACTTTGACTCTTAGTGC
CTCAGTTTCTCTCTGTGGCTCCTTGTCTATTATGTGGGTGAACAGAGTAGAAGGGAAGTT
CTATGAGGTACTAAGATCTTATCCTTCTAAAGTTATCTTTCTTCGCAAGTTGACCAACCC
TTTCCTTGCCCCCTGGCAGATGGTGGGTGAGCAAGAGAAGGTCAAAACAAGGTAATTCGA
ATGGATCCTTCCTTCTCTGAACTGCCCTGAAGCCTAGCACAATCAGTGAGCAGTGTTGGC
AAGCTGGGGTGGGGGTGGGGGACAGTGAGGGAAGAGGAGCTGGTGAGAATGCCCAAGGTT
CTCTGCTGTCAGCTCCTTGAGTCCTAGACTCTTCTGAGCTGTACTGGACTCTTCTAGGGT
ACCCTGGGAAAATGTTAAGGACAGGGAATTGGAAAAAGGCATGGTAAGAGAAATGGGGAG
AAGAAATCTTGGAGCATAAAGGGGAGGGAAAGTTCTGTCTCAACACCTGTACCATTCATA
GAACCATTGAGCGAAGCTGAGAAGGGCAATGGCTGATGTTATAATAAGAGGAATAGAAGT
TAAATCCAGTGAATAACCTCCTTAGTTACATTGGGGATTCCCAAGAAGGCTCTAAGACAG
AATTCCCAGGAGGTGAGTAAATGATATTGCATGCTGAGGTGGGAAATTCAGGACAATGGG
GGTGGGGGTGGCATAAGCCCCCCAACATTGGTCTGACAATAGGACTTTGTTTGTTTGGTG
GCCTCCTCCTCCTCCTATAGAACAAAAGGGTCTACAGTTGCCCTACCCAGGGCCAGCCCC
CACACACAGTCTTTTTGGAATGACCTTCCTTGTGTGGGTGAGTCCTGAGGGCGGCATTGG
GCCAGACGGCCAAAAGGAGGGTAAGGACTGTTAAGCCACAGAAGACTCACACGCAGAATT
CTGGGCATAGGGTCTTGCTCTGCACCCAGCTGAGAGGGGTAAATAAGGTCCTTTCCTCCC
TGTCACCCCAGTCAAGAGCAAGCTGTGTGGCAACCAGGGATTCAGCAGCAAAGACAGTTG
TGCCAGGGAAGAAGATTTACACTTTCTAGTTAGCTTCATTTTTTTCTGCAAAAAATTTGG
GTTTGCTGTAGTGTGAAATATTACGCAGCTGTTAAAATTAAGATTGATGTCTATATATCA
ACATGGAAAGCTCTCTCAGATATATATATTCTTAAGCAAAAAAAAAAGTAGAATATAATG
CAATGTGTATGTAAAAATAGAAAGCTCCACAAAATAAAACTATTTGTTATAAGTACATGT
ATATCTTGAATTTATTGAGTTTATATTGAGTTTGATTCTTAGGAAAAGCATACATATTAA
ACTGATAACAGTGGTTATATCTGGGAAGGAACTGACTATAGGAAAGGAATTGGTTAGGTG
GGTGTTAAGGGAGACTTTAGCTTTATTTCTATTGCTTGAATAGTTTATGAAAAGAATGCA
GTATGTATTACCTGTATGATTTATAATAAATTTTAAAAAATTAAAACTCTGTATCTAAAG
GATAGCTTAAGAGTTAGATACCGACCCAAAGGGAAAGTGAAACTTGATAACAAAATTCAA
CTTCTAGAAGTCCTCTGGAGAATGCTTTCTCTCTCTACTCTGCAAAGTTACATTCAGCTT
CACCTGCATGACTTTCATGATAAGAGACAGAAAAGATCTCCTGGGGACCTCAGATTGGCC
TTATAGTGGTTTCTCTTTCCTTGAGGGGTACCACAGGTCCTGGGAGAAAAAAAGAAAGAA
TTCTGTTCCTGATGATTTCATTTCCTCTACAGCCATGCCAAAGAGCTTGAACAGACACAG
CATTAATGTGCATCTATTCAGTGCAGAGAACTATTTGGGCCTCAGAATTTATTGTTTCTT
TCCTAATCTTTGCTATGGCCTCTGACCTATGACTCAGCCTTTGATTTCCTATTGATGTCA
CTCCCTCTATAGCCCTTACTGGGCCCACATATGTATCTGATTCTCCCTCTGTGCTTGCAG
TGCTGTCCCCCGCCCAGGCCATTGTGGTTTACACGGACAGGGAGGTCCATGGTGCTGTGG
GCTCCCGGGTGACCCTGCACTGCTCCTTCTGGTCCAGTGAGTGGGTCTCAGATGACATCT
CCTTCACCTGGCGCTACCAGCCTGAAGGGGGCCGAGATGCCATTTCGGTGAGTGTCTGTG
GGAATCCTGGGGTTGGATAACAGAAAGGGTTCTTCAAAGAACAACAGAAAAGAGAACTTG
GGCTGAGGAGGAGAATGTCCTTTATGAGCCACAACTCCAACTTTGGCAAGGTAAGTGGCA
AGCTTTGTCACTCTGACTAGGGCCTGTGTGCATTGTCTTCCCTCCCCCACAACTACCCTC
TTCATGCCAAGATCCCTTACTGCGAGCCTGGAGCTAAGCTTTGACAGCCCTGTTCTCACT
GGGGTTCTTTCACATGCTTCCTCTTGCTCCTCACAGATCTTCCACTATGCCAAGGGACAA
CCCTACATCGATGAGGTGGGGACCTTCAAAGAGCGTATCCAGTGGGTAGGGGACCCTCGC
TGGAAGGATGGTTCCATTGTCATACACAACCTAGACTACAGTGACAATGGCACTTTCACT
TGTGACGTCAAAAACCCTCCAGACATAGTGGGCAAGACTTCTCAGGTCACACTCTACGTC
TTTGAAAAAGGTGTGAAGGGACAGGGGTCTGGGAGGCAGTTCAGAGAGGGGACGTGGGAG
GCTCGATAGGCGGGAGGAAAGAGGCGAAAAGCCCAGCCTAATGACCTTGGCTCTAGGAGG
GTGGGCAGAAGGCAGCCTTAGCTGAGAGTCCTACATCCTCAACCGCAGGGAACAGGTGTG
GGACTATAAATCAGAGATACAGGTCCCTGCTCATCCGCCCACTTCTTTTCCCTCCCCTCC
TAGTGCCAACTAGGTACGGGGTGGTGCTGGGAGCCGTGATCGGGGGTGTCCTCGGGGTGG
TGCTGCTGGCGCTGCTGCTTTTCTACCTGGTTCGGTACTGCTGGCTGCGCAGGCAGGCGG
CCCTGCAGAGGAGGCTCAGGTAAGGGGCGGGGCCTGACTCCCCTCCCGCTAACCCGCCAC
CCCCATCTGGGCGGAGGGTGCTTCAGAGAGTGCAAGGCCCAAAGGGAAGAAGCAGCTGTG
TCCGCTGTGCAGGGGGTTCTGGAGCAGCCAAACCCACAGCGCCCCCTTTTTCCGCAGTGC
CATGGAGAAGGGGAAATTGCACAAGACTGGAAAGGATACTAAGCGCGGGCGGCAGGTGAG
CGGCACTCGGGGCCGGATGAGCTGGGGCGGAGAACCCTGGGGGCCGCGGGGCAGCTGTGA
GGGGTGGGATGCAGACGGTCACGCCCCACCAGATCGGTGACTGATGTGCGCACCCCTGCC
CCCAGACGCCCGTGCTGTATGCCATGCTGGACCACACCAGAAGCGCCAAAACCGCCAGTG
AGAAGAAGGCCAAGGGCCTGGGGGAGTCTCGCAAGGATAAGAAATAGCGGTTAGCGGGCC
GGGCGGGGGATCGGGGGTTAGGGGCGGAGTCCGCCAAAGGCTCTAAGGTGGTGGTCATCG
AGATGGAACTACGAAAGGACGAGCAGAGCTCGGAGCTCCGGCCAGCTGTCAAGTCCCCCA
GCAGAACCAGCCTCAAAAACGCCCTCAAGAACATGATAGGCCTGGACTCGGACAAGTGAT
CACCACCCACCAGGCCCTGCTGGAGCAGGGAGACCTAGGCTCCTCTTATTCCCGTCTAGG
TGCTTTCCTCTCTTGCTCCCCCCGCCCCGCCCTGCCCTGCCCTCACTTCCCTTTGAGATG
TAAGTTTCATTCCAGAATTCATTCCCTAGGCGCTTGTATTCTCCGCCACCTCCACCCCTT
GGCTTTCTGGGAGCCCAGGGGCTGATCCCACCCCTCATCTGCCCCAAGGGCTGTGTGTTT
GGTGCCTGTCCCTCAGGCACTGAGAAGAAAGGGACCTTGATACCCTCTGCCTCAACTTCA
GGCCACCTGGCATTCCCATCCCCTGCACCCCTTAGCCTGTCCCTCTGGTTCTTTCTACTT
CTGTCCCCCCTCCTCCTTCCCCTCTATCAGGTGGCTCAGCTTCATACTCTATCCTCCCAG
CTAACTCCCAGATCACCCAGATCACACTCTCCTTCAGGGTTTGTTTAGGTTGTTGATTAT
TTTTTATTTTTAATCCATGCTTTGTTTGTTTGTTTGTTTACCTGTGCCCATGCTCTGTCC
TTACTCCCATGACTGAGGACCAATGACGTCATGTGGCTTTTGCAATTCCTCACCCCTGTT
AAGTCCTTAGTGGAGAGCCAGCCCAAGCAGAGGGGCCTGATTCTCAAACCCTGGCTATAG
CATTGGTGCCCCCTGACTGCTTTGGAGCACTGTTCTGGGACTCAAGGTCTTGGGGAAGGA
TAGAGAGAGAGATCAGGATCCTCACAGGTCAGGCGGTGAAGAGGGGGCAAAGGAGCCTTA
AGAAATGATGTTTAAACAACCAAACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 3540..3706, 3996..4209, 4443..4578, 4737..4794, 4925..5026
1001..1097, 3540..3706, 3996..4209, 4443..4578, 4737..4794, 4925..5023
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved