Microcebus_murinus Locus RPL27A
snOPY snoRNA Orthological Gene Database
Microcebus_murinus RPL27A
Microcebus_murinus
RPL27A
GeneScaffold_3295
SNORA3, SNORA3
2110..2239, 3404..3534
4751
TCTTCCACTATTAGTGAAGAAAATTGAATGTATGCCAAGAACTGGGAGTGCATGGATAA
AAAAAAAACAATCCTTGAGTCCATAAGGAATTCAGTCTAGTTAGGAAGACAAATGTGTAC
TGGTTATTATGTAAGAGCTATCTATGTACTAGGTTGTGTGGTAGTAAAGGTGGGGAAGTG
AGCAACTATGACCGCATGAGTCAAGAGAAGCTTCACGTAAGAAATGCTTGAATCAGGTCC
AGGTTAGGCAGGGGTGGTCTGGTACAGGAGAGGGTCACAATCGTGTCAAATACATTCCGG
AGAAAAATTTCAATGTGGCATTTAGAAAAAGTATTTACAGGGTCTGGATTAAAAGGACCA
TATAGCAAAGCAGGCACATAGGCCCCAGAAGCATAGCAGGTTGTTCAAACTTGAGAGGCC
GCCCAAGACAGCACAAGGGCAAAGGACAAAAGACGGAGTGCCAGCTCCGGTGAGCAGCGA
GACGCCAAGTGGGCACACTAAGGGTTAAATAGTGCCTCTTGCTCTTCGCCGCGGACGGGA
GACAAACGAGCAGACCACTAAGGACAGGGGAGGTGCCTGGGACCGCCCAGGACTGGGGCA
TTTTGGGAGGAGCTGAGAGATACCGAGACCCTTTGGGTGGGCCTAGGCAGTTCCAGGGCC
CAGTCTCCAGGAAAAGGGCCCAGCCCCACCTAAGGCCCGGCAGCCTGCATGACAGCACCC
CACGCCCCGCATTTCTCAACAGTTTTCAGTCTCCGAACATGTTACAACCGCCTGTATCGA
CAAGAGTTGGCCGCCACCACGCAACCGGCACTCGGGTATGAAAGCGACGATTACAAGCAG
GAAGAGGAAGCGGCCCGCGGGTGCACAAAATCCGCGAGACCAAAGAGGCCCCGTCCGAAG
CCCCGCCTCCCCGGCCGGAAGTGAGGCAATTTGCTCCGCCCCCCCGTTCCATACCTCGCG
AGACTTCGGGAAGCCTTCCCTTTTTCGTTTCAGCCGCCGCCATGGTAAGTGTTCCTTTCG
TTGCCTCCGCTTCCATGTCGGCCGAGGCCCCGGGCTGTACTCCAGTTGCCCCCAAGCGAC
CTACCCCGGCCTTGGCCAGACTTTCCAGGCCTCACAGGGCCGGCTGTAGGGCAGGATGGC
CGGCGTGGGCCCGGGACGTGGCGGGGGGCCTTGGGGCCGCGTGTTCGGCCCGGGGTTTGG
ATGTCTTAGCCACGCGGGCCCGAGTGCCACCCTGAGTGAAACCACAGGGCCCTGGGCTAG
TCTGTATTTTCAACTTTGCTGAACGCGCCAGAAGGTAGTTCCTTGGCCTATAGGCCCACC
TCAGGCTGGCAAGCATCTCCTTTTTCCCGTTTTCCTTAGGCCTTACCACTAAGCTCCTTT
TTCCACGCAGCCATCCAGACTGAGGAAGACCCGGAAGCTTCGGGGCCACGTGAGCCACGG
CCACGGCCGCATCGGTAAGTGCCGGCTTCCCCTCCTGGTCGGCCTAGGGCTCTCTCTTTC
GGGTGCTTAGCTAGTCAGCATGTAGGTAGTTTAGAAGTGGATTAGAGTAAGACGTTTTTG
CAGTAAGGTGGATTGACTCGGGCCGCTGTTGGTTTTTTTTTTCTTTTAGAGGATTCTCTA
GTATTCCAGTTTTAGAGAATTTTCTATCAGTGGAGGAATAAAAATTAAGGGGGGTAGAGT
ATTGAATTATTTGAAGATGCAGAGTGCTGTGACATGCAACGCTGAAAAGATGTTTAACCC
GAAGTCTTGACGGAATAGCAGTACCGAAAGAGGTATTGTAGCTTGGGAACAGCATAAGCA
AGGGCACAGAGGAGTGGGGATATTCTCTGGTTTTGCTGAGATAGTATTGAGAAGGCTATG
CTAGCCATGTAGCTTTTTATTCCTGCAGGCAAGCATCGGAAGCACCCAGGAGGCCGAGGA
AATGCTGGTGGCATGCATCACCACAGGATTAACTTTGACAAATAGTGAGTATACTTGGGC
TGCCTTTACTGACACTGATAGCTTGGGAGGTATAGGCGCAGGTTTACAACATCTAAAGTC
TGGAAGCAAGCCTCTTTTGCCTATTGTTAATTTTTACCAAGTTAACACTTGATGTGAATT
GAGAACTGCCATCGAGGCTAGAGTCACGCTTGGGTATTGGTTATTGCCTCAGTGTGCTAG
AGTCCTCGAAGAGTAACTGCTGACCTTATTCACTGGCTGTGGTCCTCATGGCACAGTCAG
TCACCAGGTTAGTAACATCCTTCAGATTGACCTATGCAACTGTTAGTGTCAGTTATAGCT
ACAAATTAAGGAATGATAGATTTTGACTAGTTCTTTAGAAGACCTTTATCGTAGCAATGT
ATAGGTAGGTTTTCCAGAGAATGCTGTCAAGTGACTTGAATTTTACTCTTGGCATTGCTT
CTTTCTTCCTTAGTGATTGTCCTGGTTCTATGAAATAGAGCTAACCTTTTCCTCCTGATG
GTCTTTGTTGGTTTGTAAAGAGTTGTTCAATTCGACAAATGAATTCAGTGCTTGCTGTGT
GGTATTCACTGTTCTGTGCCAGTGAACAATTTAATTTACACTGTAATGGGGTAGATAACT
ATAAAGATGATAAACATAGCTTCTTAATTGTAGTGAGTTTACAAGGGTGGTTGCTTTTTC
TTCCCAGTCACCCAGGTTACTTTGGGAAAGTTGGTATGAGGCATTACCACTTAAAGAGGA
ACCAGAGCTTTTGCCCAACTGTCAACCTTGATAAATTGTGGACATTGGTCAGTGAGCAGA
CACGGGTAAATGCTGCCAAAAACAAGACTGGAGCTGCTCCCATTATTGATGTGGTGCGAT
CGGTGAGTGAATTGGATATGCCATTACAAAAGTTTGGCTTAGTCTAATCCACTTAATTTC
CTACCTGAAGCCTGTCTTATATTTACCCAGCTACATACCAGACAATTCCACCTTTTGGTA
GAATTATCATAAGTCATTGTGATCAAAATATAACTCTTCCCTGCCTTGCTCCCATTTTGC
TTGAATCAGTCTTTCCTGTCAGTAATAGGTGCCTATTGTTATTGCCCAGATTGTAACTAA
CAGGTTTGCATTTCTTGACTTGAGCTGTACAGCTAGTTCTGGTCTTGAGGTACAGCTCTT
GGCCCTTCATGTTCCTCACAGAATAAAATCCTAATATGTTCAATTGTTATTCAAGGCCCT
ACATTAACTGAAGAGATTTCTCCCACAGACAAACATTTTTTGGTATATTGTTGGGGTTCT
AGTCCTTGTGTCAGTGTTGCCTCCAATGAAAATGAAGGTAGTCTTTTTAAAGGCCAGAAC
CCTAGAGAGGCATTTTGACCATCAGGACTTGAAGCATTGCTGGGAATATAGTTGTCCATT
TTTGCTTATCAAGGGTAATTGAGCAGGAGAGGGAAGTTTGCTTTGCCGAGACTAGAGTCA
CATCTTGACACCACTCTTGTCCTGGTGTGCTAGAGTTCTCGAAGAGAATCTGCTGGTCTT
GATTCACTGGCGGGGGCAATCAGTGCCCCCATTAGTGCCCAGGTCAGTAACACATCCTAC
CTGGGTTTTACAAAGTGGCTTGACAGGCATCTTTCTTCATACCTGCTATGGTATATTGTA
AATTCTTTTCTCTTTTCTTCCAGGGCTACTACAAAGTTCTGGGGAAGGGAAAGCTCCCAA
AGCAGCCAGTCATCGTGAAGGCCAAGTTTTTCAGCAGAAGAGCTGAGGAGAAGATTAAGG
GTGTTGGGGGAGCTTGTGTCTTGGTGGCTTGAAGCCATATGGAGGGAGGTTCATTAAATG
CTGACATGCTTTTTCCTTGTGGTCTGAGTATAAGTTCTTTGGTGACATTTCTGCTTTACC
CTATACATTGGAAACCTACCTAACAGGTTCTGGGAGTTAAGGATATGAGGGCTTGGGCTC
CTCTACTATAACTCCTCTCAGGAAGTGCATAGTAAAGACAGGACCAGTACTTAGAGGCAT
TAGCCAGTTAACACATTTTCATGTATAAAATGAAAATGATACCTGTTGACAGTTGAAATA
CCTAATGTGAAAGGACTATGCATTGTACTTTGAATTTTACAGTGAATAGGAGGGTGTATT
CTTAACTGTTCCATGTGGCTTACAAGGGAACAGTGACAGGATTGAGGCAGTTCCCAATCT
GAATTTTAGATGTGTCAGGTGGGGGCTAGATTCCAGAAAGCAGTTGACAGATTCATATAG
GTCCCTATGCATCAGGGTCTTGTTCAAGGAGATAAACTTACCTTTTTTTCTAGTCTGAAA
TAGATCTTGTGGAAAAGATTGGGAAATCCTGAAGGCCAGAAACTGGAATTGGGTTTGGTG
ACCAATGCTTGCTTACAAATAGGATCCTCATAGATCTCAAAGCAAATTATAATTTGCTAG
TTTGTAGCTCCTGAGATTCTGAACTTTTTTTTGACCCCAAATAACAGTCTAGAATCTGGG
CAAAGAAGTAATTAAGATGGCCCTTATCCTACTACTAGGTTTCAGTTGATGGAGTTTTCC
TTAGCATTCTGTGGGGTCATGCACATGGAAAAATTGTCTTCCGTGAAAGTTGTGGGGCAG
CACAGGAGGTGAGCAGCAGGCAAGGGAGCAAAGCTTCATCTATATTTACAGCTCATCCCC
ATCACATCAGCCCAAAAGGTTATTAGGCAAATGGGAAGTGCTATGGTGGCTGATGAGCCT
GGAGAGATTATTTTGGCGGGGCTATTTCAGGGATTGGGTTACAGTGGGAGGCTGGAGGGC
AGGACCAAGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1390..1453, 1888..1963, 2647..2821, 3623..3751
1001..1003, 1390..1453, 1888..1963, 2647..2821, 3623..3748
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved