Microcebus_murinus Locus TBRG4
snOPY snoRNA Orthological Gene Database
Microcebus_murinus TBRG4
Microcebus_murinus
TBRG4
GeneScaffold_980
SNORA5, SNORA5, SNORA5
3845..3978, 5278..5415, 5827..5960
12105
AACGTGCTATCTGCTTTGGCAGAAGCAAAGCCCAGGTTAACATTTTATTTTGCCCTTGT
CACGTGTCTTGCCTAGGTCATTTACTCTAGTGAGCTAGACCTGCTGATAGAATTGTTAAA
AGCAGCATCATAGGGTCATGTAACAAATTGTTGGAGATGGTAATATTTTGTCTGGGTTTG
AAAAGATAAAAAGTGTGCTTTTCAGGGCCCTGTGATTGGGATAGCAAGCCTTGCAAGGTG
GAGTGGATGTACAAGGCCTGATTAGAAGGGGTTTGTCTGGAGAGGGAGGAGAGATAAAAC
TGGGAAGATTATTCTGGGTCATGTTGAGAAGTCCTTATTATTGGTTCAGGAGTTTTGCTC
CTAAAAATTTGGCTGGGGAAGTGGTGTTTTGGGTTTTTTAAAAGTAGGTTAGTGATGTAA
TCTACCTTGGTTTGGGGAAGCATAATCCTGCATCTATAGTGTTAAAATATATCCACAGAA
ACTTTAGAAATGTGAATTATATGTTTTGGGTTTTGCGGGATCATTTTGGTTTAAACTAGC
CTTTCCTTTTGTCTCTGTAAGCCAGTAATTATTAATCATGGTTACCCTTGATATAAAAAA
AAAAATTAATCTTGTCTGAGCCCTATCTGCAGAGATTCCAATTCAGGGATCTTGGGCAGG
ACCTAGGAATCTGAATTGTTGAATTACTCCCTAGGTGATTGCAAGGCACAACCAGGCCTA
ATAACTCTCCAACCCAAGCTATAATGCTTCTGAATTTTGATATTTAAATGAATTCCATAC
TGAAACAAAAATTTTCTGTGATTTTTGCTTCTGAAAATACTGTCACATACATGTGGGTTG
TCAAAAAGGAAAAAGATGAAGGCTGATTTTACAGAGAGGATGGCTATGACTTCAAGTTTG
TGAGTCAGGAACTGCCCCTGTATGACCACTTTCTTTCCTTTTTCTCTTTAGGGTTTGGAA
TCACTTATTAGGAGCCTTAAGTTTCTGCCACCTAGGACATCATGGCAGTTCGCCTAGTGA
AGCGATGCACATGCCTCCTGAGAGAAGCTGCCCATTTGGCGCCTGCTATGGCTCCAACTG
GCAGACTAAGACTTGCTAGGGTAGCCCATAAGACTCTGACTTCTTCAGCCACCTCACCCA
GTTCCCACATCTCAAGTTCCTTGACAGAGCTGATAGAGAAGGAACAAGTGTTTACTCCCT
ACCCAGAGAAACAAGAGGTAGACCAGCTTATTGAGAAGACCACCAGGCCAGAGGAGCTCC
TGGAGCTACTTGGTAGTGGTCACAACTTACACCACAACCATGCGGCCCTCATAGTCATAC
GACTCTCCCGACTGCTATCTGAAAAGCCAGAAGACAAGGCCTCACTCATACAGGATGCCC
GCTTCCAGAAACTTCTCCATCTGGCCAACAGTAAGGTGAGTGCTAGTGTTGCCTCAGGCC
TTGGACAAGAAGAAGATAACCAGAAACACTGGAGGCCACAGGAGCCAGTGCTTACCAGCT
GTAGATTGGGGTCCTTCCGAGTACTTTGATGTGTTTTCTCTCTGTTCTCACAAGAACCTT
GTTATGCAAATATTGCTACCTCCTCATCCTACAAAAAGGCAACCAAGACCCACAGTAATA
GAAGTGTAGAAAGCAAGCCAGGTTCCTCTCAGTTTCTTAGGTACTTTCTCCCTCACCATA
CAGTCTTGACTTGTATCTCCCACCCTTCCACGTCTGGCTGATGGCTAAGCACTATTCTCG
AAGTTGGAGGAAATGCAGCGACTAATGGGAGGTCCCTGAAACTTGAGGCAGGCATGGGCG
TGATCTAGCCATGTTCAAACCCTCTAAGGGTGAACAGGGAGAGAGGCAACTGGGGGGCCA
GAACTGACTACAGAAGTCAGTTTCTGCTCATTGTGAGGAAGGACTCTATTTTAGGTTCTT
CCCTTGGGCTCTATGTGCAAAAAGAAGGAGTACAGACTCCTGCTCTGGCCAACTTGGCCC
TCACTCTCTGGCCTGTGTTGGAAAGGAGGTGCTCAGGCACTGAAACTGGCCAGTTGTCAC
GTGATGAAGAGGAGAGAGAGGTACTATGCAAAGAAGGGGTTCACTAAATGTGTTTTTCAA
GTTCCTATTATAAAACTAGTGTAGTGGGACTTGGCCAGCTGTTTTTTAATCAGAGTAGTA
TAGAAAGTACTAGAATTCATTGCATGTAGTAAGGGGAATACTGTCTCATGGAACTTTTGT
TTTTGTTAAGTGTGTGTATATACCCATATATTGTGTGTACTAGAGTCCACACTAGTGGTA
CTAGGTACACTTTTGGGGGGGGGTTGAGAATGTAGCTCATAAAATGAACTTGGGCCCTTT
CTTGTTCTTAGGGTATAATTCTGTTGTTTATTGACTTACACATAATTGAAGCATGTCTTG
GGAGTATATGACTGACCATTTTAACAAATTTATAAGGCAAGTATTTGCAATTTAAATGAC
AGAGCTTTCTTTTAAGTGATTTTCCTACAGTCCATGAAACTAGAAAGGTACAGGCATCAG
GCTTCATGTGAGACTGGAATTGACTCCAGTACTTTCTCCTTCCTCCCCAGCTCTTCAGAC
ATTGGCTCCTCTGTTCCCAGCTCACCTCTTTATATGAGTGGTTTCCATTCCCCATTCATA
GGTCTAGAGACTGAGGCTGAGGGGTCAGCGTTGAGACACTTGGCACAGAAAATGACAGTC
ATGCTTGTTTTAACATCTGCTGTCTTCTGTGAGGATGGCGTCTGGGCCAAAGGGGAGGAG
AGGTGCAATCCAAGCAGGCAAAGAGCCGCCCACATCTCTGAGGCCTGGAGCCACATTCCC
TGCACAGCAGAGTCAGCTTCTTCAGAGACAAAGCAGGCACCAGTGGAGAGGGCAGGATGT
GGGTGCAGGTTTTGGACCCAGAACTACCCTGAAACTTCAGGGAAATAAGTTGACCTTTGT
TTACATGTGCAGTGGGGCTCATGATACTTCATAGGGTGGTTGGTATCTGATAGGAGTATG
GGTGTAGAGGATGCTGTATTAGTAGAGCTGTCAGAGATCTGGTGTGCGCAGCTTGGTCAT
CCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGTAGCAGTTGCATTC
CTAAGAAAATTCACATCCTCAGAAAATGTAGGATGTTTTGTTAGAGAAAAGTTTAGGGGT
TGGAGTTTCTCAGACTCAAAATAACAGTTATTTTACTAGAGAAAAGTTGGTGTTTTACTT
GTCATTGCAAGTAATTCTGGTGACAAAATTGATCCTAGCAAACTTTGCCATCAGGTCACA
TCCCTCAGGCTCCACTCTTTCTCTGACCTCCGGTTTTGACAGCTTTATCTGCAGTTCAGG
TCTGCATGCCCACCACACAGCCATAGCCAGGACCACATGTCCAGACGGTGTAGTCTCCAT
TTGATCAGCCACTTCAGGTCTAATCTTCATTAGGGAAACTCGGAGAGTTTCTCGATTGCA
AGCAATAGCAAATGACCCTGGCCACCTCGAGCAGAAGTAGTTTGTTCAAGGCTAGAGGAC
CAGGTTTAGAGGCATGCTCCTGGACCTGGCCTATGCCTGAAGAGAGCGCTAGCCATGTAG
ATGTCTGCAGCTGTGTCAAATTCGGTGTCTACCCTACTCATGGTAGGCACTGGCCCAGAA
GGCTGCCACAGAAACACTGTGACTCATGGGCCCTGTTCCTGTGTCCCAGGCTCAGGGATA
AATTTGGTTACAGACAGCAAGTCTCTAGAACTCAAGGCTGAACAAGGCTCCTCATGAGCT
CTGAGCACAGGGGATGTTAGACCAGGATGGGGAACTAACTCTTGCCTTCTCTGAAGAGTT
GTAGTAAATGCCCATGACAGGAGGTTCACAAAGATAGCTTCCAGCTCACACACAGGATCA
ATAGGGTGCCACGTGTAACCTCACCTGTGTCCTTTACCTGCCTAGATAACTTCGATCTGG
CATGGGACTCTTGTGAAGCTTCTGCGGAGCCTGTATGCTCTGGCGCTCCCCAGGGACTCC
AAGGTGCTGCGGTCAGTAGAGCAGGAGGTCCGCTGGCGCATGCGGAGGCTCAGTTATAAG
CACTTGGCCTTCCTGGCAGAGTCCTGTGCCACCTCTATGCAGAAGCAGTACTCTCAGGAG
CTGCTGGCTGAGCTGCTCATGCACCTGGAGAGACGCTGGACAGAAATTGAAGATGGCCGC
ACAGTGGTGGCCATCATGATGAAGGTGGGGCACCTCTCGGAGTCACTGATGAACCGCCTG
GAAGACAAGGTACTAGGGCTAAGAACAGGTGGCACCTGGTCGGCCTCTCCAGGGCTTTGG
GCTTATTAATTGGGTGATAGTCCTCTGCAGAAAGGATTGTCATGTGCATTGGGTCAGGAG
CCCTGGAAGCTTTTGTACAGAGTCTTAGGCATCACACAAGGAGGGGCCAAAGGGCTCTGG
GTAGCAGCAGGTAGTTGCTCCTTGGCCATGTTTATCAAGTACCACTTACCCGCTTGCTCC
TCCTAACACAAACACTTCCCTGATTGCACCTTTATCTTTTTTTTTTTGAGACAGAGTCTT
ACTTTGTTGCCCAGGTTAGAGTGAGTGCTGTGGCATCAGCCTAGCTCATAGCAACCTCAA
ACTCCTGCGCTCAAGCAATCCTCCTGCCTCAGCCTCCCGAGTACCTGGGACTATAGGCAG
GCACCATGCCCGGCTAATTTTTTCTATATATATTAGTTGGCCAATTAATTTCTTTCTATT
TATAGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTTTCAAACTCCTGACCTCGAGCA
ATCCGCCCACCACAGCCTCCCAGAGTGCTAGAATTACAGGCGTGGGCCACCGCACCCGGC
CTGCACCTTTATCTTTTTCCAAAATCCCATCAAGAGCATGATCCTGAGGAGTGGGCATGG
CAGGTAGCTCCTAAAGTTACACAGAGGAGCTGATCAAGCCTAGGCCAGCCCCTGTGTGGC
CCAGCTTCTGCCAGAACATTCCTAGAGATATAGTAACCCCCTCTTTTGACTTTAGCCCTG
CAGTCGAGTCAAATTCAGCCCCCGTTCCTGTCATAGTGGGGGCTGGCCCAGATGACTGCC
ATAGCAAGCTCCGTAGCTCATCGGCCCTGCGTCCCCTGCCCCTGGGACCTGGGGATAAGT
GTAGCTGTGAACATTATGCTCCAAGTTCAGGGGTTCCCTGGGGCAGGCAAGGAGGCAGGC
CCTGCACAGATGGGCCTGTGTTTAGTCAGCTCAGGCCCAGTTGCTGTCTCGCAGGGGCTG
CACTGGATGGGACCCCTGCCCCCAGCTCGTCCCTGCCACCTCAGGCCATTCAGCTGACCC
CTACGCGGCTGTGGTTGACAGTGCCTGGAGTTGGTGGAGCAGTTTGGCCCCAACGAGCTA
CGGAAGGTGCTGGTGACACTGGCAGCTCAGAGCCGGCGATCTGTGCCCTTGCTTCGGGCC
ATCTCCTACCACCTTGTGCAGAAGCCCTTCTCTCTGACAAAAAGTGTGCTCTTGGACCTG
GCCTACGCCTATGGTAAGTTCTTTGGACAAAACTGCGCAGGGAGGGAACTCAGGCCTTAT
AGGTGCCTGCAGCTGTGTCAAATTCGGTGCCTGCCATACCTGTGGTAGGCACTGGCCCAG
AAGGCTGCTACAGAAACACTGTGACCCATGGGCCCTGTTCCTGTGTCTCGGGCTCAGGGA
TAAATTTGGTTACAGACATCAACCTTCTAGACCTCAAAGCTGATGTAGAGTGGGGCTGGC
TGGCAAATGCTGACCCTCCCTAGCTAAACCCTGTGGTCTGTTCTGTCCCAAAGGCAAGCT
CAGCTTTCACCAGACCCAAGTGTCCCAGCGCCTGGCTGCCGACCTGCTGTCTCTCATGCC
CAGCCTGACACCCAGTGAGGTGGCCCACTGCGCCAAGTCCTTCGCCTTGCTCAAGTGGCT
CAACCTGCCTCTGTTTGAGGCCTTTGCCCAGGTGAGCCGCGGCCTACTCCAGTCGGAGGC
CTGGCCAGCCAGCTCCACGCCACTGTGGACAGCTGGGTACTGGGGGCTCTCTCCATGTGT
GGCCCCAACTTGAAGGAGCTGACTCCCTGGGCATCTGTTGAGAACTGTTGCTTTAATCGA
GGAAGCAAAGCCAATCTAAAAATGCCCACTTGTAAGTGGCAAATACATATTTCTGGCCAG
GTGTGGCGGCTTATGCCTGTAATGCTAGCACACTGGGAGGCTTGCTTGAGGTCAGGAGGT
CGAGACCAGCCTGAGTAAGAGCAAGACTCTGTCTCTACTAAAAATAGAAAAATTAACTGG
GCATCTGCCTGTAGTGGAACTTGCCTACAGTCACAGCTACTTGGGAGGCTGAGGCAGGAG
GATCACTTGAGCCCAGGAGTTTGAGGTTACAGTGCATCATGATGACGCCGCTGTACTCTA
GCTGGGGCAACAGAGTGAGACTCTGTCTCAAAAATAATAATAAAACTTTAAAAAAATACA
GATTTCTTTTTGGCTTATTTGGAAAGAGATTATTCAGTGGTGGAGAAAACATATTTGAGA
ACTCTTTCCTGTTTTTTCACTGATCATCATAAGTGTTTTCATACATCTTGGAGTAGCTAT
AGCAGGTAACAGCGAGGCTGAGAATGACTCAGAACTCCCTACTGAACTGTTGACTGCCCC
ACAATGGAATTGTAAGGAAAGATGATACCTGCCCTTATGTTGACAAGCAACTGTTCTAAA
CTCAGTGTACTGGTTGTAGAGCATTTCTAAAGCCAGTATCAGAAGGAGGCAGTTTCTAGA
TATCCCCTGCCCTCTGGGTAGTTGCTGCTTGGTGAAGGGTCTGGCCCTATGGGAATCACC
CCATGTGGCCAGCTGCTTGTAGGCCCTGGGTAGAGGGTCCTGTAGTCACCCCTGGCCTCC
CAGGCTCCCCTCAGATTCAGAGCTGGGTGGGAGGACGGCATCCTGGGCAGTGCGCTCATC
CTGTCTCTCTGCTATCCCTGACCTGCCCAGCACATCCTGAACAGAGCCCAGGACACCACC
GTGCCCCACCTGTGCAGCATGCTGCTGGCTTTTGCCCGTCTGAACTTCCATCCAGAACAA
GAGGATGAGTTCTTCAGCCTGGTACAGTTTCTGGGCACCCTCTCCCCATCCCTTACCCTC
TCCCTGCCAGCTAATGGCTCATGAGCCATCCTCCCAGAAGCAGCTTGGGCTGGGTGGAAG
GGAAGAGGCTGTGGTGCCTGGCACAGGAGCCCCAGATACTAAAGCGGGAAGCAAGAAGGC
CTGGCATGGGAGGGCAGGAGGAGCTGGCTGGAGCCAGGCGTCCTGGGGTTCATTTGAGAA
TAAACATGAAGTCCTGTCCTAGCATCCAGTTGACTCCCCTACCAGGCAGGGCTGGGAGAA
CATGCATCTCATTTCCGGATGCTCCTTTTAATGCCCGGCTGGAGCTCAGAAGCTTCAGGG
ACTCAAGAGACCCACTGGGTGGGCACGAGGTGGGCATGCTAAACAGAACAAGCTTAGGGT
TGTAGGGGGAATGTTCTTTATGAAAACCTCCATGGTATTTGCAGAGCCCAGTAGACCACG
TTTGACCCCCGGACTCCAACAGGGGCTTGCCTGGCTCAGTGCTGAGAACGGCCTGTGGAA
GAGGGTAGGAGTGTGGGGCTGTTTCACCTCTTAGATGCTCTCATCCTCCTAGAGGAGCAG
AGACACCTCTTCGTTGTCCCATGTTCCCACTTGGGGACATTATTAGAGAAGAGATTCTGT
GCCCTAGGCCCCTGCCAGTGGGCAGGATATAGGTAAAGGCAGTTAAATGCTGGCAATCAG
GCAGCACTCTTCCTGTTCTCCAGAGTGGTGTAAGAGGAAAGTTCCTGGTACCTTCAAGCC
CAGGGTCGCTCTAGGCTTGATTCTACCTCTTGCTGCCCAGTAGCCACCTCTGGCTTCAGT
GTGACCAGGTCAAGACTAGCTAGACTCTGGTCTGCCTGTGGCTATTTGCAGCCCTCAGGC
TAAGCCTGCTTTCTCTACCACACCCTGTCCTTTCCCAGGTGCACAAGAACGTGGGGTCTG
CACTGACAGGCCTGGAGCCAGCCTTGCAGGTGGACCTGGTGTGGGCCCTGTGTGTGCTGC
AGCAGGCAAGGGAAGAGGAGCTGCGAGCCGTCCTCCGCCCAGAATTTCACACCCAGTTTC
TAGGTGAGCCCCACCATCCTGCATTGCTATAGCTGGGGGGCTGCCTGGTCTATGCCTAGA
GCCAGGTGAGAAGTTGGAGCAGAGACAGAGAAGACCAGGGCTGCTCACCCCCACCTTCAC
TCATTCCCCGTTCATTCCCTACAGGTGGCCAGCAGGACCTTCAGTCTGCTGCCTCCTGGC
CTGTGGCCCACCCCACCCTTCTCACTCTCCTCATCTCCTAGGGGGCGAGTCTCCGAAGGA
TCAGAGCACCTTTCAGAAGCTGCTCCACATCAACGCCACTGCCCAGCTAGAGCACCCTGA
GTACATGGGTCCTTTTCTGCCAGCCTCAGCTGTGGCCCCAAGGCCCTCAGTCCTTGACAA
GAAGGTGACCCCCCTGCAGAAGGAGCTGCAGGAGACTCTGAAGGGGCTGTTGGAGAGCGC
CAACAGGGGCAGCCTCGAGGTGGCCACGCAGTACGGCTGGGTGCTGGGTGAGGGTCCACC
CCCCAGGTGGTGTGGGGCCTGATTCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCCCCAGTTCAGTGTCGTGCTGCACAGAGCTCCTTGCTGTGATCTGATCCTGGGGCAGAA
AAGACACAGGTTCCAGGCCTGACTGCAGGCTCACACCTGGAGACCTTAGCCAAAACTAAA
AGGGTGTCAACTTCCCTGAGGAGGGCCAGAGAATAAATTTGTGGCTTTGTGGGCCACAGA
AGGGTTCTGTCACATATTCTTCTTTAGGTGGTTGTAGGATTTTTTAACAACGCTTTAAAA
TTCAGATGCCCTTCTTAGGCCCTATGTAGTTTGCAGACCTCTGGCATTGTCAGTGCCAGA
GCCTTTTAACAACCACACTGCGCGCAGCTTCATGGGCTCTGCCTTGAGGGTTTGGAGGCT
GAGGGCTAGGCGTGTGGAGCTTTTGGTCACCAGCAAGTGCTGGCAGATGAGGGGTCAATG
TGAGGGCAGTGGGCAGAGCCACTCGCCAGGCAGGGGTTGGAAAGGGTCCCCCCACCCCTG
TGACCTGTCTCCTTCTCCTCCCAGGTCCCATACTATGAGTGGCTGGAACTTAAATCTGAA
TGGCAGAAAATAGCCTACCTCAAGGACAAGATGCGCAAAGCAGTTGCAGAGGATCTGGCC
AAGTGACCTACACCAGCAGCGTGGACTGCATGGCCAGGGGCTGACTCTCTGCCCGAAGAC
CTAGCCATGGGCACTGGGCAAACGAGGTGTCACCCTTGAGGACAAACCTTCTCAGTGCAG
AACCTTGGCCAGAATGGGGAGGGTGGCCTGAAGCTCCAAGGGACAGAATGTCCTTTTGTG
GGTAATAAATGTTTAATTTTGGTGTTGGACACCAGGAAGCTTCCCGGGCTTTGTCACCCC
CACCCCCTCGCTCTCGACCTCCTGTTCATATGCACAGGGGAGCTGGTGTGGCTCTCCATG
GCTCCACCCTGTGCACTCCCCTACCCCTCAGCAGAAGAGGGCTGGATTTAGGGACAGACC
CAGATCTTCAGCTACCTGTCTCTTCTAGCTTCTGCCTCTTCCTGGGGATCCTTCTCATCT
GTCACCTTGCACCTAGGTAGATGGAAGGGATCCCAACAGCCTAGAGTGACAAGTGATATA
AGGGCTGGGTGGGCACTTGGGACACTCTGGGAGAGGAGAAAATCCCTCTTGGCTGACACT
GCAGGCCGGAGCTAGACCCCATCCCTGACCTTGTCGCCCTGACCAGTGCCTTGTGCTGCC
GTCGCACAAACCATCTACCCAGATGGAGCCCTGGTGGCCTCTTTGCTGCTGCAGGGGCTG
TCATGCTAGAAAGCAACAGGGTTTCTGCCTTCTAGCCTCTTGTTAGAGATTCCCATTGGC
AGAACCTGACTGAAAGGGAGTCGGGGAACTGTGGGTCCGCCTTCAGCGGTACCAGGTAGA
GGGGGTACGGTGGGGTGGGGCTGAGAGCAGAGGAGCCTGCTGCCCTCTTGCCACCCCAGA
CCATTCCCTCACAGAGAGCAAGCATAGGCCCTCCACTGCTTGAAGCCTGTCCACTCTCCC
AAGCATGGGGTAGTTTTGTGCCAGGTGCACTGGGAGCCTTCAGGCACAGGTGAGCACAGT
CCCTGTCATTCACACAGGCTGTGGAGTTAACCACAGCTGAGTGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1414, 4185..4508, 5601..5772, 6053..6210, 7230..7340, 8258..8402, 8621..8866, 9541..9652, 9753..9867, 11004..11105
1001..1414, 4185..4508, 5601..5772, 6053..6210, 7230..7340, 8258..8402, 8621..8866, 9541..9652, 9753..9867, 11004..11102
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved