Microcebus_murinus Locus TRO
snOPY snoRNA Orthological Gene Database
Microcebus_murinus TRO
Microcebus_murinus
TRO
GeneScaffold_823
SNORA11
19534..19661
23992
GGGGGCGTATCGGGAAAGGGAGGTGCGAAGTGGTACTGCATGGCAAAGGGAGGAGGCTG
GTGTTGGGGAAAGGGTTGGATCGAGATGTGATGCAATTAGAGACAGTGGGTCAGGGGTGG
GGAGGTGGGGCCCATATGTTCTGCTGCTCTGAGAGCCGGGGGTGGGGGGTGGGGGAATGT
GGATTGTGGAACAAGCTGGTTAGAGACTGGCCGGGTCACCAAGGTGCATGCGCGATGAGA
GTCTTGAAGAACGCGTTCTTTTGGGAAAGCGGTGGGCCTGAGAGCCCTAGATCAGCGATC
AGCGCGCATGCGCACAATCAAGTTGCGGTAGGGGAGGTGTAAAGGGCTGAGGTCGTAGAA
CTGACTCTCTTGGAGGCAGAAAGAACTAGGGCTGGGAAGAGTTTCTGGGTATAAGAATCT
AGGAGTTCAAAGGTTTGGGGCCCAAGATTAGATGAGACCCCCCCCCCTTCAGGAGAGGTG
ATATGAAACGTCTCATGACTCTCCACCTCTGTCTTATTCTCCCCTAACTCAGGCTCATTC
CTTTTAGGCTCAGCTGTTACTTGGCCTCCCAGAAAGATGGATAAGAGAAATGACTACAGT
TATAGGATGCCTTCATTCCAGGTGAGGCCTTTCTGCATTCTCACCAGGCCATCTGCCCTG
TCCTGAGTTCACTTACTGCTCTTGAGCCTCCTACTATCACGTAGCTGCATAATACCCTGC
CTAACCTGTCTCAGTCCTCCCCTGCATGGTGAAAGAGGAGGAGAGGAAAACCTGCCTGAC
TATCCCTTGCTCACTTCCCCTTCTGCCACTCCCCTTCAATCAACCACTGCTCAGAGGAAA
GGGAGGTCTTCGTGGAAAGGGGTGGGCTATAGGGAGGTCACATGGCCCAGAAGATAATAA
ACTTAAGTGTGTAGGGCCCTCTGCCTCCCCCTGGGAGCCTGGGCCTTCCCTTTCCCCCAG
ATGTGCAGACTGAGACCACGGAAGAGGACAGTGTCTTGCTGATGCACACCCTGTTGGCGG
GAACCAGGGACCCTCTGGCCATGGACTCATCAGTTGCCAACCGGCCTAAGAAAAGCAAGA
CCAAGAAAGCCCCTATAAAGACTATTACTAAGGCTGCACCTGCTGCCCCTCCAGTCCCAA
CTGCCAATGAAATTGCCACCAACATGCCCAGAATAACTCTGCAGGTTTTAAACTTGCCAA
TCATCACCCAGATTAGCAAGGTTTCAGCTATCACTGAGGCAGCCAGTATTCAGACTTCTT
CAATCATTGCTTAACCTAAGAAAGCCAAGAGTATGAAGAGAGTTACTGCCAAGGCAGCCC
AAGGCTCTCAGTCCCCAACTGGCAGTCAGAGTGCCACTACACAGCTCAAGTCACCCTTGC
AGGTCCTAAACCTACCAGTCATCTCACGGACTATCCAGGCTCCAATTGCCAGTGAGTCAG
CCAATTCCAAGGTTTTGATAGCCTCCACCAAGCCTAAGAAAGCTTCTAAGGCTAAGAAGG
TTGCAAACAAAGGCATAGCTAGTGCCACTGTGATCTCACTGGCTCCAGTTGCCACCTATA
CAGCTACTACTCAAGGCCAAATTATCAGTGAGATAGTCAATATCCAGGCCACAGAAGCCT
CCATCAGAACCAAGAAAGCCTGTAAAGCCAAGAAGACAACGGCTAAGGCCACAAATACTG
ACATTGAGCATATAGAGGCTCCAATGTCACCAGACAGAATGAAGCCTCAGCAGCAGCTAT
CCAGCCAAAAAAATCCAAGGGCAAGAAGGCTGCCAATAAGGGCCCAAATTTTGCCTCTGA
AATCTTTAAGACCCCACCTGCCACTCAAATGGTCACAAACCAAGCACTGGCAGCCAACCT
TTGGGTCAAGACAGGGTCTAGGGCTTGGAAGACTGCCACTAAGGCTCAGTCAACTGAAAG
CCTGACTCAAATTACTGACCAAGGGCCAAAGGCCAAGATGGCCACAGCTTATGCCAACGT
AAGTGCCCTTGTGACTCAGGTTGCTGCTGCTGTCCAGGCCCTGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCATGGACTCATCAGTTGCCAACCGGCCTAAGAAAAGCAAGACCAAGAAAGC
CCCTATAAAGACTATTACTAAGGCTGCACCTGCTGCCCCTCCAGTCCCAACTGCCAATGA
AATTGCCACCAACATGCCCAGAATAACTCTGCAGGTTTTAAACTTGCCAATCATCACCCA
GATTAGCAAGGTTTCAGCTATCACTGAGGCAGCCAGTATTCAGACTTCTTCAATCATTGC
TTAACCTAAGAAAGCCAAGAGTATGAAGAGAGTTACTGCCAAGGCAGCCCAAGGCTCTCA
GTCCCCAACTGGCAGTCAGAGTGCCACTACACAGCTCAAGTCACCCTTGCAGGTCCTAAA
CCTACCAGTCATCTCACGGACTATCCAGGCTCCAATTGCCAGTGAGTCAGCCAATTCCAA
GGTTTTGATAGCCTCCACCAAGCCTAAGAAAGCTTCTAAGGCTAAGAAGGTTGCAAACAA
AGGCATAGCTAGTGCCACTGTGATCTCACTGGCTCCAGTTGCCACCTATACAGCTACTAC
TCAAGGCCAAATTATCAGTGAGATAGTCAATATCCAGGCCACAGAAGCCTCCATCAGAAC
CAAGAAAGCCTGTAAAGCCAAGAAGACAACGGCTAAGGCCACAAATACTGACATTGAGCA
TATAGAGGCTCCAATGTCACCAGACAGAATGAAGCCTCAGCAGCAGCTATCCAGCCAAAA
AAATCCAAGGGCAAGAAGGCTGCCAATAAGGGCCCAAATTTTGCCTCTGAAATCTTTAAG
ACCCCACCTGCCACTCAAATGGTCACAAACCAAGCACTGGCAGCCAACCTTTGGGTCAAG
ACAGGGTCTAGGGCTTGGAAGACTGCCACTAAGGCTCAGTCAACTGAAAGCCTGACTCAA
ATTACTGACCAAGGGCCAAAGGCCAAGATGGCCACAGCTTATGCCAACGTAAGTGCCCTT
GTGACTCAGGTTGCTGCTGCTGTCCAGGCCCTGGCAGATGACTATCTGGCTCACTTGAGT
CTGAAGCCCACAACCAGGACTCAGGGCAAGAGGAACCGAAAGGTAAGATCTCTGACATCA
CCGTCCTTGACTTTGTGCTTCTTTTCCATTCCTATCCTTCTAGTTGTACATAAAAGTTCT
TCTATAAAAGTTAAGTGAACCTTTTTACTTTGAGCCAATCCCTGTGTTCAGATAGGCTAT
GGAAGATGCTGAGAAGAATGTGATATAGTTTCTGCTCCTTGGCAGTTCACAGATTGGTGG
GGAAAGAAGACATCCATACACTTAGCTACAACGTGTATATAATTCAATTTGTATTTATGT
AGTAGTTACCACACACCACATGGTAACTTTGTGTTGGGTACATTCATGCAGGTTTTATCT
TTATGTCTTTTTTTTTTTTTTTTTTCAGGCCAGTGACAAAAGTGTATATCTTTATGTCTT
GAATGTAACTTTTAACAACAAGGGATCATAGGTCTAAGTTTTACACATAAGAAAACTGAG
TCCCAGAGAGGGGTAGTGACTTGTCTAAGGGGTACCAGCTAGCAGAATCAGTGGTGGCCA
AAGGAAGAGGAGGAGCCCCAGGCCCTGTCCTTAGGTTGCTCCTGGCCTGGTAGAGGAATG
AAACTCCTGCTGGGAGACAATGAAAGATAAGCCCAGGCCTCAGGCCCCACTACAGGGGAA
GGTTTAAGGAGACTTTCTGGGGGAGGCAGATGAGGAGACAAAGCTATGTCTTTCACCTGG
TGACTCTGGATCTTCATTCTTTCTGATGATGAAGTCCAGGCATCTGAATGGGGATGAGAG
AAGTGGCAGTAATTACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTGAGGCTCATGAGTCTGCGTGCCTTGCCAGGGTCACATGGA
GCCTGAAGCATAGACGCGGCAGAATTCTCCCGTATCTGAGGAATCTGGGAGAGGCTAGCC
TAGTGAGCTAGCTGGTGTGTCTTTTGTAGATGGCTGCTGGGCATAATCCTCTCTGTCTTA
TTATTCCCTTAGGACTAAGGAGTCACCCAAGCTGGGTCTACTCATGGTGCTTCTTAGCAT
CATCTTCATGAATGGAAATAGATCCAGTGGGGGTGAGTGGCTTGGTGTGCAGCTGAATGG
GTGGCTATGGTCTGGATTCCGAGTGTTCATTTTTTGTCCCTCTCTCCTCTTGCCTCCCCT
TGCAGCTGTCATCTGGGAAGTGCTACGCAAGTTGGGGCTGCGCCCTGGGTGTGATTGGGC
TCTCTCAGCACTTGCTGTCCATGTTGTCCTTTGGCAAGAGAGGACAGTCCCAGGATTGCA
TCAGCCTGGTGGTCTGGTGGAGAGGGCCCAGGGTTCTGACCAGGGTGGATGGGGAAATGG
TCTTGAACTCTCTGCTCCCTCTCTCCCCTATGTCCTCTTTCTGTTTGAAGCCGAGATGTT
AGATAGACCTTCAGGTATCTCTGACAAAGAGCCATCTGCTGCTTGCTCTAGTGGCCACAC
GCTCACTTCTTTCTTCACCTTGTTGAGACTGCCCCACGTGCTAGAGAGGTCTCTTCCATG
TCGGGTAATGCCTCGGCCCTTATCTGGGCAGTTCTGATCTGTGTTCACAGGTTATTTTAC
CCATTACCAGGGTGAAGCATTCACTGTTTGGGGAAGTAAGGAAGCTCATCACAGACGAGT
TTGTCAAGCAGAAGTAAGGGGTGTTTGGGGGCTTTGTCTGGCCCTGAAGTATTCTGGGCA
TATTGATCTGATCCAGAAAGTGCTCGGTCACCACCTTTCTTACAGTAGCTTTAGAGGGAT
GGGCATCCTGCGTTCTAGAATTGAGTCCTGCCTAAAATTCCCATGGGTGGACTTTTCCAG
GACTGGGTCAGACTCAACACAAGGCCCTTGTAGTGGGGTGTGCTCAGAGCAGGGGGCCTG
AAGAATGGCGCCTCTGTTTACAACACACCCAACAGAAATCTGGGCTTACTCCTACAGGTG
GCAGGATACTGTGGCCTTCCTGTGACATAGTGCCCTACACATGCCTCCACTGCAGCACCC
CAAGTGACTTCTTTGCACAAAGTCAATGGGAAATGGCTCAGTATTGGAAGCTGAAACCAT
GAACTCTGTTTGAGAATGAGTCTGGGGCTGGAAGATCTCTTAGAAATCCTTCAGGGGCTA
TTTAGTATTTGTTTGGAGTGGGTTGCTATTTCATGCCTAGTGGTTAGACAACAGGTTTGC
TTGGTTCAAAGTAAGTTTCATTTCCTTTCTCCAAGGTACCTGGAGTACAAGAGGGTCCCC
AACAGCAGACCACCTGAATATGAGTTCTTCTGGGGCTTGCGCTCCTACCATGAGACTAGC
AAGATGAAAGTCCTCAAGTTTGCATGCAAGGTAATAGGAAAGCTGCCTGAGTTTGGAATA
TTAAGGGAATAGGATTCCCCTGGCTGGGTCAGGCAATGTGCAGGGATGGTCAGGTACAGA
GCACTCTGAAGTTCATATATAAACATATTTATGTCCCAGAATGCTGCTAGATATATAGTT
TACATCATCTCATTAATTCTTCATACTTTGTATTAATCAGCTTGGGCTGCCATAACAAGA
TACCATAGACTTAGTGACTTGAAAAACAGAAATTTATTTTCTCACAGGTCTGGAGGGTGA
GAATCCCAGACCAAGGTCCAGCATGGTCAGTTTTGGTGAGGGCTCTCCTCCTGGCTTGCA
GATGGCCACTCTTTTGCTGTCTCCACACATGGCAGAGAGAAAAAGCAAGCTTTCTAGTGT
CCCTTTTTATAAGGACACTAATCCTATTGGATCAGGACCCCACCCTTATGATATCATTTA
ACCTTAATTACTTCTATAAAGGCCCTATCTCCAAATACAGTCACATTGGGGGTTGGGGAC
TCAACATACAGATTTTGAGGGACACAAACATTCAGTTCATAGCATACTTTCTTATCATTT
CCCATATTATAGATGAAGACACTTAGACTCAGTGAACTTAAGTAACTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCAGTGCTGGCTTCAGTGGGGCACTTAGTACCACTACTGACTTTGGTGGTACTCCTAG
TAACAATATGGGTTTTGGTGGCGCTCCTAGCACGAGCATCAGCTTTGGTGATGCTCCCAG
CACCAATGTCAGCTTTGGTGGTGCTCACAGCTTTGGTGGTGCTCACAGCACCAGCTTCTG
TTTTGGTGGAGCTCCCAGCACTAGCCTCTGCTTTGGCAGTGCATCTAACACCAACCTATG
CTTTGATGGCCCTCCTAGCACCAGTGCCTGCTTTAGTGGTGCTACCAGTGCCAGTTTGGG
TGATGGACCCAGCACCAGTGCCGGTTTCAACTTTGGCAGTGCGTTAAGCACCAGTGCTGG
ATTTGGTGGTGGACTGAGCACCAGCACCGGCTTCGGTGGTGGAGTAGGCACCAGCTCTGG
CTTTGGTGGTGGACTAGGTACCAGTGCTGGCTTTAGTGGTGGACTGGTCACCAGCGATGG
CTTTGGCAGTGGGCCTAATGCCGGCTTCAACAGAGGACTGAGTACCATCGTTGGCTTTGG
CAGTGATTCCAACACCAGCAATGGCTTTACTGGAGAACCCAGCACCAGCGCCGGTTTCAG
TAGTGGACCCAGTTCTATTGTTGGCATCAGCGGTGGACCAAGCGCTGGCGCTGGCTTCTG
CAGTGGACCAAGCACCAGTGGCTTCGGCAGTGGACTGAACACTGGAGCTGGCTTCAGCAG
TGGACCGAGCACTGGTGCTGGCTTTGGTGGTGGAGCCACCAGCCTTCGTGCCTGTGGCTT
CTCCTATGGCTAGTGAGGTTTCAGGTAATTGTAATATCTTTATTACCAGGGCCCATGAGG
TTGGGTATGAGTTGGGAGATGTTATAAGAAACCCCGGGGTGGGAGAGTGGGGTGGGAAGA
TGAGGCAATGAGGGAAGTATGAGAAAACAGTATATTTAGTGCTAAAATGTGTTCCTGTGT
ATTTTGTTTTCAGGTTTATTCCCCACATTTACAGATACCACTAATGAATTGCAACAGTCC
TTCCCATGGAGTCAAGATACATCCATGGAATCTTTGTCCACACATCAGTCTAAGCAGCCA
TGACCAAACAGCTGAGGATGACATGCTGTGAAAAATCTGTTTGCCATTTCTGCTTTATTG
TTTGCTTCCTGTATGCTGTCATATTTTGCTATCAGAGTTACATTAAATTTGCAAAATGAA
TTGGAGTTTTTTCCTGTTTTTTAATGTTCTTAGGTAGTTGTGGAGTGGCATCTTGGGTAG
TTGTGGCATCTTGAATTCATAGAAAAGCAGGAGATCAGCATAGCTTTTTAGGGAAGGTGA
GGCTCCAATTTTTGGCTCAAAGGCAAGTATGACTTCAGCAGAATAGAGGCTCGGGGAAAG
CATGGCCGGCAAGAATATAATAGCTTGAGAAAAGATATGGAGGGGGAAAGCCTGGAGCAG
AAGGCAAAGCAAGAGGGTTCTGGACAGTAAGTACAGATTCATTTTGATTCGTTTGTATAA
GAATGGAGGAATAGAGGGGGAGGTAATGAGGGTAGGACACAGGAACAAGGGAGGGATTTC
TTAGGATAGGAAAGACTTGAGCATATTGCATAGACTGTGGGGCAAAAGTCAATAGAGAGG
GACAGGAGAAAGACATGAAAGAATCAGCAATTGACTGAAGTAGCCCGTCCCTGAGAAAGT
AGGATGGATTATGGTGCCAGATAATAGAAGGTGACCCTGACTTCGAAGAGGATTTAAGGG
TGGCTATGGAAGCAGTTATAGATCTGCTTCAAGCAGTAATCAGCAACTCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1270, 1274..1699, 1702..2091, 16114..16218, 17141..17204, 17305..17384, 17485..17576, 18672..18751, 18845..18887, 19270..19332, 19895..20009, 20797..22350, 22369..22992
1001..1270, 1274..1699, 1702..2091, 16114..16218, 17141..17204, 17305..17384, 17485..17576, 18672..18751, 18845..18887, 19270..19332, 19895..20009, 20797..22350, 22369..22989
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved