Microcebus_murinus Locus ENSMICG00000013819
snOPY snoRNA Orthological Gene Database
Microcebus_murinus ENSMICG00000013819
Microcebus_murinus
ENSMICG00000013819
GeneScaffold_1936
SNORA64
30119..30246
32484
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTCCTATAGAATGTGTC
TCAGGAACCAGCTTATCCTCCGGTGTTCTACCTAAATAAAGATACAGGAGAGATATCACA
ACCAGTATTACCTTGGACAGAGAGGTAAATTAATATTTTTTGTTACCTGTCTTTTAAACT
CTCTACTATCCTTTCTAGTTTCTCCTCTCTGTTATTCTTTTCTGACTTCCTTATTTTGTT
CTGCAATCCTCACTCATAGGATAACTCTTGGAATTATCCTCTTTTAGGGATATGCTATCC
AGAATAATAGCCATTAGCCACATGTGGCTATTGAGCACTTGAAATGCGACTGGTCCAAAT
TGACATGCGCTAGGTGCATGTTGAGATGTGTAAAATATGCTCCAGATTTGAAAGACTTGG
AATGAAAAAAAGAATTCAAAATAACACTTTAATATTATTTACGTTGGTTACACGTTGAGA
TGATAATATTTTGGGTAGCATGGGTTAAATAAAATGTACTTGTTTACAATTAATATTACT
TGTTTATTTTTTAAAATGTGGCTATTAGAGGATTTAAAATTATATAGGCTGGGTGTGGTG
GCTGACACCTATAATCCCAGCACTTTGTGAAGCCAAGGCAGGAGCATCTCTTGAGCCCAG
GAGTTTGAGGCTACCGTGAGCAAGGATGACACCACTGCACTCCAGCCTAGACAATAGAGC
AAGACCTTGTCTCAAAACAAACAAAACAATTACATAAAAACAGCACTGTTCTAGGACCTT
CCCAGTCAGGATTGTGTTTACTAGAGAATCCTAAAGCAACATTCCTCAGTTTATGGTTCT
TTAATGAAACTTCAGGAATTTTCTCCACTGCTAATACATTTACAAGGGTGAAGGTGGGGA
GTAGAAACAGGAGTCTTAAAGAATAAAAATATTTGTAAAGGAAAGAATTATTGTAAATAC
CACATTGGAAGGAAAATTTGAGTATGTTTTCTAGAAAGGCTGTTCTCTCAAAAATTTCAC
TTTATTCTGACTTCAAGAGAAAATTTTAAACAAAAGGGAGAGATAGAAGATATTTTTAAA
TACTATACACAAGAAGATTTTAACAGTGTACAAGAATAAAATGTTAATGATCCTAAGGAC
ACTATGTCGTCATCAACCCAAGTGCACTGTATTTCGTATGACTTGGAAAAATGATTTAAC
CCTGCCCAGATGGGAAGGATTGTATCCAACATTTCAACTGGGACTTTTGTAAAATTAAAG
AATATGATTACGTCTAAGATCTACACCTTTTCACATAATATTAGAATGAAAAAGTATTAC
TTTGAATTAGTAGTGTTGATTTTTAACAAGCTACTGTCTCTGAAGTATGGAAAGTGTAGC
CAATAATAATGGCTGATTCTTACTGGGCATTTACCATGTGCCAGGTGTTGTTCTAAGCCC
TTTATATGCATTAACCCATTTAATCCACATAGAAACCCTGTGAGGCAGATCCACTTATTA
TCCCCATCTTACACATAAAGAACCCAAAGGTCAAAGGGATTAAGTGTGGGTCCAACACAG
CTGGTGACAAAGCCAGAATTGGGGCCCAGACAGCTGGTTCCAGATCCCCTGTTGTCCTGT
TGTTCATAGAGTGATTCTGCCCCACGCAGGACCCCAAGCACTGGCACTGGCTGCCCTCCT
AAACTCAGCCATGCTGAACAGAGCCATAGTAAGGGGACTACCTGGAAGAGAAGAGTTCAC
TTTTGAGTGAAATCTGAGACATTTTTCTCTAGCACGCACTCTCTAAGAATCATATCTGTG
GGGAATTCAGTTCACCAAGTTTTTCGAGACAAAGAACCAAGTAGAAAGAACCAACTCCTA
CAGTCCAGCCATCACTTCCAGTGTAGAATAACTACATTTGGAACAGTGCTCCCTTGTACA
GATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCAGTAGGATCGCTGAGCCCCGGAGATTGAGGTTGCTGTGAGCCAGGCTGACCCCACGG
CACTCACTCTAGCCTGGGCAACAAAGTGAGACTCTGTCTCAAAAAAAAAAAGAATTAGAC
TATCAACAACTCTTCTAGGTTTTTATGTCCTTCTACAAAAGCTCTACCTATAAACAAATA
GAATCTTTATACAAATAACAGTAGATCGTGAAACCTAACTTATGAATAAAATATCCTGTG
GTACATTTCCTAATGATAAAATATGCTAAAACCAGAAAGATAAATTAGGGAGCGATTCAT
TTTGACACCAATTGGATATTTTTCGTTGCTCTGCAGGAACACAGCAGCTATTCTTTGACG
GTAGAAGCAAGAGATGGCGATGGAAAAGTAACAGATAAACCAGCAAAACAAGCTCAAGTT
CAGATTCGTATTTTGGATGTCAATGACAATATACCAGTAGTGGAAAGTGAAATGGTAACT
ATTGTTTTAATAAGTGTACCTATTTATATTTTAATTCTATTAATAACTAAAAATATGTCA
CTTAAGTGTGTATTACATTAAAATAAAAATCACTGTGTTTGTGTTTTGCAGTTGGAAGGG
CTGGTTGAAGAAAATCAAGTCAATGTTGAAGTTATGCGCATAAAAGTGTTTGATGCAGAT
GAAGTAGGCTCTGATAATTGGTTAGCAAATTTTACATTTGCATCTGGAAATGAAGGGGGT
TATTTCCACATAGAAACAGATGCTCAAACTAATGAAGGAATTTTGACTCTTATTAAGGTA
AGTACTGCGTTTTAAAAACTGGGATGGGACAAGTTGGCATTGGAGAGGAATCTAATACAT
TTTGAGCCCCAAAAACAAGTGCTTTACAAACTCAACTGGCACCACAATTGTTTGAGACAG
GAACTATCCTTGTTTGCCCAAGTTTGTGGTTTGGAAGTTGTCATACTACAGTTCAAATTC
AGATCTGAGGACTTTAGTCCCAGCCAGATAGCATGATACCAGCTTGGTTATTACTTTGCA
CATTTCTGGTCTTGTTTGCAGCCCATGTCTGATGACAGCATTCTCACATCATAACCTCTT
GCCTCTGTTGAACACCCCCTCACTTACTACCTTGCATTTTATTTACTTAACAGTAATGCC
AAACCTCACAAAATAACATTCTGAAAACAGAAACNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTT
TATTCCTAGGTATCCGCCCAAGAAAAAATAAAAAACATGTGTATACAAAGACTGGTGTGC
AGATGTTCAGAGCAGCATTATTCATAATAGTAAAAGGCTAATAACAGTCCAAATGTCCAT
CAACTGCTAAGTAGATAAATAAAATGTGGTGTATTCATACAATGGAATACTAATGAGCAA
TGTAAAAAATGAAGTACCGTACATGCTGCAACACGAATGAACCTCAGAAACATTGTGCCA
TGTATAAGAAGCCAGATGGAAAATGCTGCATATTGTATGACTCCATTTGTGTGAAATTCT
AGAAAAGGCAAAACAATGGGGATAGAAAGCAGATGGGGGTTGCCCAAAGTGGGGAGCATG
AGTGGGGATTGACTGCAAACAGGCATAAAGGAAGTGATACACGTGTTTTAGAGTGATACA
AATGTTGTGAAACCAGACTGTAGTGATTATTGCAAATACTAGAAATCATTGTGCTGTACA
CTTAAAATCAGTGAATTTTATTGTACGTAAATTGTATCTTAATGAAGCTGTCACAAAAAG
ACAAAGGAGATGAGCAGGTATTTTAAAATATGGAAGTAGAGATAGTAAACCATCACATGA
GAAAAATCCACAGCTTTATTAACAAATTAACAAATAAGTTTAAAAATCTTTAATGCTATT
TAAAAATAGCAAAAATGGGAATGATAAAATATGTTGACAGAGTTGTGAAAAATAGAGGTA
TGCGCCCTCATACATTGCTTATAATGCTGGAAATTTTTCCATTTGCTTTGAAGCATTTGG
CTACTGATGATCAGAAACATTTTTATGATCCCAGGACCTACCTAATTTTTTTCTGTAATG
TCTTGGCCTTTGAATACTAATGATATCTGGCAGGAAGATTTTATTTCTCATCCAGCATAC
AGCATGCCATTACATCAAGCATGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTACATACATTATTGAAAACATAAAA
TGAATATTCCCCTGACTTCCCAGATTTGGCTCTTTCCACATTAATTCTCCTCGCTTTGAA
GGAAGAAACCCAGAAATCATTTTATCAGCATTGTTTTCACTTTTAACCAATTCAACCTGA
AAGAAAGTTATTGCTCCTAACAATACTATTCCAGAATTATTAGATACTTCCATTTAAGGC
AATCACTGATTTTTAAAGTTGATATTTATAAATGTTGGGAATATCCCAGTAAACAATAGA
ATGTAAGAGTACTTATCTCTACCAGTCTTTGTTGTGTAACTAAATTATTCCCCAAAAGTT
TACTCTAAATTTAAGGGAACACTAGGTCAAAGCTGTAGGACAGACCACAGAGCAGCTTAC
AAACTTCTTGGGTTAGTGGGCTGAGGGTGATCACCCTTAATTATATATCTAGTATGTTAC
AGGAATAAGGACGGTTCCAAGGAAGTGTGATATGCAGTAAGAGAAGGGCTTTTAGGATGA
ATGTTTTTACTTTTCAAGAAATTGAAAACATTCAAAAAAAAAAAAGCCTATAATAAGAGT
ATATGTAATGAGAAGAAAATTAAGCTTGAAAGAGTTATAGATGTTAGAGATTCTCAATTT
ATCCAGAATTCAAAATTAATTTTATGTTTCTTTTATAACAGATATGCAAAACTGGAAGAT
ATGGACAATTGGGTCTCTGTGGATTCAGTCACATCTGAAATTAAACTTGCAAAAATTCCT
GACTTTGAATCTAGATATGTCCAAAATGGTACATACACTGTAAAGATTATAGCTATATCA
GAAGGTAAGTTATTAAATAGATATTTGTCTTAGTTATATGTATTTAGATATTTATTAAAT
AAATATATATTTATTGTTAGATATGTATTTAGATATTTCCAACATCTGAAAACTTTGTTT
TGATCATGTGTAAAAACCGAATCTCACTAATGAATGAACGTTCACATTTAGTGAATTAAA
AGATATTACTTGGTCTGAATATGAAACATTTCTAGGATAGAAAGTGTCCTGAGTGGTTAG
TCCCTTTTTCATACCAAATTGGCAAGAAAATTCAAATATATCCATTGTCAGCAATAGTAT
CAGAATACACATACTTTATCTTTTTTTTTTTTTTTTTTAAGATTATCCAAGAAAAACCGT
CACTGGCACTGTCAGGATCATGGTCGAAGACATCAATGACAATTGCCCCACACTAGTGGA
CCCCGTGCAGACTATCTGTGATGATGTACCGTATGTGAATGTCACTGCGGAGGACCTGGA
TGGATACCCAAACAGTGGGCCTTTCAGTTTCTCTGTCATTGACCACCACCCGGAATGGCA
GAAAATGGAAATAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
AAAACTAAAAAGCAACAAAAGGAAAAACTCAGAAAGTACTTACTAAAAATCTGTCTTCAT
TCCTGAGAGTATGGAGGATAAAACGTAGCAGATAACATTTACAACAAGTTTTGCTTTACG
CAAGTTTGGTTCAGAGAAATAGTTGCATGGTGTCGTTTAATATGGGGAAACCAGTTTTTT
TTAACACATGTATCTTGGGAATTAATTTCCATTTAAACCATCCTATTTTTTTCAGAGATT
GGTGAACCTTTTATAATGTTAATCTTGATCATGGTGACCTTTACTCACAGTACATTTATT
GAAAACCTACTAGAGGCTGCCCTTGTGCTGGAAGGGACTGGATTGTGTCCATTCTACAGT
GACACCTTGGATTTGCATGGTATTTTTAAATGTTCGAAGTAAACTTATATCTTAGATCTC
AGGGCCATGCCTGGTCTCTACAGAGCTATTGTTTAGGGAGCCCTAGTTGCAATTATTCCA
GCTGAATTTAAAGAATCCCCACCCGCTGCCCAAGATACACAACTATAGTGGCTTCTTCCT
GGTCACTACGAGAGCCGCTCAGGTTCCTGTCCTATGCCTGTGTTCCTGTCCTAGTCTCCT
GGGGCTGCTATAATAAAAATACCTTAGACTGAGTAATTTATAAACAGATTTATTGCTCAC
AGTTCTGGAGGCTGGGAAGTCCAAGATCAAGGCACCAGCCAGCAGATCCTGGTATCCAGT
GAAGCTTGTTGTCTGCTTCCAAGATGGGGCCTTCTTGCTCACGTGGCCAAAGGGGAGCTC
AGTGGAGCCTCTTTTTATAATGAGCACTAATGTCATTTATGAATTACTTCCTTCCCAAAG
GCCCCACATTTTAATACTGTCATATTGAGTATTAGGTTCACATATGAATTCTGGAGGGGT
TACCAACATTCAAACCATGACTGTCCCCATGTGCCAACACTTCCCAAAGCATTGTGCTTA
GAAGTGTGGCCAACTGTAGCAAAAATGAGAATGTGGAAGAAGCTCTTCAGTGATCTCTTT
CCTTTTAGTGAATCTCGTTTTAATAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATGGCACTCACTCTAGCCTGGGCAACAAAAGTGGGGACTCAGTCTCAAAAA
AAAAAAAAGCTAGAACATGATAAAGACCCTTTATCTGTCTGATACGCCCCCATGCCAGTG
GACATGCCCATATGTCCCTACCTTGTGCATATGGACCATGTGATGTGTTGATGTGAGTTT
TTAGGTATCCTTCAGGATGGTTTTGAATATGGAAAAGTCTATCCAGAAAACTATTTTGTT
TTAAACAAGTAGCGTTCATTTCAGAAAAAATTTCAAATGTGATGCCCAAGTTTTTCTTAA
TTCACAGGTTTATTATGTTATTTTATTTTCAGCAAATATTTTAAATAATTTTAAGAGGCT
TTGAATATTGTTTGGTCCAATTCCCAAATTAAATACCTTTAACATTTCAAACTGCATTTA
TATAGATTTAGTATCTTTGGTTTTCTTATGTTTTTCCATGATCTGAATTAATAAGTAAAA
CTCCCCTATGATCCTTACACTCTAAAATTCCAATAGATGCAACTTATAAACACATTGAGT
TCTGTATTATTAATAGGTAGTATTATGTCAATAATGAATTTCTTAAGAGTGCTAGTAACC
ATTGGCCTTAGAAGGTACATGCTGAAAAATTTCATGCTATCTGTAACTTACCTTGAAATA
GTTCCCAAAAAGTTAAAAAAAAAAAAAAAAGTGGCTGTATATAGAGAGAAAAAGTATGTT
GAAAATTGTGAACAATTAGTGAAGGGTTCATTGTGATATTCTTTCATCTTTTCTATAGGT
TTTCATTTTTTTTAAAATTTTGAATATATAGTATTAGAAACAAAAGGAGAGGACTAGTTT
TAGAAGCTTATTAAAGCTGAAGATAGGTACATGGGATATGCTCTTCTATGTCTATGTTTA
AAATTTGCCTTAGTAAAGTTTTTTTAAGAAATAGTAAAATAAAGTCATTCCATGGAAATG
CTGTTTAACTCACCACCTGTCACTGCATTCCTAGTATGTGGACCATTTTGGTAGACCACA
CACATTGGTTGCAATTAATCATCATGAAAATAAGGCGTCCAAATCTGATCCTGCAGTGCT
GAAGCTGCATATTAAGGATCTAAGATGCATCTAAATTTCAGCGGGCATGCAATATGAATT
CAGTGAGAAGTGAAGGAAGACGAAAGCTTCTAACTGGAGCTAACTATTATCAGCAATAAA
AGAATTTTCTGTAATTCCATTTTGCCCCTTCCTTGATAATCACTCACTTTTATATTCTTT
TGCCTCCTGCCATTACAGGTACCAGTGTGCTGCTGCAACAAAGCGAGCAAAAGCTTGGGC
GAAGTGAAATTCAGTTCCTGATTTCCGATAACCAGGGCCTCAGTTGCCCTGAAAAGCAGA
CCCTCACGCTCACGGTGTGCGAGTGTCTGGACGGCAGCGGCTGTGCAAAAGCGTTGCGCA
GCTCCTACGTGGGCCTGGGACCCGCGGCCATCGCGCTCATGATCTTGGCCCTTCTGCTCT
TGCTACGTGAGTCTTTCAAAAGCCACTTTTGAGCTCCTTTTAGTGATTTGAGTGCACTAC
TACTAGTGATTCTATGTTACTATGGTGATCATTGATTTCTCCGCAGTTATTCTTAAACCA
CATTAGAATGCTTCTGAGGGTGAATAGGGAAGCAATACTGAATGATTGAAAAATTCACTA
AAACTTGCTATTGTAGGACCCTTCAGAATTTTGTGTGATAAATATGTATCATTTTCTGAT
TTAAATAACTGAAGTCAGGCGTGCTCTTCAGCTACCTTTGGCACAAACCTTGTTGCTGTG
AGCTCTGTGAGGGCAGCGTGTTGTCTGTTCTCTCTACCGCTGTGTTTCCGGTACCTTAGA
CCAGAGCTTTGCACATGGCAGGCTCAGAAAATATCTATTGTGTGAACTTGGATTATGCAT
ACAAGCTTATCTTACAAATTTAGCTTATTCCAATCAGTCCTTGCTTTGCACATGCAACTT
GTCACAGCTCTGCCTGCCCGCTGCCCCCATGCTCCTGCCCTCCGCCAGGCTCCCAGCAGT
GAGACCCTCCGAGCACATTTCTGCTTCCCAACACTGACAAAATGTTCTCCACCAGTCCCG
TCTGCCCTCCAGAGTCTCGGGTTTCTTTTGACAAGAGAACAAGGGACTGCAACCGGGCGT
CACGTGGAATACCACTCCATTGGACCACTGAACTTGGGCAGAGGACCACCTCCAAGGGAG
CCTAGGCTATTTCAGTGACAGAGGAGGAGCCAGTTAGAGCCATTAGTAGATATTCAATTG
AATACGCAGCACTCAACAGTTTGCAGTATACTTTTATACTATTATTTCCATTTTGTGGGT
AGAAATACAGACACTTAATGGTCAGTGACTTGTCTCAGCTTGCCATGTCTGTGGGTAGGT
ACTGGAGCCAGGACTGCTTCTTTTACCCAAGCATTCCTTCCACTGCCTTCTCATCTCAGA
TTCCCTGGAAACCAATGTGGCACTTGGCACATAACAGTTACTTGATTAATATTTGTTGAA
ATTGTTGAATTGCTACTGGCTGATTCCAATCTTTTTATTAATTACAAGCTATAGTTACCA
TGCTGTCGACTATTTTACATAAAAAGGAATCTAGATGGTAGTCAGTTCATCATTGGAAGC
TGCCAATGGGCGTGGCAGATGTGGTTAATTCTTTCTTGCCTCGATCGAGGGTCTTTTCTT
CCCCCTAGAGGTAGAATAAAATTTAAGGAGGGATCTCTGAAATTATATTTAATTCTATAT
GAAACATTATATATATTCTGAGGGTTTTTAAAGTAGAATCATTTTAGAAAATACTTAGGT
GATTCAAAGGTTAGTTGGGACCTCATAGAGTCATGCCTTGTGCAAAATTTTACTCTAGGG
TGAAGTACTGTAGCAGTTTCAGTGTTCTCCAATATTGTAATATATTAAGATTTTTTACTC
TTAGGAGCTTTTGATCTTTCTAACAGTACATTTTTGTATAGACAATCAGTTAAAAAAAAT
TTAGATAGTGGTTTTTTAAAAAAATTAATCTTTAAATTGGTTTCAGTGATTTGGATACTA
TCTAATCCAGCCTTGGTATTCCACTTAGTAACTGTAGACAGCCTCTTTGTGATGAACGAG
GCCTTCAAATCTGTAGAACTCTCTCATGCTGCCTTCGGGCTTTCATGTAACTCACCTGAG
ACAAGCTTGGTAAGGTTGGCTCAGGGTGAAGAAAGGAAAAATAGGGCTGTTGGCTGGGTG
CAGTGGCTCATGTCTATAATCAAAGCAATTTGAGAGGCTGAGGATGGAGGATCACTTGAG
GCCAGGAGTTCAAGACCAGCCTGAGCAACATAGTGAAACCCCTGTCTCTACAAAAAAATT
TTTAAAAATTAGCCGGGAGTGGTGGCACGCACCTGTAGTCCCAGCTACTCAGGAGTCTGA
GGCAGGAGGATCGCTTGAAGTCACGGTGAGCTGTGATGATGCCACTGCACTCCAGCCTAG
GCAACAGAACAAGACCTCGTCTCTAAAAAAGAAAAACAGAGCTGTAAATAAGTGAAGACA
ACTCCAGGGAATGATATGCAAAAATTCCAAAAATTATGCAATATAACATGTCAGGATTAA
CCTTCTCTGACCCTCAGTTTTGTGTCTGTTGTAGTTGTGCCATTTCTGCTGCTGATGTGC
CATTGTGGAGAGGAAGCCAAAGGCTTCGCCGCTATCCCCGGCACCATAGAGATGCTGCAC
CCTTGGAACAACGAAGGGGCGCCACCCGAAGACAAGGTCAGGTCCTCAGATGTCAATATA
ACTTGTCTTCCTTTTGGGGTTTTTAAGGGGCCTCGGGAAATGTTTCTAACGTCTCTGATC
ATGAGGAGTAAAGCGATCATTGCGGATTTCACTCACGTGCCTTTGTTAAACAAAGGGTTC
AAATGACAACATGCTTTCTGTTTGTGGACAGGGCAGAGTGGAGATGGTTTTGTATTCTCC
TGTAACATGTCCTGTGTTCAGAGAATGTAGAGCAAAGGTCAGGGAGAACAAGAGTGTGTA
GGGATTTAGGATAGAAATGTTTGTCCCAGTATTAAATGGGGAGCCTTCCACAGCCAGGAA
GTGGCCTGTCTCCATTCCCTCCACATGTAGGGGTGGCAGAGGTAAATCCACAATCCCCAT
GGCACTTGCAAAACGTTGCAAAATCCCCTTTCCCAGCCACTTAGGAGCCATTTCCCTTTG
CCTGTCTATAGCATCTTCACCCTGGACCTCTCGCCACCATCTGCCATGAGCACCCTTTCC
CCTTTCTTACAGGGTAGGATTTAGCATCGACTGTCATTTTCTTAACAGTGATGTAAACAT
GAACGTGGCCAGGCCAGGATCAACATGACGATCCCTCCACAATGTGCCTCCTGGCTCCTC
CTGTTTCTCCTCCATGGACGAGTTCCATTCCCACACCATCCTCACGTTCCAGACACTCAC
TGCTGTCCCCACACTCCAGCCCATAGATGGGAGGAGAGTGAAGAACAGCTCTTTCAGCAC
ACCTACCAGAAGTTGCATACGCCATTTCTGCTCCATTGACATTGACCGCAACCTAGTCGG
GCGGCTCTCCCTCGTAGCATCAGAGGCTTGGAAATACAGTCTTGATTTTGGGAGGCCATG
TATCCAGCTAAAAACAAAATTAAGAGCTCTCTAACCATAGAAGAAAGGACCAAACTCCAG
AGGAAGCTAGAAATACCACTGGTACCAGTGGAGTAAATGAGCGGAGACTATATGTGAATG
TTGGAGTTTTGTTTCCTCCTTGAGTTGTAATCATCTTTGAAATGAGGAAGTAAAAAGAGA
GTTTCACAAGATTCAAATAGAAGTTATTCAACCTACCAGGAGTGGTGGCTAACACCTGTG
GTCCCAGTGACTCAGGAGGCTGAGGCAGAAGGATCATTTGAGGCCGGGAGTTCAGGAATA
GTGTGGGCAACATAGTGAGACCCCATCACTACAAAAAATAGGAAAAAAAAAAATAGCTGG
GTGTGGTGGCACATATCTGTAGTCCCAGCTACTCAGGAGGCCAAGGCAGTAGGATCAGTT
GAGCCCAGGAGTTTGAGATGGCAGTGAGCTATGACCGCACCACTACGCTTGAGCTTGGGT
GACAGAGCAAAGTTATTCAACCCACAGTATTTTTTCTAACTGGCCTCTGTGGAACCAGCT
TGTCCCTACCTCTGCCCACTCAGCTCAGATTCTTCCAGCAGCTGCACCAACCCTCCATCC
TTCTAATTCCATTCTCAACTGTATGTGTTCTCACAGGTGGTGCTGCCGCTGCTGGCTGTG
GATCAACGGGACGGTCTAGCGGTAAGAAATGGCGTCGTAGGCATAACCAGGGAAGCCACT
GTGAAAGGAAGTAGCTCGGCATCCTTTACCAAAGTGCAGCAGGAGATGTCTGAGATGGAG
GGAAGATGGGAAGAACAGAGAAGCCTTCTGACTAGTGGAGCTGCCCAGGTTACAGGGACA
GCAGGAGCCATCACCAGTGCTGCAAGCATAAGGACCACACAAGCCACAGGGGCTTCCAGA
GACATGGCGGGGGCTTCCAGAGACATGGCGGGGGCTTCCAGAGACATGGTCGGAGCTCGA
GTAGCTGCTGGTGCACTGAACGAGGAATTCTTAAGAAGCTATTTCACTGATGTAAGGATT
GGTTTTTATGTATGGGGGGGAAAACATTTCTATATGGATGTGATATTATTAGGGTAATCA
TTGCTGTGGATCTAAAGGAGACTTTGGGGGGTGGGGTTTGGGTTTTTTGTTTTTTCCAAG
GAAATGCTTATAGGCAATAAGAGATACACCCATCGAATCAGTCAGTGTAGCTAAATTACA
CTGTGCTAGCAGGGGACCCTGCAATGTTAGTTCAGTCAGCTCTGCTCCGCTCCGCTCCAG
GCTGTCTTCATTCCAAGATACACAATGAGAGAGCAGATTGTACCTGGGACACTGCTGTCC
TTGTGGCCCAGGGTAAAGAATAAGGCAGAGGCAGACAATGGTCCTGAAAGCCTCCACCTG
TTTACACTCATATTTCATTGATCAAAGCAAGTCATGTGCCCAAGACAGATGCCAGTAGGG
CAGAAAGTTCCATCCCTCTGCAGGAGCAGGCTTGATAGGGATGAGCCCAGTTGGGAAGGG
CAGAGAATACATGACCTAAAAGACACAATCTACTAATATTAAGTCCACTTGAATTTTAAC
TTCTGTATGAGAGTATTTAGCTTCACTATAAAGTTGAGAAGACTTGCAGGAAAGATGATC
AGATACAGTAAGGAAGCTCATGCCTAGAATTAGGAGTTAGAAACAGACGGAAAATAAAAG
CGTGGCACAGGATCACTGTGCATTTTGGAACACGGATTGCTCGCATGCATACTCAGGGAT
ATTTCATAACAGAGAATGGGTCTATTCATCACGGACGCGATGTCAGTAGCTCACAACAGA
AGTTCAAAACCCAGAAGCAAAATCTGATGGTACTAAAAGAGAAATAGTCAGATCGATAAT
TATAGTTGGAGAGTTCAACCTCTTCTATTCATACCTGAAAGAACAAGCAGACAGAAAATC
AGTAAGCTGTAGGAAATATAACAACACTGTCAACTGACTGGATTTGATTGGCACTGATAG
AGCCTTTTGCAGCTAAAGCAGAATCCACATTCTTTTCAATATAGACTCTATTCAGGACGT
AAGTGTAAATAAATTTAAAAGAATTGCAGTCCCTACAGTATACTCTGACAAGAAGAAACT
AAACCAGAGATCAATAACAAAGAGATATGCCCAAATATTTGTAAATTACACCTTTCTAAA
TAACCTGTGGATAAAAGAAAAAAAATAATAGGATCAATTAGAAAACATTTTGAACTGACT
GAAAATTAAATCATACTTTATCAAAAACTTATGGGGCACTGCTAAAACAGTGCTTGGAGG
GAAATTGATAGCAAAAGTGATTATATTAGAAGATGGGTCACAAATCAGTGATCTCAGCTT
CCCCCTTAAAAAGTTACAGAAAGAAGAACAAATTAAAACCAAAGCAAGCAGAAATAGGCA
ATAAATTTTCGAGGCAAAATCAATTAAATATTAAACAAAAAAATAGGTATAAAAGCAATG
AAACCAAAACCTTATTTAAAGAGATCAAAAAATTGATAAACCTCTTAACCAGATTATTTG
AGATATTATATAAAGGGTATAGATGCAAATTATGGACATAAGAAATGAAATAAAGAACAT
TACTGTAGATCATACAGACAGTAAAGATAATTTTAAAAATAAAAATAAAAGCAGGATTGG
ATGCCTTTGTTGAGAACAAGGTCCCTGTGTCCCCATGGCAATAGGCAAAGTGGGAGTGTT
AGCTTCTGGGAGGCACCTGAGAGGCTAGGAGAGGGGCTTCCATTGAGGAAGGCAATTTAT
TTCTATTCCCTCTGTTCCAAATTTCCAAATTACTGGAGTGTTTTCCCACTTTTTTCCACC
CTTCCTTTCATACCATCCTCCACCCCCCCAAGTATTATCTTGACAGATAGAGTTAGTGTC
ATGGAAAACCACTTCCTGTCCTTTTCTGTCTCATTGCTAAGCTTGGTGCTAGTATCCTAT
TTGTTTTATTTTGATGTATTTTTCTTCTCTCCTCTAATCCTGCTCAGGTCAGTCTTGGTT
ATGTGTGCATGTGCTAACTTTAGATTTGGAAATAATTTCAGAATTATCAGAAAATTTGCA
AGAATAGTAGAAATTTTGAATTCTTGTTCCCTCTTCACCCAGATTACCCAATTATTAACA
CTTTGTCACATTCACTATTAGCTTTTCCATTCTCCCTCTCTCTGTCTCACACATACACAA
ACGTTCTCTTACATTACTACAGTACCATTAACAAATTCAGAAATTTAACATCGACACAAT
CCATATTTCTGTTTAACCAACTGTGACAATAATGTCTTTTATAGCAATTGTTTTTCTTGT
CCAGGATCCTGCATTTCATTTAGTTACCAGGACACTTGAGTCTCCTTTAATCTGAAATAA
TCTCCTCTCCTTTTCTTTGTTTTTTATGATATTAATAATTTTTTAAGAATACAGGGCAGA
CTCTCTCATTTCTTCATAGTCGCACTTGTCTTCATCAGTGTGACTTCATAACAGGGAGAG
AGAGAAATGATCTCAGGACCTCAGACTGGCCTTATGGTGGCCTCTTTCCTTGAAAGGCTC
AATAGGTCCCGAAGAAAGAAAGCAAAAAAGAGAATAAAGGCCAGTGATGTTGTAGGATAT
CTCTCTATTGGGTTTTCTCTGGTGTTTCCTTGTAATTAGATTCAGGTTATGCATTTTGAA
CAGGAATATAGAGACTCGTTTTTAAATGACGAGGTGTTGCTAATTATTTGTCTCTGTGTT
TATTTTCATTTTAGAAAGCAGCCTCTTACGCTGAGAACGATGAGATTCACACGGCCAAAG
ACTGCCTTCTGGTTTACTCTCAAGAAGAAACCGAATCCCTGCATGGTTCCCTTGGCTGCT
GCAGTTTTATTGAAGGAGAGCAGGACGACCGCTTCTTAGATGATTTGGGACTTAAATTCA
AGACACTAGCTGAAGTTTGTATAGGTCAAAAAATAGACACAGATATGCAAATTGAGCAGA
GCAAAAACCTGTCGCAGGAACAGGTACGAAGGCAGCGTCACGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCTTTCAAGTTCCAAAATCTTTGCAGGAAACAAATGCA
GAGAAAGTAACTCAGGAAATAGTCACTGAAAGATCTGTATCTTCTAGGCAGGCTCAAAAG
GTAGCTACACCTCTTCCTGATCCATTGGCTTCTAGTAATATTATAGTAACAGAAACTTCC
TATGCCACAGGCTCCACTATGCCACCAAGCACTGTGATCCTGGGCCCTACACAGCCACAG
AGCCTTATAGTGACAGAGAGGGTGTATGCTCCAGCTTCTACCTTGGTAGATCAGCACTAT
GCTAATGAAGGCAAAGTCATGGTTACAGAAAGAATCATACAGCCTAATGGGGGTGTATCT
AATCCTCTGGAAGGCACCCCACCTCTGCAAGATACACAATACATTATGGTGAGGGAAAGA
GAGAGCTTCCTTGCCCCCAGCTCAAGTGTGCAGCCCACTCTTGCCATGCCCAATGTAGCA
GTAGGACAGAATGTGACAGTGACAGAAAGAGTACTAGCACCTGCTTCCACTCTGCAATCC
AGTTACCAGATTCCTGCTGAAGATTCTGTGACAGCCAGAAAGACCCTGGTCCCTGGCGCT
CTGCCAACTTTTGGTTTAGCGGAATCTGGCCATTCTAATTCTACCATGACTACATCTTCC
ACCAGAGTCACCAAGCATAGCACGGTACAGCATTCTTACTCCTAAACAGCAGTCAGCCAC
AAACTGACCCAGAGTTTGACTAACAGGCACTGATTTCATGTTTTCAATATGCCTGCTTTT
CATGAGTCTTAACAGACATGCAGAGACACACAAACAGCTTAAAATTTCTCTCAGTCACTG
ATATGTAAAGGGCCACACTGTCTCTGCTCCCATGAATGTATTTCAGAAATGCTCCATGAT
TTACTGAGGACATAGCATGATGCTGTTTCTTAGGTACCTTTTAGTGATTTATGTAAATAA
TATTCACAAAACAAGACAGAGAATAAATCTGGCTTCTACGAATTTAACCAAATTAGCACT
GTATCCAGTTCATCAGCCGTCCAGCAGAGAACTCAGGAAACCGACTGGGTCTCTTTGCAT
ATCATATTAACATTTAACATTGATATTCTACATTCTGTATTTTACTGCACCTAATTGACA
AGTCAGTTATCCAAAGATGCACAATCTGGGTTACCAGTTTTGTTGTTGGTTTTCCTTAAG
ACTGGAACTTTTTTAATCTGTGTGAGGCTGATTACATTTTGGAACAATAACACGGGGAGA
ACACACATTGTATGTTTCTGTGCACATAACTCCATGTGTGTGTATGCACATGCATATCGT
ATGGTCTTAAAAATAGCATTTTACCTCATCATTTCAACAGTCATGAAAATTTTAAACACT
TCAAATTCAGTTGAATAACCCAGGACAAAATTTATAAATATAAAATAATTTTCCTTTGTA
TAATAATATGCCATGAATAAAAAAAAAAAACCTCAGGGTACATTCTCTTCCAAATAGCTA
CAATTTAGAGCAGCTAAATTAACTAACTATATTCTCTAGTCATGGTGGGGAACCATGCCT
ACTTCACTGCTATGTAGCCTCAGTGCCTAACATGGTGCCACATAAGTATTTGTGGAATTA
AACTGAATTGTACACACCATTCTCTTTTATCTACAATTGCCAAAAATATCAAAAATCTGT
ATATTTCTATAATTTTATATTTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1012, 1015..1074, 1077..1103, 4656..4793, 4911..5096, 9427..9692, 20141..20283, 20621..20802, 20805..20822, 20827..20845, 23358..23585, 25714..25835, 27336..27607, 27650..27710, 30434..30658, 30661..30700, 30702..30758, 30802..31484
1001..1012, 1015..1074, 1077..1103, 4656..4793, 4911..5096, 9427..9692, 20141..20283, 20621..20802, 20805..20822, 20827..20845, 23358..23585, 25714..25835, 27336..27607, 27650..27710, 30434..30658, 30661..30700, 30702..30758, 30802..31481
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved