Microcebus_murinus Locus RWDD4A
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RWDD4A
Microcebus_murinus
RWDD4A
GeneScaffold_3980
SNORA77
5099..5221
12079
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAAGAGCTAGCTCTCTC
ACTCGCCGGTCTCGTCCTAGCCACATTAGGGCTCCCGGACTCACCAGGCCCCACGCCCCC
AGGCCACTGCAGCTGTGCCCGGTCGCCGCCAGTCCGACAGGACAAAGGGAGGCACACTGA
GATGGCCAGAGACGCCGGAGCCCGTCACTGAAAACACAACCCCACAGCCGGCTCCAGCAG
GATTGACTTCCCTGTTCCCACCTCCACTGACACAGGAAGTACTTTCTGGGCCTGAGTGAC
ATAGCTCTACACCAATCGCTGTCCCGGAACGTTACGCCTCTCCTCGACCCGTAAGGAAGG
AGCTCCATTTCCTAGAGGAGAAAGAGTTGGGGGCGGGGAAACAAGAAGCCAATAGGAGAA
GCTTGATGGAGGAGGGGGTGGAGCTTCTGCCATTACCACCCTGCAGGCTCTCCCGAAACC
CCCGGGCGCCCCACCTGCCGCGGCTTCTGGTTCTGGGCCCGCAGCCCACCACCGGCGGCT
GGGCGCTGCGAGGGCCGGGGCGCCCGGGACTTGCGTCTGTGGGTGTTGCCCCCGCAGCCG
AGGCGCGGAAGGGGGACGCCCCGGCCTCGGGGCCACTGCCCTCGCTCTGTCTGCATTGTC
GCGAACGCCGTCCGCCTGGGAGGCGCCCTGCGACCGGCGCGATGAGTGCCAACGAGGACC
AGGAGGTGAGACCCCGGGCTGAGCGCCCCCTTCCCGGCGCGGGCCCCAGCCCTGAGGGAG
GGCGGCTGAGTAGCCGACCCCGGGATAAGACCTTGTGTCGGGACTAGCGGCCCGGCACGT
GCCCTTCGCCCCTGGAGCCCTCGGAGCCTGGAGGGGTGCCCCAAGGTGACCAGCGCCTCG
CGGGGAGGCGCCAAACATGCGAGAACGGGTAGGGGGTCTGCCTCTGTCTCCCCACCCCCG
GAATTTTCCATTTTTACAAACTCGGGAGTCTCCCTATGTTTCCTTAATAACGAGGTGAGC
GTCCTTGGTAGACGTCCCGGGTGCGTGAGGCTCTCCTATATCCCGCGTGTTTGTTTAGCG
CTGTGTGCTGAGTTATGCTGATTTGGAATCCGAGCACCTTTAAATTTTAAAGTCTGTTGA
CTAGTGGAGAGAGTATTAATTGACAGTTAAATTTCTTGTGGAAGAAAATGACGCTGGTGT
CTCTGGTTTCAGTCCATATTGTTTGGTGAAATCATTTATCCATCTGTTAGTTGTCCAGTG
GACACGAAATCCTTTTTGAGCATACGTGTACCACCTGAATTGTGTGATTTATGCTCAGAT
ATTTACTTGGGAAATGCCATTTTGCCATTGAATCACGAGTTGGAGAGGATGCTACAGGTC
ATCTCTAGGGGATCTTCTACTTTGTTATGAGTATAGATGAGAAAGGTCTACAGAGTAAAG
TGATGCCCAGGGTGCCCAGTGATATGTGATAGAATCAGGACTGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTACAGTGTAATGCTTGTCTAAGTTTGACCCATGGAAACACTCACCTTA
GAACCATTTCGGTAGTTGTTAGAAAAACAGTTGCCTGCATGCCACCTCAGACCTACTGAA
TCAAATTTCTGTGGTGGGGCCCATGAATTGCCATTTTAACAAGAAAATTCCATTCTTCTC
TACCACATGATATTCAGCTCTTTGAAGACAGTTTCCTGCCCAGTTGTTTAGAACTCTTCT
CAGATGAAATGGTTCCTTTTAGCTTTTCCTCATATATCCATTCATTTTAGTTCCTTCACT
ATCCTGAAATTATGTGTCTAGACAAAGTTCTGGCATCACATTGTTTTGTACAGATTTACT
GTCAAGTGAAACTCTTTTAAGTATTTTATACAAAGTCTTTAATCCTCTGCTTGTATATTT
AGGTATTTAAGTACAAGTTCTATTTGCCATGGTAAGTCTTATCATTAGCTTGTTTTTTGA
GGACTTTTTGGATTCTTATTCTGCCACCAGCATTATTCACTATCCCATTAGGTTATCCAC
AAATGTAATAAACCTGCCCTCTATTTTTGTTCCTGTCCATGTCATTAATTAAATTATGAG
AAAGAGGCCAGGCGCAGTGGCTCATGCCTGTAATCCTAGCACTTTGGGAGGCTGAGGCGG
AGGACTTGCTTGAGGGCAGGAGTTTGAGACCAGCCTGAGCAAGAGCAAGACCCCCATCTC
TACAAAAAAAATAGAAAAAGTTAGCCAGGTGTGGTAGCTCATGCTCATGGTCCCAGCTAC
TCTGGAGCCTGAGACAAGAGGAACCCTTGAGTGCAGGAGTTTGAAGCTGCAGTGAGCTAT
GATGACACCACTGTGCTCCAGTCTGGGTGACAGAGCAAGACCCTGTCTCAAAAAATAAAA
AGGAAGGATTAAGGACAGAAGGAGTGCATAATATTTTGAGTAAAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAACTTCTTGTTTGTAACACCACAATGTTCTAAGAA
ATATTTGCAGGCAAGGATTACTGGTTACATTTTTCCATGCAGACCTTTCTCAGGTCTTCA
GTAGGTCCTTGTCATCCTTTTTCTCTGGAGTTGCTTTAAACTGAATCTCATTTTCCACCC
CGGTAGGTAGGAGAAAATATGGTCTTCTTGATAGGATTGATTTGATAATTAAATAAGATA
ATAAAATGTAAAATACTTAGCAGTGTCTGGCATATAGTTTTTTTTTTTTTGAGACAGAGT
CTCGCTTTCTTGCCCAGGCTAGAGTGAGTGCCGTGGTGTCAGCCTCGCTCACAGCAACCT
CAGACTCCTGGGCTCAAGCAATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGG
CACGAGCCACCATGCCCGGCTGATTTTTTATATTATATATATTAGTTGGCCAATTAATTT
CTTTCTATTTTTATGGTAGAGACGGGGTCTCGCTCAGGCTGGTTTTGAACTCCTGACCTT
GAGCAATCCGCCCGCCTCGGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCGCGC
CCGGCCTGGCATATAGTTTTAAAATAAGTATTATTAAATAGTAGTACTATTGTGATATGT
TGGTACATGCACATGTATTCTTAATATAAGTATCTAAGGCCATATAAGTTAGTCAGGTTT
TGCATAGTTGAGTAGGCTTGAAGGGAAAGTAAAAACTCTCTATTTGTAATTCATTTATAC
CACTAAATGAAACTCATTTGGTCATTTTCTTTCAGATGGAACTAGAAGCATTACGTTCTA
TTTATGAAGGAGACGAAAGTTTCCGGGAATTAAGTCCAGTTTCATTTCAATATAGGGTAA
GACGGCATGAATAGGAGCACTCGCTACCATGCTAGAAAGGACTACAGGTTGCTAAAAATG
CTTATTTTCTTTTTTAAACTTCGTTGTTTAAATTTATTATGTCTTTGTATTTTCTGAAGC
ATTTAAATGGAAACATTCCCCTGCCATCAATCATTTTTAACATGTGAAAACTTAATTCAG
AAACTTTTGAAAAACAAAGATAAGCTTGTTCTTATTGTAACAGAATTGTAAAATATTAGA
AATGGAAGAAATCCTAAAATTTGTGTAATTTTATCTTTAAAGGTAACTTAACTTCTCGGT
CATCGTTTCCTAAGCTTCCATAGTTGATATTGATAAATATTAGGATTAAAATCCAGATAT
TCCAAACCTAGTATTCTTCTTACTTTTCCTATGATATGGTCAAGAAAAGTTGGTCTTTTC
TTAATTCTGTATTCTAAATATGTGTGGACATTTTTTAGGTATGTGAAACATAGATTTTTC
TTTAAAATGGGAGTTACTCATAACTTGGTCTTTAAGATAAAACAGTACTAGTATTTTGTT
TTGTAAATAAATAATATAAACCATCTATTCAAATAATTACAAATATTAGTGGAATTAGAA
AGTTCCTTTTGTGAAAGATTTGCAGTTATTAATGTTGTCACCATTTAAATAAATTGTTCG
CAGTCTCACTCTGCACCCAGCGGCAGCCCCAGGCGGTGCTTTTTCCGTCTGTCAGAGAAA
TATTCCCAGTTCTGTGGCTGCCTCACCTGTCAAGGGCGATGCCACTGCCTGGGGACTTGG
GGAAAAGATAATAAGATAAGATAATAAAAAATATAAAATAAATATAAAAAGTAAAATAAA
AATCCCAACATGTGGTTTATTATAGACTGTCACAAGAAATAAATTCTTTATAATCACTTC
CTTTGGATACTCTCCTCCCTGCTCAGCTTTTCTCAGTTCTGTTTCAAGTGTAACAATCCT
GACACTATCACCTTGTATATAATAGCCAGGGGATTTTTTAGGGCCAAAATTATGATGGAG
TTAAGTTCTAGACCCTTCTATTTGAATCCAACTGCCACCCCAGACTTGCCCTGCCCTGCC
ACACTCTTCATTAGCAATAGGGAGATTGAGAATTCAGTATACTTTCCTAATTGTCTGTGT
TACCAACAGCAGTTATTTATTGCGCGCAATATGCAGAATACTCTGGACGTGTATGTGTGC
TGTACCGTGAACACTCTGATGTGACCCATAGGATGGATTTAAGAGGAATGAGACATGAAA
GTAGGAGACAGTGTGTTCGCAGTCACAGGACTTGGGGTAGAGTTCTGCCTGTGTTCCAAG
TCAGACCCCTCAGTTCTCATATAAAATAGTTTAGTAACCTCCCAAAGGACTTTCCTGGTT
TACTTCTTTCTTTAGCTTCCTCCTTACACTCCACCATTAGTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTG
TTCCTAAATGCACATGAGTAGAGACCTAGTGATTGCATAAGGCAAGTAACTTTATCACTT
TTTAATTACCTCCTATATTTAAAACACAAGCATAAGCCAGTTAGATCCATTATGCAGGTA
ATCAACTTACCTAAGTATATAAACAGATCCCTAAGTTTATTCGATATGATTTCTGAGCCT
TGCCTCATATTGGTAAGAGTGCGATTGAGGGTGAAAGGATGGGGACGAAAAGTCAGTGGT
CAGAAAATAAAGGTGAATCAAGTAATAATTTTGGGGAAAATTTTTTAATCTTACTGCTGT
TTAAAAACGTATTTTTAAAGTAGTATGATACTAAAAATAGTACTGTAGAGATTAGCCTAA
GCCAGAGCAAGGATGAGATGCTAATTTATAAAGCATTCCATAGTTTTATTATAAAATCAT
CATTTTGCAACCACCACTATAATAATTGGTTCAGTCAAGGACTATTAATGAATGCTAAAA
TTTTTAGATGAAGGGTTGTTGAGAAACAAAGTATTCACATAATTTTGTAGTGTTACTTCT
TAATTATAAAATGAAAAGGTTGACATTGAAGAGATCTGGGGCATATCACCTTAACCAAGT
GATCAAGCTTAGTGCCACCAGTGATGATTCTAGAAGATCTTGTCTGCCTCCTTATATGAT
GCCATGAGAATGGCCCACATCACCTGTTCAGTTTCCTAACCAAAAATGTTTAATTTGAAT
CTGAACATAGGAAACAATCTGTCTACATCTGAGGACTTTATTAGGTAAACTGGGCTGGAT
TTATTTTGTCACAAAAGATATTTAAAAAGCAGGGGAGAAGACTGGGGACTGTTCTTTTAT
AAATTAAAGCAGAAAAAGAGTCATGACAACTAAATGCAATCCATAATCCTTGAATGGATC
ATGGATTTGCGGGGTTGGCGGTGATGTCTGTTAAAGGACACTTCAGGTACAATTGATGAA
TTTTTAGTATGGTTTATGTATCAGGTAATATTTTTGTATCAATGTTGAATTTCTTGAGGG
TGATAATGGTCTTGTGGTTATAAAGGAGAATGTCCTTTTCTTAGGATGCTTTATCCATAA
ATATATTAAGATACATGAAATAATTTCATTACTTTCAAATGGTTCAACAAAAAACAAAGG
AAAAAAATTACATCAAGGGAGTGTGGGTGGATTCTCTGGTGAAGAGGGGGAAAGATAAGT
AAATGGGGCAAAAGGTATTTGGTGACTCAGGTAAGTGTCAATGTGTGTTCATTTTACTAT
GTCAGTTTTTCTTTAAGATTAAAATTTTTTTAAGTAAAAAATTGGGGTAACAAAAGAAAC
ACAAGATATCTTTAACTTATTCAGGAATTGCTGTTCAGCTGAAGGCATTCCTTTTCCTTA
TCAGTTGTCTTTCCCTTTTTTCTGTCAGTTTTACATTTCATTTTCTGGTCTCTTGGGATT
GTGCCTCTTGTAATTTAGCAGTTGGATAACTTAGAATAAAGATGAGGTATTTCAAGTTTG
TGGATTATTTTTGTCTATTTGCTTCCTGTTTCCCACAGTTAATGTCTTATGTTCATTCTA
AGAACACTGGGGAAAACACACAAAAAAATATAAGACATAGACTTGGTACTAGAAAAGCTC
GTGGGCTGGTTGGAGAGACAGGCGGTGGGCTTAAACTAAATCTGTTAAAACAGACTAGGA
TTAAATTAAAACTCAGACTCTTTTTATACTCCCCTCATCCCCTCTCAGTGTTAGCCTGTA
CCCCTGGACTTTTCAAAATATTATGTTTCTGATCTGAACATGAATATTGCAAAGAATTCA
TTCTTTTGAAGATCATATTTACTTCTCTGTCTTTTTATCACCTTTCACAAGCCTAAGATT
TCCCCTTTTCTTCAGATAGGTGAAAATGGTGATCCCAAAGCCTTCTTAATAGAGATTTCC
TGGACAGAAACATATCCCCAAACACCTCCGATTATATCTATGAACGCATTTTTTAACAAC
ACCATGTGAGTAGTGTTTTGTTTTCATTGTTTTTTTACTATACTCTCTATTTTACTTTTC
TCTTAGCAATATATTTGTTGTGCATTGTAGATCATCAGCTGTAAAGCAGAGTATATTAGC
CAAGCTGCAGGAGGCAGTAGAAGTTAATCTGGAANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAGAAAAAATTGTTTATTCATAGAATATTGTTAGGAATATTCATCT
TTGCGACGTCAGGCATTATGTATAAGATCCCCTTAGCACCACATTATGCACTAAAAGACT
TTCAGTGGTCAGTATTAGTTTAGTTTTGTCTTGTGACCAAAGAATAAGCTTTTTGGCAGC
AAAGGCCTTGTCTTCTATTTGAGTGCTTCTGGCTTTCACATTCCCAAGAGGACACAGAAG
AACCCAGAGAGGCAACTGGAGGTGGTAGCTAAGATCTTGGATTGTGGGCCAGACTGCCTG
GGTTCAAATCCTCCCTGCACCACTTACTATGCTACTTTGGGCAAATTTCTTAATCTCTCT
GTGCTCAGTTTCTCATCTGTAAAATCTACCTCATAAGATTTTGGTAAGGATAAAGTGAGT
GATACATGTAAAACATTTGCAGCAGTGCTTTGGCATAGTTTTAAGCATTTAAAATTTTAA
TTTTCATAATCCCTGTCTACACAAACCCAAATGTTTTAAAAATAGTCTCAGGGACCCAGA
ATGTTCTAGGTAGGTCTATGTGATTTTTCTAAAGACATGTTTAAATTTCCAAATAATAGC
AAGTTAACTGAATTGTAAAACTACCTTGGAACCTCAGATCTTCAACATAATGCTAGTAAT
GAGATCTCCCTCCCCAGGGTTTTGGTTGTATCAAAGGCACTAATAATATATCCTTCGATG
TGAACTTTTACAAGAGTGGAACCAATATTGTATTATGGGCACCTGATTTAATAAATGAGT
GATAATAATATAGGATTCTTTGATAAGTCTAAAAATGAGCCATTTCAGGACATTGCTAGA
ACATATCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACATATTTA
GTGTTATTTAGTAAGTTTTAAGGCATGAGTCTAAGAATATTTTTTTTTATATAGACATCA
ATGAGCAATATGATCTCAGTTGAAACTCCTAATACAGCCTCATCAAGTAAGAAAAAAGAC
AAAAAAGAACAACTTTCAAAAGCCCAGAAACGTAAGCTGGCAGATAAAACAGGTTTGTAT
TATTTTTTTTTCTTTTACAACCCAGATAAATGGAGGATTTTTAAATAGTATTTATGAAAC
TGTTCTTTAAATTTAAGTATTCCACTAAAAGACTGAAAGCACTTGGCAAACTATGAATTC
TTATATAAATTCGTATGAGCTTGTTTTCTAGCTCTCCCAACAGATGAAAACCCTTTTTAA
GGAATGTTAGATTAAATAATGAATATTTCATCAGGGTACAGCAATTAATATATAAGTTAG
CGAGGTCTCCTCTTAGTCTTGAAATCAAGCCAAACTCCTCTTTATAAGGCTTAGCTTCCT
GATGTGAAACACTAACTCATGAAACAGTGAACTAACACAGCTTCTTACTTGAATAAGCAG
TGACCTTATATAAAATAGTAGAATTGTGCAAATGCCTGAAACTAATAAATTGATTAGCTC
CTATTCCTGGCATTAGCAACCCACCTCCATATTTTTTTCTTGATATCAGGTTTTGTCCTG
AATGGAAATACCGTAAATGTAAAAAGGGAATATACCTAAAATACATTGCAAGTGTCCCCA
GGTTAGAGTGGTGCTTTCAGTTCACAATGGTGATAGATAAACTATTTTTCCAACTTAATG
ATATGTGATTTAAATTTTTAATTTATTTGTTATATANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGACATAACTAATTTTAAATTAATTTTAAACTAGCTGATTGGTC
TTAGAAATAAAGTTGCTAATTTTTATCCTATAGACCACAAAGGGGAACTTCCTCGAGGTT
GGAACTGGGTTGATGTTGTAAAGGTATGTAATATTTATATTTTAGTCTTTAAAATTATTA
TAATTATTACCATCAAATAATGAAATGTGTATTTTCTGCTTTCCCCCTCACAACCTGTGG
AATTTCCTGGGATTTCCCTTACCTTTGTTACATTCAGCATGTAAGTATTTTTGAAATATC
CTTCACATTCTTCTCTCTTAGGTTTCTTTATTTAAAAATAAAAGAAAATCTGCAGAAGTT
ATAACTACCATATAGTATGACTCTTTATGTAAGTACATCTTAAGAATGCACATGCTTAAA
TATGGCTCTAAATTATCAATAATATGGAAACTGAAAAAACCAGACATAGAAAGGAATGCT
TAATTTCTTAAAAGTTTTTGTGGTTTTGTTTTGTTTTGTTTAGGACAGATCTTAAATGTA
GTCCATTCTTGCCAAAAAAGATTTTCCATTTTGGTTTAAAATTGTTTACTTTCCATTTGG
GATTTTTTTTCCTACTTCTCTCAGTTTTTTTCTTGCATTAGCTGTAGTTTCAAAACTGAT
GAATAACACAGTAAAGTCTCTTTGTAGGACTTCACGAAATAAGTTTTGTGTGCCAGTTAG
TGCCACAACTGCTATGAGAAGTGTTTATTAATAATATGATCCAAGGGTAGTTAAAGATTA
GGATCTTAATGGAGACCCACAAATATGAGCAATTTACAGAGTATTCTGAAAGTTTATTTT
AAAGTCAGCTGTCGGATCCATGGAATGCATTTTCTATAGAAACTCTTTAAAATAATCTTT
GTGCCTCTAGAACCTAGTACAAAAATATTTCCTGAGCATAGGAAGCCATGAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 4355..4435, 8595..8704, 8790..8937, 9954..10071, 10893..10942, 11077..11079
1001..1024, 4355..4435, 8595..8704, 8790..8937, 9954..10071, 10893..10942, 11077..11079
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved