Microcebus_murinus Locus RPL4
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPL4
Microcebus_murinus
RPL4
GeneScaffold_869
SNORD18, SNORD16, SNORD18, SNORD18
1221..1292, 1681..1779, 2181..2252, 2947..3016
5167
CAGTTTCGGGCCTTGCATCTTCATATGCTGTTTAGTAGGGTATATATCCGTCTTTTACA
AGAGAGATTTTTTTAAGAGAAAAGACAAACTATTGTGTTTCTACTTTTTCCTAAATGCTT
GTGTCCAGCTTAAAAATCATCTCTGCAAAAGCTATCTGGTTCTTTTCGGTGTCATGTAAA
TCTTCAGCCAGCTCACACAGTATGAATGATGATACATGTACAAGTGATGTCTGTATATGT
GCTATGTTGTGTGCCGGGGGAGTTCAATGAACAAAATAAGACAAAACTATCTTTACGATA
TTTGGATCACAGTGGAGTTGGAATAAATGAACAGCAATATTATATGGTAATAAATGCTGT
GGATAATCGAAAATTGGAATGGTTTGGTCTTAAACAGAAAGCTTAGAAAGTGCCTGAAAG
TGAGGAATTGTGGGAAGAGGAGCTTTGAGGTGAAAACTTGCTGTACCTCTGAGTCAGGGG
GGGATGGGGCTGAGTGTAGGGAAAAGGAAGATGAGATCAGAGAGGTAGAGCAGATTGTGT
AGGCCATCCTCAGGACTTTGGCTTTACTTTCAGGTGGGAAGTCTTTTAGAGAGGGCTAAT
CAAAAACCATAGTGTTTTTACTAGTGAGTATTGGGAGAGGCAGTTAGAAGATGCGGAGGA
AAAGGATGCAAGTTTGGACGCATACAGCCCTGGTAGACAACATCTGCAGACCATTTGGTG
AACATTTAGACAGTGGCATTAAATAGCAGTTTTCAAACCCTTATGTTGTGGTTTTGATTG
AATATTGTGCTTTATTAGGATTAGTTTGGAAGTTTCATGATGAACTTTTTCGTTGAAAAT
TGTGTAGCAGAACCTGAAATGCTGAGTGTCCTTTGAGTGTAAGATGTTTTGACTTTGAGT
AGTCTGCCCCCACCATAGTAGTCTCTCTTATAACCGAGCACTTAATGGTATTGTCCACAG
ATGAGAGGAGTTTGTTTCTAACTTTATCCTTTTTTTCCAAGGCTTGTGCTCGTCCACTGA
TATCGGTGTACTCCGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCAGTCT
TCAAGGCTCCCATTCGACCAGATATTGTGAACTTCGTTCACACCAACTTGCGCAAAAACA
ACAGGCAGCCCTATGCTGTCAGTGAATTAGCAGGTATGGATTTATGTCTTCCTACAGTTG
GTATTTTAGGGGGCTGCTTTACAGTAGTGATGAAATTCCACTTCATTGGTCCGTGTTTCT
GAACCACATGATTTTCTTGGATGTTCTGATGCTGTTTGCTACTGTGGGTAATAATCATGG
TTTGGTAAGCTGAGATAGCAAAAATTCTTATTTCTTTCCAATTTTAGGTCATCAGACCAG
TGCTGAGTCTTGGGGTACTGGCAGGGCTGTGGCTAGAATTCCCAGAGTTCGAGGTGGTGG
GACTCACCGTTCTGGCCAGGGTGCTTTTGGAAATGTATCCTTTGTTTCACTGAGACTGGT
CAACCCATGGAATTTAGCAAACTGGACTTGGTCTTATCCACCTTAATATAGCTTGAAGAC
ATTTGTGTCCATAATACTAATAGTGCCCCACTTAAAAGATCGGGAATCTGGATGGTGTTC
ATTTTTCTGTCTTGAATTTATTCTTCTGGGGGGAGTTCTGTTCCGACTGGGAAGTTTTGC
TTGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCTGTCAG
TAAGCTGGTACAGAAGGTTGACGAAAATTTTTACTGAGCAAGACGTAATCTTTTAATTCC
TTGAATTTGAGAAATGTGATTCTTAATTGAGAATATAGATGTGTCGTGGGGGCCGCATGT
TTGCACCAACCAAGACTTGGCGTCGCTGGCACCGTAGAGTGAACACCACCCAAAAGCGGT
ATGCCATCTGCTCTGCCCTGGCTGCTTCAGCCTTACCAGCACTGGTCATGTCTAAAGGTT
AGTAATGTTCTGTATCATGAGTGGTGCAAAACGCCTTTTTTCACCTGAAACTTTGTTTAT
TGCTAAGTTCTGTTTGTCCAGAGTGTCTTACAAAATTGCCCATTACTAAGTAATTGTTCA
AAGAGTGATGTGGTATATAGTTAATTAAAAACTTTCTCCTTAATGTTTATTATGTTCTCC
ACTGCATTTTTTATTTAACTGTCAAAATGATGAGATTCCACTTCATTGGTCCGTGTTTCT
GAAACACATGATATTTGTGGAAATTCTGATTTGGCAAATTGTATACCATTTTGCTTTTGT
GGGTTATATAAAATGTCTCTTAATTTTTCAAAGGGTTTCGGTTTTGGGGTAACCAGGTAA
CTGTTGAATTGGCTTTATTAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTGG
TCGAAGATAAAGTTGAAGGCTACAAGAAGACCAAAGAGGCTGTTTTACTTCTTAAGAAAC
TTAAAGCCTGGAATGATATCAAAAAGGTAGGTTTGATGTGAGCACATTTACAGTTTGGTA
ATCCTTGATCCATACAAATTTCTTGTCATTTTGAATTTCAAAATGACGCATGAAGGACAG
GATACCTAAGTCTTAGTGTACAAGACAACAAGGACTTTGGAGCCTAGATCCTGTGGTTTG
AATCCTGACAGTTTTGTTATTTGTGCCCCCAGTTTCATCATTGGTAAAGTGAGATTTTTT
TAAACTATGAAGATATATTGCAGAAATCATGTCTTAATCAGAATACTTTAACTGTTTAAT
TTATAGGTCTATGCCTCTCAGCGAATGAGGGCTGGCAAGGGCAAAATGAGAAACCGTCGT
CGTATCCAGCGCAGGGGACCTTGCATCATTTACAATGAAGACAATGGTATCATCAAGGCT
TTCAGGAATATCCCTGGTAATTATATTCCTTACATGTTGATTGGCTGCCCTGTGCAAGCT
TAGTCAGCTTTTATGATGAGATTCCACTTCATGGTCCGTGTTTCTGAAACAGGTGATTTT
GTGGAAGTTCTGATGCATGGCTGAGTAAGTTGTGTTATTAAGGTAGATCTCAGGTACTTT
ATTGTAGCACATAAGCCAAAAAGATAATTTGTTGAAATATAGGCTCTCTGATTCTCCTTT
CCCTTCAAAAGGAATTACTCTGCTTAACGTAAGCAAGCTGAACATTTTGAAACTTGCTCC
TGGTGGACATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCCTTCCGAAAGTTAGATGA
ATTATATGGCACTTGGCGTAAAGCTGCTTCCCTCAAGAGCAACTACAAGTGAGTGTTTTT
CGTGTACTAAAAACAGATTGTTTATACTGTGGATATTTGCATTCAGAATTGGTGTGCATG
TTTTCTAAATAATAGGTTTATTTCATTCCCATTTCCCCTTATTATAGATGAAATGGTGAA
GTACTCTACCTCATTGGGTACATGTTTGTGTGAAATGATAATGTGAGAAATGGGAATTTA
GGCAACTATTGATCTTTTTCTTTCAGCCTTCCCATGCACAAGATGATCAACACAGACCTT
AGCAGAATCTTGAAAAGCCCAGAAATTCAAAGAGCTCTTCGAGCACCACGGTAAACTTCA
TATTTACAGCATAACTCTTGCCTCAACCATAATACTGTTATTTCATTTCAAAAATGTGTA
TGTGTAAAAATGTTGATGAAGTGTCTACCTTTTTATATGTAGCAAGAAGATTCATCGTAG
GGTCCTAAAGAAGAATCCACTGAAAAACCTGAGAATCATGTTGAAGCTAAACCCATATGC
AAAGACCATGCGCCGGAATACCATTCTTCGCCAGGCCAGGAATGTAAGTGATAATTTATT
TTTTACCAATATATTAAGTTCTTAGATTTGATTCTTAACGACTCTGCGTAATTTATTACA
GCACAAACTTCGGGTGGCTAAGGCAGCTGCAGCAGTACGGGCCAAATCAGATGAGAAGGG
GGTTGCAGACAAAAAGCCTGTAGTAGTGAAGAAAGGAAAAAAGCTTGTTGGTGTTAAGAA
GCAGAAGAAGCCTTTGGTGGGAAAAAAGGCTGCCTCTACCAAGAAACCTGCAGCTGAAAA
GAAGCCTGCAGCTGAAAAGAAGCCAACAGCTGAAAAGAAACCAGCAGAAAAGAAACCTAC
CACAGAAGAAAAGAAGCCTACTGCATAAATTCTTAAATTTGTTTATTCCATAAAGGTCAA
ATCATTTTGGACACCTTATTTTGAATAAAGACCTGATCCAAGAGGCAGTGAAAAACATGG
CTTTGGGTGTGTTGAGTCTGGTTAGAATTTTTAATACTTACACATTCTCCATAATTCCAG
CCTTTGTCTATTTTATAGTCTGTTATAAAATGAAGCCTTGGATTTATACTAAATCCATGC
AGTGAAATGGAAGAGGGAGGGTTTTTTTAATCCTGATAAAATCCATTTTGTAAATTAACA
TGTTTTGAAAAACATACATATAGGCTGTTAAGACTTAGTCTCCAAAATGGAAGTGGGTTA
AGGTTTGACACTAAGTTAACCATAAGAGGACACAATTGTAGAATGGAAGTTGGGGGATAC
CACAGTAAAATTGACCCTGAAAAGTTAATGATGAGCTATGACAATACAGTTGGAGGAAAT
GCTTGCCACCCTCTTGGCAAGCATTTTTTTTTTTTTTGAAAGCACGTGCATGTTTTAGGT
TTTTTTACAGGTATCCAAAACCGCATTACAGTGGGTTTACCCCTGGCTCCCCCCCCACAC
ACAAGCTTGTAAACTGATAAATCTCACCTCCCTAGAATTAACCTCCCCTGCTCTGGTTTG
TCAGGGATTTGTTTTGTGTCTGAATTGTTAAAGTAGCATTAAAGTTTACAGCCAAGGTGA
CCTATAATTCTCTCGATCTCTAGGACCAAATCTGTTTCTCACCTTATAAGGGTGCCATTT
CCTGTTGCAATTTCTTTCTTTTTTTTTGGAGACAGAGTCTCCCTTGTTGACCAGGCTAGA
GTGAGTGCCGTGGTGTCAGCCTAGCTCACAGCAACCTCAATCTCCTGGGCTCAAGCAATT
CTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCGCCACCATGCCCAGCTAATTT
TATATATATATATTAGTTGGCCAATTAATTTCTTTGTATTTATAGTAGAGACGGGGGTCT
CACTCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1172, 1367..1473, 1838..1976, 2361..2485, 2766..2895, 3131..3287, 3506..3589, 3702..3822, 3901..4086, 4123..4167
1001..1172, 1367..1473, 1838..1976, 2361..2485, 2766..2895, 3131..3287, 3506..3589, 3702..3822, 3901..4086, 4123..4164
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved